A real-time fluorescent quantitative PCR detection method, primer probe set and kit for xanthomonas albilineans
Patent Information
- Application Number
- CN202611018577.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-07-09
- Publication Date
- 2026-08-21
AI Technical Summary
[0009]本发明针对现有甘蔗白条黄单胞菌检测技术中存在特异性不足、灵敏度有限、定量能力较弱以及难以准确检测潜伏侵染样品等问题,提供一种基于Xal_000736特异序列的甘蔗白条黄单胞菌实时荧光定量PCR检测方法、引物探针组及试剂盒
[0025] (1) Xal_000736 was discovered and applied for the first time as a specific detection target for Xanthomonas spp. in sugarcane. Through systematic comparative genomics analysis, the present invention screened the Xal_000736 gene at the whole genome level. This gene is highly conserved in Xanthomonas spp. in sugarcane, and no homologous sequence is found in other closely related Xanthomonas bacteria or sugarcane endophytes. This fundamentally improves the specificity of detection at the level of detection target and overcomes the technical defects of existing technologies that rely on conserved genes and thus cause cross-reactivity.
Smart Images

Figure CN122609733A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular detection technology of plant pathogens, and particularly relates to a real-time fluorescence quantitative PCR detection method, primer and probe set and kit for Xanthomonas sugarcane. Background Technology
[0002] sugar cane( Saccharum Sugarcane (spp. hybrid) is one of the world's most important sugar crops and a crucial source of raw materials for bioenergy and bio-based materials. Globally, sugarcane cultivation area exceeds 25 million hectares, with an annual output exceeding 1.8 billion tons. my country is one of the world's major sugar-producing countries, with sugarcane sugar production consistently accounting for over 90% of the nation's total sugar production. Guangxi Zhuang Autonomous Region ranks first in both sugarcane cultivation area and sugar production, playing an irreplaceable role in ensuring national sugar security and promoting regional economic development. However, sugarcane production is constantly threatened by various diseases, among which sugarcane white streak scald is caused by Xanthomonas sugarcane white streak (…). Xanthomonas albilineans Xal (Xal) is a systemic bacterial disease affecting the vascular bundles and has become a major limiting factor affecting sugarcane yield and quality.
[0003] Sugarcane white streak disease is widely distributed in major sugarcane-growing regions worldwide, including Asia, the Americas, Africa, and Oceania. It has also occurred to varying degrees in sugarcane-growing areas of Guangdong, Guangxi, Hainan, and Yunnan provinces in my country. The pathogen is primarily spread over long distances through infected seed stalks, but can also spread in the field through mechanical damage and agricultural operations. *Xanthomonas sugarcaneus* exhibits significant latent infection characteristics, capable of colonizing the vascular tissue of the host for extended periods without showing obvious external symptoms. When plants encounter high temperatures, drought, or other abiotic stresses, the latent pathogen rapidly multiplies, leading to a sudden outbreak of the disease. Typical symptoms include continuous or discontinuous white pencil-like streaks along the midrib of the leaves. In severe cases, this can further develop into leaf necrosis, top rot, stem shrinkage, and even the death of the entire plant, causing serious losses to sugarcane yield and sugar content.
[0004] Because *Xanthomonas whitestrum* primarily colonizes the vascular tissue of sugarcane and its latent infection is extremely common, accurate diagnosis of this disease cannot be achieved solely through field symptom observation, especially during periods when symptoms are not obvious or when latent infection is present, leading to a high risk of missed detection. Therefore, establishing rapid, accurate, and highly sensitive molecular detection techniques is of great significance for early disease monitoring and warning, seedling quarantine, disease-free seedling production, and disease-resistant breeding.
[0005] Currently, the main methods for detecting *Xanthomonas sugarcaneensis* include pathogen isolation and culture, serological detection, and molecular biological detection. Pathogen isolation and culture has long been considered the traditional gold standard for identification; however, this method is cumbersome and time-consuming, typically requiring 5-10 days or even longer to obtain definitive results. Furthermore, it is highly susceptible to contamination by saprophytic bacteria and other contaminants during the isolation process, demanding a high level of technical experience from operators, making it unsuitable for rapid screening of large batches of samples. Serological detection methods, such as enzyme-linked immunosorbent assay (ELISA), while possessing certain throughput and efficiency, have sensitivity and specificity that largely depend on antibody quality and batch stability. They often fall short in detecting low-abundance pathogens, easily leading to false negatives.
