A molecular identification method of bacillus velezensis based on combination of acr3 and yerp gene markers
Patent Information
- Application Number
- CN202611104807.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-07-24
- Publication Date
- 2026-08-21
AI Technical Summary
此类方法需首先对样品进行富集与选择性培养,获得单菌落后再进行显微镜观察、生化鉴定或上机检测,实验操作繁琐、耗时长、成本高
(1)本发明首次揭示并验证acr3基因与yerP基因的组合可以作为特异性鉴定贝莱斯芽孢杆菌的分子靶标,该双基因组合的应用,克服了传统基于单一基因(如16S rRNA)无法有效区分贝莱斯芽孢杆菌与其近缘种的技术缺陷;
Smart Images

Figure CN122609736A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of microbial detection technology, and particularly to a method based on... acr3 and place Molecular identification method for Bacillus belesi based on a combination of genetic markers. Background Technology
[0002] *Bacillus velière* was first reported in 2005, isolated from the estuary of the Belé River by Spanish scientists Ruiz-García et al., and named *Bacillus velière*, a new species in the genus *Bacillus*. *Bacillus velière* is a Gram-positive aerobic strain with milky-white, opaque, round colonies that are slightly convex in the center or crater-like. Under a microscope, the bacteria are rod-shaped, arranged singly or in pairs, varying in size, and contain endospores, existing in both vegetative somatic cells and dormant spore forms. Compared to vegetative cells, spores exhibit strong resistance to adverse conditions, surviving in environments with high ethanol and low acidity. *Bacillus velière* is widely distributed in natural environments such as soil, water, and air. With increased research attention, scientists both domestically and internationally have isolated and screened *Bacillus velière* from fermented foods such as baijiu (Chinese liquor) and fermented black beans. The morphology, physicochemical reactions, and metabolites of the obtained strains vary, which is related to the source of the isolated strains. Therefore, *Bacillus belyssae*, as a novel bacterium, has significant research value and broad development prospects. Currently, detection methods for *Bacillus belyssae* mainly include morphological detection after isolation and culture, biochemical tests, or mass spectrometry. These methods require initial enrichment and selective culture of samples to obtain single colonies before microscopic observation, biochemical identification, or instrumental detection. The experimental procedures are cumbersome, time-consuming, and costly. In recent years, with the rapid development of molecular biology, molecular biological detection methods, primarily PCR, have gradually replaced traditional culture and biochemical detection methods, becoming one of the most promising new technologies in microbial detection. The key to nucleic acid detection methods lies in the selection of target genes or target sequences, i.e., finding nucleotide sequences unique to the target species for detection design. This invention provides a simple, rapid, efficient, and highly sensitive molecular identification method for *Bacillus belyssae*. Summary of the Invention
[0003] To address the aforementioned shortcomings of existing technologies, this invention proposes a method based on... acr3 and place A molecular identification method for Bacillus belesi based on a combination of gene markers is proposed to address the problems raised in the background section.
[0004] To achieve the above objectives, the present invention provides the following technical solution: This invention provides a method based on acr3 and placeA molecular identification method for Bacillus belesi based on a combination of genetic markers, acr3 Genes and place Genes as molecular targets, the acr3 The nucleotide sequence of the gene is shown in SEQ ID NO.1. place The nucleotide sequence of the gene is shown in SEQ ID NO.2, and includes the following steps: (1) Extract DNA from the sample to be tested; (2) Design specific primer pairs: acr3 The primer pair 1 for the gene is acr3-F and acr3-R, and their nucleotide sequences are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively. place The primer pair 2 for the gene is yerP-F and yerP-R, and their nucleotide sequences are shown in SEQ ID NO.5 and SEQ ID NO.6, respectively. (3) PCR amplification: Using the DNA of the sample to be tested obtained in step (1) as a template, PCR amplification was performed independently using primer pair 1 and primer pair 2 to obtain two amplification products; (4) Result detection: The two amplification products obtained in step (3) are detected by agarose gel electrophoresis. If the target bands are observed in the electrophoresis results, the sample to be tested is determined to be Bacillus belesii; if the target bands of the two amplification products are not observed at the same time, the sample to be tested is determined to be Bacillus belesii.
[0005] Preferably, the PCR amplification in step (2) includes the preparation of the total PCR system and the PCR amplification reaction.
[0006] Preferably, the total PCR system includes PCR reaction reagents (2×Rapid Taq Master Mix), double-distilled water (ddH2O), DNA template, and PCR amplification primers.