[0006] With the rapid development of molecular biology techniques, conventional PCR, real-time quantitative PCR (qPCR), and loop-mediated isothermal amplification (LAMP) have been gradually applied to the detection of sugarcane white streak disease. Among these, detection methods based on the 16S rRNA gene are problematic because this gene is highly conserved among bacteria, easily leading to cross-amplification between different species of Xanthomonas and even other closely related genera, resulting in a risk of false positives. While housekeeping genes such as gyrB have improved detection specificity to some extent, high sequence homology still exists among closely related species, failing to completely solve the problem of insufficient specificity. LAMP technology offers advantages such as ease of operation, rapid reaction speed, and no need for expensive instruments, making it suitable for rapid initial screening at the grassroots level and in the field. However, its quantitative ability of amplified products is very limited, making it difficult to accurately determine the pathogen load and hindering precise assessment of latent infection levels and disease development trends.
[0007] In recent years, real-time quantitative PCR (qPCR) technology has become an important tool in the field of plant pathogen detection due to its outstanding advantages such as high sensitivity, strong specificity, and the ability to perform quantitative analysis. However, most existing qPCR detection systems for *Xanthomonas whitestrum* in sugarcane still rely on primers and probes designed based on conserved gene regions such as 16S rRNA and ITS, leaving considerable room for improvement in their detection specificity. Especially when dealing with complex field samples containing abundant plant tissue background and endophytic bacterial communities, existing detection systems often exhibit non-specific amplification signals or insufficient sensitivity for low-abundance target bacteria, making it difficult to accurately distinguish between latently infected samples and healthy samples. This severely restricts the early diagnosis and precise control of sugarcane whitestrum disease.
[0008] Therefore, there is an urgent need to develop a new detection technology based on novel specific molecular targets that can efficiently distinguish Xanthomonas white stripe from other closely related bacteria and endophytes, while also possessing high sensitivity and quantitative detection capabilities. This is of great practical significance for comprehensively improving the early diagnosis level of sugarcane white stripe disease, ensuring the production of healthy seedlings, and achieving precise prevention and control of the disease. Summary of the Invention
[0009] This invention addresses the shortcomings of existing Xanthomonas white-striped bacteria detection technologies, such as insufficient specificity, limited sensitivity, weak quantitative capabilities, and difficulty in accurately detecting latent infections. It provides a real-time quantitative PCR detection method, primer and probe set, and kit based on the Xal_000736 specific sequence for Xanthomonas white-striped bacteria. Through comparative genomics analysis, this invention screens the species-specific molecular marker Xal_000736 from the Xanthomonas white-striped bacteria genome. Based on this target, specific primers and TaqMan probes are designed to establish a highly sensitive real-time quantitative PCR detection system, enabling rapid, accurate, and quantitative detection of Xanthomonas white-striped bacteria. This invention aims to solve the technical problems of non-specific amplification, insufficient detection sensitivity, and difficulty in identifying latent infections in the field found in existing detection methods, providing reliable technical support for sugarcane white-striped disease monitoring and early warning, disease-free seedling certification, disease epidemiological surveys, and disease-resistant breeding.
[0010] To achieve the above-mentioned objectives, the present invention provides the following technical solution.
[0011] On the one hand, the present invention provides a method for detecting Xanthomonas sugarbhae (… Xanthomonas albilineans The method uses the specific gene Xal_000736 of Xanthomonas sugarcane as the detection target to amplify and detect the nucleic acid in the sample to be tested, and determines whether Xanthomonas sugarcane is present in the sample to be tested based on the amplification results. The nucleotide sequence of the Xal_000736 gene is shown in SEQ ID NO.4.
[0012] As a preferred embodiment of the method described in this invention, the nucleic acid amplification detection uses real-time quantitative PCR, and the primers and probes used specifically bind to the region of the sequence shown in SEQ ID NO.4.
[0013] More preferably, the nucleotide sequence of the forward primer used in the real-time quantitative PCR is shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.2.
[0014] More preferably, the nucleotide sequence of the probe used in the real-time quantitative PCR is shown in SEQ ID NO.3; the 5' end of the probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group. In one specific embodiment, the fluorescent reporter group is FAM, and the fluorescent quencher group is BHQ1.
[0015] Preferably, the reaction procedure for the real-time quantitative PCR is as follows: pre-denaturation at 95°C for 300 seconds; followed by 40-45 cycles of denaturation at 95°C for 10 seconds, annealing at 60°C and extension for 30 seconds, with fluorescence signal collected at the end of the annealing and extension steps at 60°C.
[0016] Preferably, the positive determination criteria of the detection method of the present invention are as follows: samples with a typical S-type fluorescence amplification curve and a Ct value ≤ 35 during the amplification cycle are determined to be positive; samples with a Ct value > 35 or without a typical amplification curve are determined to be negative or suspicious samples.
[0017] Preferably, the detection limit of the detection method of the present invention is not higher than 100 fg / μL. More preferably, the detection limit of the detection method of the present invention is between 100 fg / μL and 10... 8 The template concentration range of fg / μL showed good linearity, with the standard curve regression equation being Y = -3.246X + 39.10 and a coefficient of determination R0. 2 =0.9993, amplification efficiency of 103.27%, where Y represents the Ct value and X represents the logarithm of the template DNA concentration.
[0018] On the other hand, the present invention provides a method for detecting Xanthomonas leucosus (…). Xanthomonas albilineans The primer-probe set includes a forward primer with the nucleotide sequence shown in SEQ ID NO.1, a reverse primer with the nucleotide sequence shown in SEQ ID NO.2, and a probe with the nucleotide sequence shown in SEQ ID NO.3; the 5' end of the probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group. Preferably, the 5' end fluorescent reporter group of the probe is FAM, and the 3' end fluorescent quencher group is BHQ1.
[0019] On another front, the present invention provides a method for detecting Xanthomonas leucosus (…). Xanthomonas albilineans The kit contains the primer and probe set described above.
[0020] As a preferred embodiment of the kit described in this invention, the kit further comprises a positive standard, a negative control, a PCR reaction solution, and an instruction manual; wherein, the positive standard is genomic DNA of Xanthomonas canis or a recombinant plasmid containing the sequence shown in SEQ ID NO.4; the negative control is nuclease-free water; and the PCR reaction solution comprises hot-start DNA polymerase, dNTPs, MgCl2, and PCR buffer.
[0021] Furthermore, the present invention also provides the above-mentioned primer and probe set or the above-mentioned kit for detecting Xanthomonas sugarcaneus (… Xanthomonas albilineansApplications in the field of sugarcane seedling quarantine, disease-free seedling certification, disease monitoring and early warning, quantitative analysis of pathogens, or evaluation of disease-resistant breeding.
[0022] The Xal_000736 specific detection target described in this invention was first discovered and applied to the detection of *Xanthomonas sugarcane* through systematic comparative genomics analysis. The inventors conducted a comprehensive comparative analysis of the whole genome sequence of *Xanthomonas sugarcane* JG43 with the genome sequences of several closely related *Xanthomonas* species, including... Xanthomonas sacchari , Xanthomonas campestris pv. campestris , Xanthomonas oryzae pv. oryzae , Xanthomonas oryzae pv. oryzicola , Xanthomonas citri and Xanthomonas translucens Through genome-wide BLAST analysis, homologous gene clustering analysis, and stepwise screening of specific sequences, multiple candidate specific loci were obtained.
[0023] Based on this, the inventors further set strict secondary screening criteria, including: (1) the sequence exists only in Xanthomonas albilineans In the genome; (2) in all published Xanthomonas albilineans (3) The sequence is highly conserved in the genome; (4) No homologous sequences are found in other Xanthomonas species or even closely related species; (5) The sequence region is suitable for designing real-time quantitative PCR primers and TaqMan probes; (6) The expected amplification fragment length is appropriate to ensure high amplification efficiency. After layers of screening and verification, the Xal_000736 gene was finally determined as the optimal detection target. The NCBIL database comparison confirmed that the sequence exists only in the genome of Xanthomonas canis and no significant homologous sequences were found in other closely related Xanthomonas species and microorganisms, which fully demonstrates its extremely high species specificity and sequence conservation, and fundamentally ensures the high specificity of the detection method based on it.
[0024] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in the following aspects.
[0025] (1) Xal_000736 was discovered and applied for the first time as a specific detection target for Xanthomonas spp. in sugarcane. Through systematic comparative genomics analysis, the present invention screened the Xal_000736 gene at the whole genome level. This gene is highly conserved in Xanthomonas spp. in sugarcane, and no homologous sequence is found in other closely related Xanthomonas bacteria or sugarcane endophytes. This fundamentally improves the specificity of detection at the level of detection target and overcomes the technical defects of existing technologies that rely on conserved genes and thus cause cross-reactivity.
[0026] (2) Significantly improved detection specificity. The 0736-F1 / R1 / P1 detection system established in this invention can accurately identify *Xanthomonas canis* strains from different geographical sources and collection years. All target strains produce stable and strong amplification signals, while... Xanthomonas sacchari Non-target bacteria such as Herbaspirillum, Pantoea, Luteibacter, and Chryseobacterium showed no specific amplification, demonstrating excellent detection specificity.
[0027] (3) Significantly improved detection sensitivity. The stable detection limit of the real-time quantitative PCR detection system established in this invention reaches 100 fg / μL, which is significantly lower than the lowest detection limit of conventional PCR (10 fg / μL). 4 The concentration of bacteria (fg / μL) is increased by about 100 times, which can meet the needs of sensitive detection of low-abundance pathogens and latently infected samples.
[0028] (4) Possesses excellent quantitative detection capabilities. The standard curve established by this invention exhibits good linearity, with a regression equation of Y = -3.246X + 39.10 and a coefficient of determination R0. 2 =0.9993, amplification efficiency of 103.27%, and all indicators fully meet the MIQE guideline recommendations, within the range of 100 fg / μL to 10 8 Accurate determination of pathogen load can be achieved over a wide concentration range of fg / μL, providing a reliable means for epidemiological analysis of diseases and precise assessment of infection severity.