[0007] Preferably, the total PCR system contains the following components: 12.5 μL of 2×Rapid Taq Master Mix, 10.5 μL of ddH2O, 1.0 μL of DNA template, 0.50 μL of upstream primer, and 0.50 μL of downstream primer.
[0008] Preferably, the PCR amplification reaction program is as follows: pre-denaturation at 95°C for 7 min; denaturation at 95°C for 15 s, annealing at 58°C for 15 s, extension at 72°C, for 32 cycles; and final incubation at 72°C for 10 min; the extension time is 50 s or 75 s. The amplification products are stored at 12°C.
[0009] Preferably, in step (4), the target band amplified by primer pair 1 is 960 bp in size, and the target band amplified by primer pair 2 is 3144 bp in size.
[0010] The present invention provides the application of the molecular identification method for Bacillus belyssus described herein in the following (1) or (2): (1) To identify or assist in the identification of whether the test strain is Bacillus belesii; (2) To detect or assist in the detection of whether Bacillus belese exists in the sample to be tested.
[0011] The present invention also provides a rapid multiplex PCR detection kit for Bacillus belyssus, the kit comprising primer pair 1 and primer pair 2; primer pair 1 is acr3-F and acr3-R, the nucleotide sequences of which are shown in SEQ ID NO. 3 and SEQ ID NO. 4, respectively; primer pair 2 is yerP-F and yerP-R, the nucleotide sequences of which are shown in SEQ ID NO. 5 and SEQ ID NO. 6, respectively.
[0012] Preferably, the kit comprises PCR reaction reagents, a positive control sample, and a negative control sample.
[0013] Preferably, the positive control sample is a recombinant plasmid containing the target gene fragment, and the negative control sample is deionized water.
[0014] The present invention also provides the application of the PCR detection kit in the following (1) or (2): (1) To identify or assist in the identification of whether the test strain is Bacillus belesii; (2) To detect or assist in the detection of whether Bacillus belese exists in the sample to be tested.
[0015] Compared with the prior art, the beneficial effects of the present invention are: (1) This invention is the first to disclose and verify acr3 Genes and place The combination of genes can serve as a molecular target for the specific identification of Bacillus belyssus. The application of this dual-gene combination overcomes the technical deficiency of traditional methods based on a single gene (such as 16S rRNA) that cannot effectively distinguish Bacillus belyssus from its closely related species. (2) The present invention is designed to target acr3 Genes and place A primer pair for a gene that can specifically amplify the gene. acr3 Genes and place It can detect genes without amplifying gene fragments from other bacteria, exhibiting high specificity; the detection limit for genomic DNA is as low as 1.5 ng / μL, which can meet the sensitivity requirements of routine molecular detection. (3) The kit and molecular identification method provided by the present invention can accurately and effectively detect whether Bacillus bereaves exists in the sample to be tested. No sequencing or complex biochemical identification is required. Identification can be completed by single PCR amplification and gel electrophoresis, which significantly shortens the detection cycle and is easy to operate. Attached Figure Description
[0016] Figure 1 for acr3 Gene phylogenetic tree; Figure 2 for acr3 Gene amplification band diagram; Figure 3 for place Gene phylogenetic tree; Figure 4 for place Gene amplification band diagram; Figure 5 for acr3 - place Two-gene combined phylogenetic tree; Figure 6 This represents the results of primer-specific amplification. Figure 7 This is the result of primer sensitivity detection. Detailed Implementation
[0017] To enable those skilled in the art to better understand the technical content of the present invention, the technical solution of the present invention will be further described in detail below with reference to specific embodiments.