[0029] (5) It has good repeatability, is easy to operate, and is suitable for large-scale promotion and application. The intra-batch and inter-batch coefficients of variation of the detection system of this invention are both less than 2%, showing excellent stability and reproducibility. The entire detection process can be completed within 3 hours, the operation steps are standardized, and it can be widely used in many fields such as sugarcane seedling quarantine, disease-free seedling certification, field disease monitoring and early warning, and disease resistance breeding evaluation, with significant social benefits and industrial application value. Attached Figure Description
[0030] Figure 1 Flowchart for screening specific targets of Xal_000736, a strain of Xanthomonas canis.
[0031] Figure 2 The results of sequence comparison of the Xal_000736 gene in Xanthomonas canis and closely related Xanthomonas species are presented.
[0032] Figure 3 A schematic diagram showing the design locations of primers and probes for the Xal_000736 gene region.
[0033] Figure 4 The results of routine PCR amplification using the 0736 primer set and the backup primer set under different template DNA concentrations are shown.
[0034] Figure 5 The results show the specificity of the 0736-F1 / R1 / P1 system against different strains of Xanthomonas sclerotium from sugarcane and non-target bacteria.
[0035] Figure 6 The amplification curves were obtained by real-time fluorescence quantitative PCR detection of different concentrations of Xanthomonas canis DNA in the 0736-F1 / R1 / P1 system.
[0036] Figure 7 The standard curve and linear regression analysis results for the 0736-F1 / R1 / P1 system are shown.
[0037] Figure 8 The results show the comparison of sensitivity and specificity between the 0736 detection system and the existing xal-FR detection system.
[0038] Figure 9 Statistical analysis chart of field sample test results from different regions.
[0039] Figure 10 This is a schematic diagram illustrating the quantitative detection of pathogens in sugarcane tissue using the detection system of this invention. Detailed Implementation
[0040] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0041] All raw materials used in this invention are not particularly limited in their source; they can be purchased from the market or prepared using conventional methods known to those skilled in the art.
[0042] There are no particular restrictions on the purity of any of the raw materials used in this invention. However, this invention preferably uses raw materials of analytical grade or purity commonly used in the field of chemical synthesis.
[0043] The primers and sequences involved in this invention are as follows: SEQ ID NO.1: 0736-F1: 5'-GCGAGAACAGCTTCAGAGAA-3' SEQ ID NO.2: 0736-R1: 5'-GGTGTTTGACGAGACTGTAGG -3' SEQ ID NO.3: 0736-P1: 5’-ATCCGCTCAATGCTGATCGCAAAC -3’ SEQ ID NO.4: GTGCTCGCTCTCACAATCCTCGCCGAGGCCGGCGATCTGCGGCGCTTTGCACATCACCGGCAGTTCCTGAAGTACTGCGGGTTGGACCTGGCCAAATGCCAGTCCGGTCAGTTTCGCGGTCAGGAGAAGCTCTCCAAGCGCGGCAACGCACGCTTGCGTTTCGCGTTCTGGTTCGCGGCTACGGTTGCAGTGCGTATGCGCGAGAACAGCTTCAGAGAAAAGTACGAGCGCTACATCCGGTCCGATCCGCTCAATGCTGATCGCAAACGTAAGGCACTCACGGCCGTGGCGGCCAAGATGGCGCGGGTCGCCTACAGTCTCGTCAAACACCAATCCAGCTACCGCTGCTACTTCGAAACGAGTTTACCCCCCGTGGATCGACCCCTCTCTGTTGGGCCGTCGGGACCGCTTAGGATCCTGTAG SEQ ID NO.5: 16S-F :5’-AGTGAACGCTGGCGGCAGGC -3’ SEQ ID NO.6: 16S-R :5’-GCACCTTCCGATACGGCTAC -3’ SEQ ID NO.7: 0736-F2: 5’-CTTGCGTTTCGCGTTCTG-3’ SEQ ID NO.8: 0736-R2: 5’-GGATGTAGCGCTCGTACTTT-3’ SEQ ID NO.9: 0736-P2: 5’-CGTATGCGCGAGAACAGCTTCAGA-3’ SEQ ID NO.10: 0736-F3: 5’-GCTCGCTCTCACAATCCTC -3’ SEQ ID NO.11: 0736-R3: 5'-CTGACCGGACTGGCATTT-3' SEQ ID NO.12: 0736-P3: 5'-CACATCACCGGCAGTTCCTGAAGT-3' Example 1: Isolation, identification, and genome sequencing of pathogens This embodiment is used to obtain the detection targets and strain resources required for verification of the present invention. From 2016 to 2024, the inventors systematically collected multiple leaf samples exhibiting typical symptoms of sugarcane white streak disease in major sugarcane producing areas such as Guangxi Zhuang Autonomous Region and Hainan Province. Using SM selective medium, the vascular bundle sap of the diseased leaf tissue was serially diluted and spread, and cultured in the dark at 28℃ for 3-5 days. After colonies grew, single colonies with typical morphological characteristics of Xanthomonas sugarcane white streak were selected and purified by streak plating three times, finally obtaining 8 purified Xanthomonas sugarcane white streak isolates and 10 sugarcane endophytic bacteria isolates.
[0044] PCR amplification of the 16S rRNA gene was performed on all isolates using universal bacterial primers 16S-F (SEQ ID NO. 5) and 16S-R (SEQ ID NO. 6). The PCR products were purified by gel excision and then sequenced. The obtained sequences were subjected to BLAST (Basic Local Alignment Search) homology analysis in the NCBI (National Center for Biotechnology Information) database. Based on the alignment results, eight strains were identified as *Xanthomonas canis* (a bacterium). Xanthomonas albilineans The remaining 10 strains were identified and classified into the genera *Herbaspirillum*, *Chryseobacterium*, *Pantoea*, *Luteibacter*, and others. Xanthomonas sacchari Different genera and species. In addition, to obtain more comprehensive genomic information as a basis for subsequent target screening, the inventors also performed whole-genome resequencing on all eight identified Xanthomonas sugarcane strains and submitted the assembled genome sequences to the NCBI database to obtain precise genetic information of each strain at the whole-genome level.
[0045] Example 2: Screening for the specific detection target Xal_000736 To obtain molecular detection targets capable of specifically recognizing *Xanthomonas canis*, this embodiment employed a systematic screening method using comparative genomics analysis. The specific procedure is as follows: Figure 1 As shown. First, the whole genome sequences of several representative strains of Xanthomonas were collected and downloaded from public databases and the self-test data of Example 1, including but not limited to: Xanthomonas albilineansJG43, Xanthomonas sacchari DD13 Xanthomonas campestris pv. campestris 8004 Xanthomonas oryzae pv. oryzae PXO99A, Xanthomonas oryzae pv. oryzicola GX01, etc.
[0046] Using software tools such as BLAST, Roary, and OrthoFinder, pan-genome analysis and homologous gene clustering were performed on the whole genome of the above strains. Based on this, the following strict screening conditions were set: (1) The gene sequence exists only in Xanthomonas albilineans (2) In all sequenced genomes Xanthomonas albilineans (2) The strain is highly conserved; (3) No significant homologous sequences are found in other Xanthomonas species or even closely related species; (4) The gene sequence region has physical characteristics suitable for designing real-time quantitative PCR primers and TaqMan probes; (5) The expected amplified fragment length should be less than 150 bp to ensure high amplification efficiency. After screening, the Xal_000736 gene, which is functionally annotated as a putative protein, was finally identified as the best candidate detection target.
[0047] The results of NCBI Blast specificity analysis of the Xal_000736 gene are as follows: Figure 2 As shown, this sequence matches 100% only with the genome sequence of *Xanthomonas canis*, while no significant homologous sequences were found in other non-target closely related *Xanthomonas* and other microorganisms, demonstrating its superiority as a species-specific detection target. Therefore, the Xal_000736 gene was selected as the core target of the detection method of this invention, and its full-length nucleotide sequence is shown in SEQ ID NO.4.
[0048] Example 3: Design and screening of specific primers and TaqMan probes Based on the identified target sequence of the Xal_000736 gene, primers and TaqMan probes for real-time quantitative PCR were designed using the IDT PrimerQuest Tool (Integrated DNA Technologies). The software provided three candidate primer-probe combinations with high overall scores based on parameters such as GC content, Tm value, secondary structure, and dimer formation probability of the template sequence. These three combinations are as follows: Group 1: forward primer 0736-F1 (SEQ ID NO.1), reverse primer 0736-R1 (SEQ ID NO.2), and probe 0736-P1 (SEQ ID NO.3); The second group consists of forward primer 0736-F2 (SEQ ID NO.7), reverse primer 0736-R2 (SEQ ID NO.8), and probe 0736-P2 (SEQ ID NO.9). The third group consists of forward primer 0736-F3 (SEQ ID NO.10), reverse primer 0736-R3 (SEQ ID NO.11), and probe 0736-P3 (SEQ ID NO.12).
[0049] All three probes were labeled with the fluorescent reporter group FAM at their 5' ends and the fluorescent quencher group BHQ1 at their 3' ends. Figure 3 The diagram schematically illustrates the regional structure of the Xal_000736 gene and the approximate binding sites of the three sets of candidate primers and probes mentioned above.