[0018] Example 1: Design and Effect of PCR Amplification Primers 1.1 PCR amplification primer design and synthesis Based on the genome of Bacillus belyssus strain HN-1 preserved in the laboratory acr3 Gene sequence and place Gene sequence was obtained, and two pairs of primers were designed using Primer Premier 5.0 software. Specific sequence information is shown in Table 1. Primer pair 1 consisted of acr3-F and acr3-R, which were used to amplify the gene. acr3 The forward and reverse sequences of the gene, with nucleotide sequences shown in SEQ ID NO.3 and SEQ ID NO.4, respectively; primer pair 2 is yerP-F and yerP-R, which amplify... place The forward and reverse sequences of the gene, with their nucleotide sequences shown in SEQ ID NO.5 and SEQ ID NO.6, respectively. Table 1. Primer sequence information for PCR amplification
[0019] acr3The gene sequence is shown in SEQ ID NO.1, and the specific sequence information is as follows: ATGAAAATAACCAGAGAGACATTAGAAAAACAGCAAATTTGGATATATGGTGTGACTCTTGTAATCGGCGGAATAGCGGGGATCGCCGGGAAAGATTCAGGACTTCGCTGGGGATGGACGATATCACCGCTTATCGCTGTTCTCATGTATGCCATGTTTGCCCAAATCCCATTCTTGAAGCTGAAGGAAGCCATGTCAAACCTCAAATTTATGGCGGCTTTATTGATCGGTAATTTCTTAGCTGTACCTGTCGTTGTATGGGTGTTAACCGCCATTTTTCCTCAATCTCCTCCTATATTATTAGGGGTTTGTTTGGTATTGCTTACACCTTGTATTGATTACGTCATCGTCTTTACTCAGCTCGGCAAAGGAAATGAGAGATTAATACTGGCTTCCACGCCGGTTTTGTTCGCCGTTCAGATGGTATTGCTTCCGTTATACCTGTGGCTGTTTATCGGGAAAGAAGTGATAGGGGCTGTTCATGCGGGGCCGTTTCTGGAAGCATTCTTATGTTTAATAGCGGGACCGCTGCTGGCGGCTGTGATGACTCAATTATGGGCTGATAAGAAGCCGGCGGGAGAAAAGGTGTTGGAATGGACGGCGTGGCTGCCTGTTCCTTTTATGGCTCTGGTCTTACTGGCGGTCGTCGCCACACAAATCGGCAAGGTCATCAGTGATGCTGGCATCATTATACGTGTGATTCCGATCTATCTGTTATTCCTGCTCATTATGCCGTTTGTCTCCCGGTTTATCGCATATGCGTTCCGTCTGGATACAGGTGAAGGAAGAGCATTGATCTTCAGCACGGGCACAAGAAATTCTCTCGCAGTCCTTCCGTTAGCGCTGGCTTTGCCGGATGCTTGGGCTTCATTAGCCGCCGCTGTTATCGTCACACAGACGATCGTTGAATTGATAGGCGAATTGGTTTATATAAAAGCGGTGCCCGGATGGCTGCTGAAA。
[0020] placeThe gene sequence is shown in SEQ ID NO.2, and the specific sequence information is as follows:
[0021] 1.2 Template Preparation Following aseptic techniques, *Bacillus belye* HN-1 strain was inoculated into LB liquid medium and incubated statically for 36 hours. 2 mL of the bacterial culture was then used to extract DNA. The DNA extraction procedure is as follows: (1) Take 4 mL of the bacterial culture that has been cultured overnight, centrifuge at 10000 r / min for 1 min, and try to remove the supernatant; (2) Add 200 μL of buffer to the bacterial pellet (weigh 20 mg of lysozyme and dissolve it in 1 mL of TE buffer to prepare a lysozyme solution with a final concentration of 20 mg / mL, filter it through a 0.22 μm micropore and store it for later use), and treat it at 37℃ for 40 min; (3) Add 20 μL of Proteinase K solution to the tube and mix well; (4) Add 220 μL of buffer GB, shake for 15 s, place at 70 °C for 10 min, the solution becomes clear, briefly centrifuge, and remove water droplets from the inner wall of the tube cap; (5) Add 220 μL of anhydrous ethanol and shake thoroughly for 15 seconds. At this time, flocculent precipitate may appear. (6) Add all the contents obtained in step (5) into the adsorption column CB3 (place the adsorption column in the collection tube), centrifuge at 12000 r / min for 30 s, discard the waste liquid, and place the adsorption column CB3 into the collection tube; (7) Add 500 μL of buffer GD (anhydrous ethanol has been added before use) to the adsorption column CB3, centrifuge at 12000 r / min for 30 s, discard the waste liquid, and put the adsorption column CB3 into the collection tube. (8) Add 600 μL of washing solution PW (anhydrous ethanol has been added before use) to the adsorption column CB3, centrifuge at 12000 r / min for 30 s, discard the waste liquid, and put the adsorption column CB3 into the collection tube. (9) Repeat step (8); (10) Place the adsorption column CB3 back into the collection tube, centrifuge at 12000r / min for 2min, discard the waste liquid, and place the adsorption column CB3 at room temperature for several minutes to thoroughly dry the residual rinsing liquid in the adsorption material. (11) Transfer the adsorption column CB3 into a clean centrifuge tube, add 100 μL of sterile double-distilled water to the middle part of the adsorption membrane, let it stand at room temperature for 5 min, centrifuge at 12000 r / min for 2 min, and collect the solution into the centrifuge tube.