[0050] To select the combination with the best detection performance, Xanthomonas albilineans Using genomic DNA from strain JG43 as a template, the amplification efficiency of three sets of candidate primers was compared using conventional PCR. The genomic DNA was serially diluted 10-fold to 10... 8 10 7 10 6 10 5 10 4 10 3 10 2 and 10 1 Eight concentration gradients (fg / μL) were used for amplification using the three sets of primers described above. The amplified products were detected by 1.5% agarose gel electrophoresis, and the results are as follows: Figure 4 As shown in the electrophoresis pattern, the first primer set (0736-F1 / R1) clearly demonstrates that, compared to the other two primer sets, the amplification bands of the first set (0736-F1 / R1) are the clearest and most uniform at all concentration gradients, with no primer dimers or non-specific bands produced, and the limit of detection reaches 10. 4 The amplification efficiency was the highest among the three groups, with the highest fg / μL, indicating that it was significantly superior in amplification efficiency, sensitivity, and specificity.
[0051] Based on the combined results of Tm value, GC content, dimer formation probability, amplified fragment length, and the aforementioned experimental verification, the first set of primers and probes was ultimately determined to be the optimal primer and probe combination for this invention: forward primer 0736-F1 (SEQ ID NO.1), reverse primer 0736-R1 (SEQ ID NO.2), and TaqMan probe 0736-P1 (SEQ ID NO.3). The product fragment length amplified by this primer pair was 132 bp.
[0052] Example 4: Establishment of a real-time quantitative PCR detection system This embodiment uses the optimal primer-probe set 0736-F1 / R1 / P1 selected in Example 3 to establish a standardized real-time quantitative PCR reaction system and procedure. After optimization, the determined 20 μL total reaction system contains the following components: 10 μL of 2× qPCR Probe Master reaction buffer, 0.4 μL each of the 10 μmol / L forward primer 0736-F1 and reverse primer 0736-R1, 0.2 μL of the 10 μmol / L TaqMan probe 0736-P1, 1 μL of DNA template, and finally, sterile ultrapure water to a final volume of 20 μL. A negative control (NTC) using sterile ultrapure water instead of the DNA template is included in each reaction to ensure the system remains uncontaminated.
[0053] The real-time quantitative PCR reaction program is set as follows: First stage, pre-denaturation at 95℃ for 300 seconds; Second stage, amplification for 40-45 cycles, each cycle including denaturation at 95℃ for 10 seconds and annealing and extension at 60℃ for 30 seconds, with FAM fluorescence signal collected simultaneously at the end of the annealing / extension step.
[0054] Example 5: Detection Specificity Verification To comprehensively evaluate the specificity of the detection system of this invention, the established 0736-F1 / R1 / P1 primer-probe combination and reaction conditions were used to detect all strains isolated and preserved in Example 1. The detection targets included 8 strains of *Xanthomonas canis* (target bacteria) and 10 non-target endophytic bacteria, the latter belonging to *Herbaspirillum*, *Chryseobacterium*, *Pantoea*, *Luteibacter*, and others. Xanthomonas sacchari Ranks, etc.
[0055] Real-time quantitative PCR amplification was performed according to the reaction system and procedure described in Example 4. Specificity verification results are as follows: Figure 5 As shown, all eight strains of *Xanthomonas sugarcane* collected from different regions and years produced strong and stable specific amplification signals, with Ct values concentrated between 14.37 and 15.42, demonstrating excellent intraspecific detection consistency. In contrast, all ten non-target bacteria did not produce typical S-shaped fluorescence amplification curves within 40 cycles. Although some samples showed weak, atypical background signals with Ct values greater than 39 in the later stages of amplification, these signals were weak and had poor repeatability, all far exceeding the positive determination threshold set in this invention, and did not constitute interference. Therefore, this invention explicitly sets the positive determination criterion as: samples showing typical amplification curves and Ct values ≤ 35 within 40 cycles are judged as positive. Under this standard, this detection system achieves 100% detection specificity for *Xanthomonas sugarcane*, accurately distinguishing the target pathogen from common closely related or associated bacteria.
[0056] Example 6: Detection Sensitivity Verification and Standard Curve Construction This embodiment is used to determine the lower limit of sensitivity (LOD) of the detection system of the present invention and to establish a quantitative standard curve. The determination was performed accurately using a NanoDrop 2000 ultra-micro spectrophotometer. Xanthomonas albilineans The concentration of genomic DNA of strain JG43 was then determined by serial dilution with sterile ultrapure water, yielding 10-10... 8 10 7 10 6 10 5 10 4 10 3 10 2 and 10 1 A total of 8 concentration gradients of standards were available, with a concentration of fg / μL.