[0022] 1.3 Single PCR amplification 1.3.1 Experimental Methods Using the DNA of Bacillus vesiculosus HN-1 strain extracted in step 1.2 as a template, singleton amplification was performed using the two pairs of primers from step 1.1 according to the following procedure.
[0023] (1) Amplification acr3 Gene The total PCR reaction volume was 25 μL, and the primer concentration was 10 μM. The PCR reaction system is shown in Table 2. Table 2 acr3 Gene PCR reaction system
[0024] The PCR reaction procedure is shown in Table 3: Table 3 acr3 Gene PCR reaction procedure
[0025] After the PCR reaction was completed, a 1% agarose gel was prepared. 0.5 g of agarose was dissolved in 50 mL of 1x TAE buffer, and the agarose was completely dissolved by microwave heating for 1–2 min. 1 μL of nucleic acid dye was added to the gel solution, mixed well, and poured into a gel template for solidification. After the agarose gel solidified, PCR reaction solutions were sequentially spotted, and DNA markers were spotted for band alignment. After spotting, the gel was run at a constant voltage of 140 V for 20 min, and the gel was observed under UV light, with the results recorded by photography.
[0026] (2) Amplification place Gene The total PCR reaction volume was 25 μL, and the primer concentration was 10 μM. The PCR reaction system is shown in Table 4. Table 4 place Gene PCR reaction system
[0027] The PCR reaction procedure is shown in Table 5: Table 5 place Gene PCR reaction procedure
[0028] After the PCR reaction was completed, a 1% agarose gel was prepared. 0.5 g of agarose was dissolved in 50 mL of 1x TAE buffer, and the agarose was completely dissolved by microwave heating for 1–2 min. 1 μL of nucleic acid dye was added to the gel solution, mixed well, and poured into a gel template for solidification. After the agarose gel solidified, PCR reaction solutions were sequentially spotted, and DNA markers were spotted for band alignment. After spotting, the gel was run at a constant voltage of 140 V for 20 min, and the gel was observed under UV light, with the results recorded by photography.
[0029] 1.3.2 Test Results (1) When performing single weight acr3 During gene amplification, the results are as follows: Figure 1 and Figure 2 As shown, where Figure 1 For based on acr3 A phylogenetic tree constructed from genes. Analysis results show that all B... velezensis The strain sequences clustered robustly with 100% support into the same independent branch, and were associated with Bacillus subtilis (B). subtle ), Bacillus cereus (B. ) Cereus Closely related species, such as [list of species], have formed significantly divergent evolutionary clusters. This genetic characteristic, characterized by high intraspecific uniformity and significant interspecific differences, proves [the following]. acr3 Genes are highly conserved molecular markers unique to Bacillus belesii, providing a unique and reliable molecular basis for its precise species-level identification. Figure 2 for acr3 Gene amplification band diagram shows that a 960bp target gene fragment was successfully amplified.
[0030] (2) When performing single weight place During gene amplification, the results are as follows: Figure 3 and Figure 4 As shown, where Figure 3 For based on place Phylogenetic tree constructed from genes. Analysis showed that multiple *Bacillus belye* strains clustered tightly, forming a separate monophyletic clade with 100% clade support, demonstrating extremely strong species conservation. Simultaneously, this clade correlated with *Bacillus subtilis* (B. subtle ) evolutionary branch and Bacillus licheniformis (B. lichen-shaped Complete separation was achieved for closely related species such as [list of species], with a confidence level of 100%. Due to... place The high degree of conservation of genes within Bacillus belyssus further proves... place The advantages of genes as species-specific core markers for identification. Figure 4 for place Gene amplification band diagram shows that a 3144bp target gene fragment was successfully amplified.