[0057] Using the standards at these eight concentration gradients as templates, real-time quantitative PCR amplification was performed according to the reaction system and procedure described in Example 4, with three technical replicates for each concentration. The amplification curves are shown below. Figure 6 As shown, the fluorescence signal intensity increases regularly with increasing template concentration, 10 8 fg / μL to 10 2 Samples at concentrations of fg / μL all produced clear and stable S-type amplification curves with good reproducibility. 10 2 The average Ct value for the fg / μL sample was 32.30, while that for the 10 1 The Ct value of the fg / μL sample was close to the background threshold of the negative control, and the reproducibility between technical replicates was poor. Therefore, the stable detection limit (LOD) of the detection system of this invention was determined to be 100 fg / μL (i.e., 10). 2 (fg / μL). Further testing of the same batch of standards using conventional PCR methods revealed a limit of detection of 10. 4 fg / μL. In comparison, the real-time quantitative PCR detection sensitivity of this invention is improved by approximately 100 times.
[0058] To establish a quantitative standard curve, 10 8 fg / μL to 10 2 Regression analysis was performed on data from seven concentration gradient standards (fg / μL). The log10 value of the initial DNA concentration (fg / μL) of each standard was plotted as the x-axis (X), and the corresponding mean Ct value as the y-axis (Y), for linear regression fitting. The results are as follows: Figure 7 As shown, the standard curve regression equation is Y = -3.246X + 39.10, and the coefficient of determination R0 is... 2=0.9993, showing an extremely high linear correlation. The amplification efficiency E=
[10] calculated from the equation slope. (-1 / slope) -1]×100%=103.27%, this efficiency value fully meets the optimal range of 90%~110% recommended by the MIQE (Minimum Information for Real-Time Quantitative PCR) guidelines. The above results indicate that the detection system of this invention is effective at concentrations from 100 fg / μL to 10... 8 It exhibits excellent linearity and quantitative accuracy within the template concentration range of fg / μL, enabling precise determination of Xanthomonas leuciscus load in sugarcane.
[0059] Example 7: Repeatability Detection To systematically evaluate the intra-batch and inter-batch repeatability and stability of the detection system of this invention, three representative standard concentrations—high, medium, and low—were selected, i.e., 10-1. 6 fg / μL, 10 4 fg / μL and 10 2 fg / μL was used for repeatability experiments. In the same batch of real-time quantitative PCR reactions, three technical replicates were set up for each concentration to calculate the intra-batch coefficient of variation; the above experiments were independently repeated three times under the same conditions to calculate inter-batch variation. The mean, standard deviation (SD), and coefficient of variation (CV) were calculated by analyzing the Ct values of each concentration sample across different replicates.
[0060] The results showed that this detection system exhibited excellent repeatability: 10 6 The high concentration group (fg / μL) had an average Ct value of 19.62 ± 0.18 and a coefficient of variation of 0.92%; 10 4 In the concentration group of fg / μL, the average Ct value was 25.83±0.24, and the coefficient of variation was 0.93%; 10 2 The average Ct value for the low concentration group (fg / μL) was 32.30±0.41, with a coefficient of variation of 1.27%. The intra- and inter-batch coefficients of variation for all tested concentration gradients were well below 2%, indicating that the 0736-F1 / R1 / P1 detection system of this invention exhibits extremely high accuracy and stability across different batches and concentrations, fully meeting the quality control requirements for large-scale, standardized sample testing, and providing reliable results.
[0061] Example 8: Comparative Analysis with Existing Detection Technologies To objectively evaluate the technological advancements of this invention, a comprehensive performance comparison was conducted between the 0736-F1 / R1 / P1 detection system (hereinafter referred to as the "0736 system") established in this invention and existing xal-FR primer detection systems designed based on different targets. The comparison was performed on the same experimental platform and under the same conditions. The detection targets included 8 strains of Xanthomonas sugarcaneus, 10 non-target bacteria, and serially diluted DNA standards. Evaluation indicators covered specificity, sensitivity, and standard curve quality.
[0062] The comparison results are as follows Figure 8 In terms of specificity, the 0736 system accurately identified and amplified all eight strains of *Xanthomonas canis*, while showing no positive amplification for the ten non-target bacteria. In contrast, the xal-FR system, while detecting the target bacteria, also showed visible weak amplification signals in some closely related non-target bacteria, indicating a certain risk of cross-reactivity. Regarding sensitivity, using serially diluted genomic DNA as a template, the 0736 system achieved a stable detection limit of 100 fg / μL, superior to the xal-FR system. In terms of standard curve construction, the 0736 system yielded a standard curve with a coefficient of determination R0. 2 The amplification efficiency reached 0.9993 and was 103.27%, both superior to the control system. In summary, the detection system based on the Xal_000736 specific sequence provided by this invention demonstrates significant advantages over existing technologies in key performance indicators such as specificity, sensitivity, and quantitative accuracy.