[0031] (3) We are acr3 and place Phylogenetic trees were constructed for these two genes separately, and analysis revealed that when using... acr3 When constructing a single-gene tree, fungal outgroups ( Colletotrichum It was classified within the Bacillus group (intermediately between the Bacillus and Belizean groups). This is biologically unreasonable because bacteria and fungi are distantly related. This indicates that in the use of... acr3When constructing a phylogenetic tree using a single gene, the number of variant sites it contains may be insufficient to distinguish such a large span of species, or the gene may have undergone abnormal evolution in these species, resulting in an unreliable topological structure for the phylogenetic tree. In the context of... place Single-gene phylogenetic analysis revealed that while it could cluster Bacillus belyssums together, its internal support (Bootstrap value) was relatively low. place The genes can identify it as Bacillus belyssus, but the determination of the evolutionary relationship between different strains within this species is highly uncertain and unreliable. acr3 Genes and place All genes are functional proteins involved in the transport of lipopeptides in Bacillus belyssum. These functional genes are subject to high environmental selection pressure. Living under similar environmental stress, these genes may undergo convergent evolution, leading to the incorrect clustering of them in a single-gene tree. Finally, through... acr3 - place The use of two genes to construct a tree not only correctly places outgroup species at the bottom of the developmental tree, but also shows that the bootstrap values of each branch within Bacillus belyss are generally very high (97-100%), proving that the identification results are highly reliable.
[0032] (4) acr3 - place A phylogenetic tree of two genes combined, such as Figure 5 As shown in the figure, the analysis results indicate that all Bacillus belesiensis (B) are present. velezensis The strains clustered on the associative tree with 100% confidence into a highly conserved and independent evolutionary branch, associated with Bacillus subtilis (B). subtle Clear and stable topological separation was achieved among closely related species such as *Bacillus licheniformis*. This result fully demonstrates that... acr3 - place Dual-gene combinations are core molecular markers for identifying Bacillus belesiensis with high resolution and reliability. Therefore, by constructing dual-gene phylogenetic trees, we significantly accumulated more effective variant sites (SNPs) by increasing sequence length, greatly enhancing the evolutionary signal strength for distinguishing closely related species. At the same time, as functional genes that are highly susceptible to environmental pressures, single genes are easily affected by convergent evolution, horizontal gene transfer, or random genetic biases, leading to unstable or even disordered topological structures in phylogenetic trees (such as outgroup misalignment). Dual-gene analysis can effectively counteract this "genetic noise" through mutual correction and information supplementation between genes, significantly improving branch support and the scientific robustness of identification results.
[0033] Comparative Example 1: Duplex PCR Amplification The DNA of Bacillus vesiculosus HN-1 strain extracted in step 1.2 was used as a template, and the two pairs of primers from step 1.1 were used for double PCR amplification.
[0034] The total PCR reaction volume was 25 μL, the primer concentration was 10 μM, and the contents of each component are shown in Table 6. Table 6 PCR Total Reaction System
[0035] The PCR amplification program consisted of 32 cycles: 95℃ pre-denaturation for 7 min, 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 75 s, and a final incubation at 72℃ for 10 min. After the PCR reaction, a 1% agarose gel was prepared by dissolving 0.5 g of agarose in 50 mL of 1x TAE buffer and microwaving for 1-2 min until completely dissolved. 1 μL of nucleic acid dye was added to the gel solution, mixed well, and poured into a gel template for solidification. After solidification, the PCR reaction solution was sequentially spotted, and DNA markers were added for band alignment. After spotting, the gel was run at a constant voltage of 140 V for 20 min, observed under UV light, and the results were photographed and recorded.
[0036] Test results: A clear amplification bias was observed in the multiplex PCR reaction system. acr3 Genes gain an advantage in competition, severely inhibiting place During gene amplification, only a 960bp target gene fragment appeared in the electrophoresis bands, failing to yield the 3144bp target gene fragment. This indicates that the multiplex PCR method using this primer mixture cannot effectively detect two target genes simultaneously, making accurate molecular identification of Bacillus belysus difficult.
[0037] Example 2 Specificity Verification Experiment 2.1 DNA template preparation Following aseptic technique requirements, the test bacterial sample ( Bacillus velezensis HN-1, Bacillus subtle 168. Bacillus subtilis HN-13, Bacillus velezensis HN-9, Bacillus Pseudomycoides HN-12, Bacillus velezensis HN-8 Bacillus megaterium HN-11 was inoculated into LB liquid medium and incubated at 37°C for 36 hours. 2 mL of the bacterial culture was then used to extract DNA. The DNA extraction procedure is described in step 1.2. The tested fungal samples ( Colletotrichum fructicola HD-1, PestalotiopsisG4) was inoculated into PDA solid medium and incubated statically at 28℃ for 5–7 days. A suitable amount of mycelium was scraped off, and DNA was extracted using a fungal genomic DNA extraction kit. Fresh young leaves of rapeseed variety Zhongshuang 11 were ground into powder using liquid nitrogen, and genomic DNA was extracted using a plant genomic DNA extraction kit. All extracted DNA samples were uniformly diluted to a final concentration of 150 ng / μL and used as templates for subsequent PCR amplification.