[0063] Example 9: Field Sample and Reagent Kit Application Validation To verify the application effect of the detection system of the present invention in actual production, field samples were systematically collected from major sugarcane producing areas such as Guangxi, Hainan, and Yunnan. These samples included plants with typical white streak disease, suspected infected plants, and asymptomatic plants that appeared healthy in the field. Using a commercially available plant genomic DNA extraction kit, total DNA was extracted from the vascular bundle tissue of sugarcane leaves at different stages. Using this DNA as a template, real-time quantitative PCR detection was performed using the detection system established in Example 4.
[0064] The statistical distribution of field sample test results is as follows Figure 9As shown, the detection system of this invention detected high levels of pathogen load in all typical diseased plant samples. Notably, low abundance levels of pathogen signals were also detected in some seemingly healthy and asymptomatic sugarcane samples, clearly demonstrating the system's ability to quantitatively distinguish between different disease states, including healthy, latent infection, and diseased states. This further confirms that *Xanthomonas sugarcane* can be prevalent in the field as a latent infection, and that the detection system of this invention has the capability for early diagnosis and quantitative monitoring of the pathogen before symptoms appear. Simultaneously, validation using conventional PCR methods on the same batch of samples showed that the positive detection rate of the real-time quantitative PCR detection system established in this invention was significantly higher than that of conventional PCR, making it particularly suitable for accurate detection of samples with low pathogen loads and latent infection.
[0065] To promote the standardization and industrial application of this technology, the core components constituting the detection system were further assembled into a kit. The kit includes forward primer 0736-F1, reverse primer 0736-R1, TaqMan probe 0736-P1, a positive standard containing a recombinant plasmid with the target fragment, nuclease-free water as a negative control, and a premixed 2×qPCR reaction solution with optimized formulation. Detailed instructions for use are included, clearly specifying the operating procedures and interpretation criteria. This kit was used to perform blind testing on randomly selected sugarcane samples from different sources to verify the entire detection process (…). Figure 10 From sample DNA extraction, reaction system preparation, instrument operation to result analysis, the total time was controlled within 3 hours. The results for all tested samples were consistent with those obtained using the standard methods previously established in the laboratory. This indicates that the reagent kit provided by this invention has good stability, convenience, and accuracy, and can meet the needs of various application scenarios such as grassroots laboratories, seedling quality inspection, and field disease monitoring, possessing broad application prospects and significant industrialization value.
[0066] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A method for detecting Xanthomonas whitestrum in sugarcane ( Xanthomonas albilineans The method, characterized in that, Using the specific gene Xal_000736 of Xanthomonas sugarcane as the detection target, the nucleic acid in the sample to be tested was amplified and detected, and the presence of Xanthomonas sugarcane in the sample was determined based on the amplification results. The nucleotide sequence of the Xal_000736 gene is shown in SEQ ID NO.
4.
2. The method according to claim 1, characterized in that, The nucleic acid amplification detection uses real-time quantitative PCR, and the primers and probes used specifically bind to the region of the sequence shown in SEQ ID NO.
4.
3. The method according to claim 2, characterized in that, The nucleotide sequences of the forward and reverse primers used in the real-time quantitative PCR are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively.
4. The method according to claim 3, characterized in that, The nucleotide sequence of the probe used in the real-time quantitative PCR is shown in SEQ ID NO.3; the 5' end of the probe is labeled with a fluorescent reporter group and the 3' end is labeled with a fluorescent quencher group.
5. The method according to claim 4, characterized in that, The fluorescent reporter group is FAM, and the fluorescent quencher group is BHQ1.
6. A method for detecting Xanthomonas leucosus (a type of bacteria) Xanthomonas albilineans The primer and probe set of ) is characterized in that, It includes a forward primer with a nucleotide sequence as shown in SEQ ID NO.1, a reverse primer with a nucleotide sequence as shown in SEQ ID NO.2, and a probe with a nucleotide sequence as shown in SEQ ID NO.3; the probe is labeled with a fluorescent reporter group at its 5' end and a fluorescent quencher group at its 3' end.
7. The primer-probe set according to claim 6, characterized in that, The probe has a 5' fluorescent reporter group (FAM) and a 3' fluorescent quencher group (BHQ1).
8. A method for detecting Xanthomonas whitestrum in sugarcane ( Xanthomonas albilineans The reagent kit is characterized by, It includes the primer and probe set as described in claim 6 or 7.
9. The reagent kit according to claim 8, characterized in that, It also includes positive standards, negative controls, PCR reaction solutions and instructions for use; the positive standards are genomic DNA of Xanthomonas canis or recombinant plasmids containing the sequence shown in SEQ ID NO.
4.
10. The primer and probe set according to claim 6 or 7, or the kit according to claim 8 or 9, for the detection of Xanthomonas sugarcaneus (… Xanthomonas albilineans Applications in sugarcane seedling quarantine, disease-free seedling certification, disease monitoring and early warning, quantitative analysis of pathogens, or evaluation of disease-resistant breeding.