[0038] 2.2 PCR amplification Take the DNA template obtained in step 2.1 and perform singlet PCR amplification using the primers shown in Table 1. The total PCR reaction system is shown in Tables 2 and 4. The PCR amplification reaction program is shown in Tables 3 and 5. Take 5 μL of the PCR amplification product and perform 1% agarose gel electrophoresis. After running at a constant voltage of 140 V for 20 min, observe the gel under UV light and take pictures to record the results.
[0039] 2.3 Test Results As shown in Table 7 and Figure 6 As shown, the above experimental method was used to identify the DNA of various bacteria, fungi, and plants preserved in the laboratory. This system is only applicable to B. velezensis Strains (HN-1, HN-8, HN-9) can simultaneously amplify 960bp ( acr3 ) and 3144bp ( place The specific target band of Bacillus subtilis (B.) was observed, while the target band of Bacillus subtilis (B.) was observed. subtle No cross-reaction was observed between the DNA of closely related species such as *Bacillus megaterium*, environmental fungi, and host plant DNA. Therefore, based on... acr3 and place The dual-gene detection method has extremely high species specificity and identification accuracy, which can effectively overcome the problem of insufficient resolution of 16S rRNA gene among closely related species, and provide a reliable molecular basis for the rapid identification of Bacillus belyssus.
[0040] Table 7 Results of Specificity Validation Experiment
[0041] Example 3: Specificity verification experiment at the level of closely related species within the same genus 3.1 DNA template preparation Following aseptic techniques, samples of *Bacillus belyssiensis* and closely related Bacillus species within the same genus (*Bacillus subtilis*, *Bacillus licheniformis*, *Bacillus amyloliquefaciens*, *Bacillus pumilus*, *Bacillus cereus*, *Bacillus thuringiensis*, *Bacillus mycosis fungoides*, *Bacillus megaterium*, *Bacillus coagulans*, *Bacillus clausti*, and *Bacillus polymyxa*) were inoculated into LB broth and incubated at 37°C for 36 hours. 2 mL of the bacterial culture was collected for DNA extraction, following the steps outlined in step 1.2. The extracted DNA from each sample was then uniformly diluted to a final concentration of 150 ng / μL and used as templates for subsequent PCR amplification.
[0042] 3.2 PCR amplification Take the DNA template obtained in step 3.1 and perform singlet PCR amplification using the primers shown in Table 1. The total PCR reaction system is shown in Tables 2 and 4. The PCR amplification reaction program is shown in Tables 3 and 5. Take 5 μL of PCR amplification product and perform 1% agarose gel electrophoresis. After running at a constant voltage of 140 V for 20 min, observe the gel under UV light and take pictures to record the results.
[0043] 3.3 Test Results As shown in Table 8, the above experimental methods were used to identify closely related Bacillus species within the genus, and it was found that only *B. velezensis* KCTC 13012... T The strain can simultaneously amplify 960bp ( acr3 ) and 3144bp ( place The method showed a specific target band for the bacterium, but no cross-reaction with other Bacillus species, indicating that the identification method is highly specific.
[0044] Table 8 Results of Validation of Specificity at the Level of Closely Related Species within the Genus.
[0045] Example 4 Primer Sensitivity Experiment 4.1 DNA template preparation The Bacillus berreatus HN-1 strain DNA extracted in step 1.2 was used as the original template. The original template DNA concentration was 150 ng / μL, and it was serially diluted 10-fold (10... -1 10 -2 10 -3 10 -4 10 -5 10 -6 10 -7 10 -8 The diluted concentrations were 15 ng / μL, 1.5 ng / μL, and 1.5 × 10⁻⁶ ng / μL, respectively. -1 ng / μL, 1.5×10-2 ng / μL, 1.5×10 -3 ng / μL, 1.5×10 -4 ng / μL, 1.5×10 -5 ng / μL, 1.5×10 -6 ng / μL, used as a DNA test template sample.
[0046] 4.2 PCR amplification Take the DNA test template sample obtained in step 4.1 and perform singleton PCR amplification using the primers shown in Table 1. The total PCR reaction system is shown in Tables 2 and 4. The PCR amplification reaction program is shown in Tables 3 and 5. Take 5 μL of PCR amplification product and perform 1% agarose gel electrophoresis. After running at a constant voltage of 140V for 20 min, observe the gel under UV light and take pictures to record the results.
[0047] 4.3 Test Results like Figure 7 As shown, acr3 The amplified gene product is 960 bp in size. place The amplified gene product is 3144 bp in size. acr3 The gene has extremely high detection sensitivity, even when the template is diluted to 10. -5 Even then, weak specific amplification bands could still be observed, compared to acr3 , place The sensitivity of gene detection is low. When diluted to 10... -1 The bands faded significantly by time, down to 10. -2 The subsequent bands were very weak, and further dilution resulted in an undetectable signal. Therefore, the minimum template concentration for accurate detection of Bacillus belyceae is 1.5 ng / μL.
[0048] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A method based on acr3 and yerP A molecular identification method for Bacillus belesi based on a combination of gene markers, characterized in that, by acr3 Genes and yerP Genes as molecular targets, the acr3 The nucleotide sequence of the gene is shown in SEQ ID NO.
1. yerP The nucleotide sequence of the gene is shown in SEQ ID NO.2, and includes the following steps: (1) Extract DNA from the sample to be tested; (2) Design specific primer pairs: acr3 The primer pair 1 for the gene is acr3-F and acr3-R, and their nucleotide sequences are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively. yerP The primer pair 2 for the gene is yerP-F and yerP-R, and their nucleotide sequences are shown in SEQ ID NO.5 and SEQ ID NO.6, respectively. (3) PCR amplification: Using the DNA of the sample to be tested obtained in step (1) as a template, PCR amplification was performed independently using primer pair 1 and primer pair 2 to obtain two amplification products; (4) Result detection: The two amplification products obtained in step (3) are detected by agarose gel electrophoresis. If the target bands are observed in the electrophoresis results, the sample to be tested is determined to be Bacillus belesii; if the target bands of the two amplification products are not observed at the same time, the sample to be tested is determined to be Bacillus belesii.
2. The molecular identification method for Bacillus belesiensis according to claim 1, characterized in that, The overall PCR system includes PCR reaction reagents, double-distilled water, DNA template, and PCR amplification primers.
3. The molecular identification method for Bacillus belesiensis according to claim 2, characterized in that, The total PCR system contained the following components: 12.5 μL of 2×Rapid Taq Master Mix, 10.5 μL of ddH2O, 1.0 μL of DNA template, 0.50 μL of upstream primer, and 0.50 μL of downstream primer.
4. The molecular identification method for Bacillus belesiensis according to claim 1, characterized in that, The PCR amplification reaction program is as follows: 95℃ pre-denaturation for 7 min; 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension, for 32 cycles; and finally incubation at 72℃ for 10 min; the extension time is 50 s or 75 s.
5. The molecular identification method for Bacillus belesiensis according to claim 1, characterized in that, In step (4), the target band amplified by primer pair 1 is 960 bp in size, and the target band amplified by primer pair 2 is 3144 bp in size.
6. The application of the molecular identification method for Bacillus belyssus according to any one of claims 1 to 5 in the following (1) or (2): (1) To identify or assist in the identification of whether the test strain is Bacillus belesii; (2) To detect or assist in the detection of whether Bacillus belese exists in the sample to be tested.
7. A rapid PCR detection kit for Bacillus belyssus, characterized in that, The kit includes primer pair 1 and primer pair 2; primer pair 1 is acr3-F and acr3-R, whose nucleotide sequences are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively; primer pair 2 is yerP-F and yerP-R, whose nucleotide sequences are shown in SEQ ID NO.5 and SEQ ID NO.6, respectively.
8. The PCR detection kit according to claim 7, characterized in that, The kit contains PCR reaction reagents, positive control samples, and negative control samples.
9. The PCR detection kit according to claim 8, characterized in that, The positive control sample was a recombinant plasmid containing the target gene fragment, and the negative control sample was deionized water.
10. The use of the PCR detection kit of claim 7 in either (1) or (2): (1) To identify or assist in the identification of whether the test strain is Bacillus belesii; (2) To detect or assist in the detection of whether Bacillus belese exists in the sample to be tested.