KASP primer set related to resistance to wheat yellow mosaic disease and application thereof

Abstract

The application discloses a KASP primer set related to wheat yellow mosaic disease resistance and application thereof, and the KASP primer set comprises a forward competitive primer rs54449-F1 with a nucleotide sequence as shown in SEQ ID NO. 1, a forward competitive primer rs54449-F2 with a nucleotide sequence as shown in SEQ ID NO. 2, and a reverse universal primer rs54449-R with a nucleotide sequence as shown in SEQ ID NO. 3. QYm-2B.1 The primer set is used for detecting a yellow mosaic disease resistance related site on a 2B chromosome of wheat, and genotyping TT and CC allele types of the site, and the TT genotype is related to stronger yellow mosaic disease resistance. The KASP primer set can be used for rapidly and accurately detecting an excellent genotype related to wheat yellow mosaic disease resistance, is not limited by a wheat growth period, is suitable for large-scale and high-throughput disease-resistant material screening, can be used for assisting in breeding of a disease-resistant site and other excellent traits, and can accelerate a breeding process of a new wheat variety which is outstanding in disease resistance and excellent in comprehensive traits.

Description

Technical Field

[0001] This invention relates to marker-assisted breeding of wheat, specifically to a set of KASP primers associated with wheat yellow mosaic virus resistance and its application. Background Technology

[0002] Diseases are one of the important limiting factors affecting wheat yield and quality. Among them, wheat yellow mosaic virus is a soil-borne viral disease that is relatively common and causes serious damage in wheat production in the wheat-growing areas of the middle and lower reaches of the Yangtze River in my country (see the definition of this wheat-growing area in the literature (Cheng Shunhe, Guo Wenshan, Wang Longjun, et al. (2012) Wheat in Southern China. Jiangsu Science and Technology Press)). It has become an important limiting factor for stable and high wheat yields in this region.

[0003] Wheat yellow mosaic virus (WYMV) is caused by wheat yellow mosaic virus and is mainly transmitted in the soil through polymyxa graminifolia. The disease typically occurs from the end of winter to the tillering stage, causing yellowing and mottling of new leaves and chlorosis of older leaves. Severe disease can lead to leaf necrosis, stunted growth, and tiller death, ultimately affecting normal wheat growth and yield (Fan Dejia, Wang Ruqin, He Zhentian, et al. (2024) Progress in research and breeding application of wheat yellow mosaic resistance. Journal of Nuclear Agricultural Sciences, 38(05):861-869). Accurate evaluation of wheat yellow mosaic disease, analysis of its resistance genetic basis, discovery of resistance-related loci, and application to breeding practices are important prerequisites for cultivating resistant varieties. However, current identification of wheat yellow mosaic resistance mainly relies on field disease surveys and manual grading, which are easily affected by environmental conditions, disease onset time, and human judgment, making it difficult to achieve stable and accurate screening of resistant materials. Furthermore, wheat yellow mosaic disease resistance is a typical complex quantitative trait, regulated by multiple genes, and its genetic mechanism is quite complex, which further increases the difficulty of discovering disease resistance genes and utilizing them in breeding.

[0004] Numerous studies have explored genes or loci associated with wheat yellow mosaic virus (YMVV) resistance by constructing segregating parental populations and using linkage analysis to locate relevant quantitative trait loci (QTLs). Currently, 14 loci or genes associated with YMVV resistance have been reported, primarily located on chromosomes 2A, 2DL, 4D, 5AL, and 7BS (Dai KL, et al. (2020) Dissection and cytological mapping of chromosome arm 4VS by the development of wheat). Haynaldia villosastructuralaberration library. Theor Appl Genet, 133(01):217-226; Yamashita Y, et al. (2020) A single QTL on chromosome 6DS derived from a winter wheat cultivar “OW104” confers resistance to Wheat yellow mosaic virus Breeding Sci, 70(03):373-378). Meanwhile, some disease resistance genes have been cloned and their functions verified, for example... TaPDIL5-1 (Kan JH, etal. (2022) Simultaneous editing of host factor gene TaPDIL5-1 homoeoallelesconfers wheat yellow mosaic virus resistance in hexaploid wheat. New Phytol, 234(2):340-344), TaVTC2 (Zhang T, et al. (2023) Wheat yellow mosaic virus NIbtargets TaVTC2 to elicit broad-spectrum pathogen resistance in wheat. PlantBiotechnol J, 21(5):1073-1088), Ym1 (Chen YM, et al. (2025) A wheat CC-NBS-LRRprotein Ym1 (e.g., confers WYMV resistance by recognizing viral coat protein. NatCommun, 16:3630). However, due to factors such as parental genetic background, mapping methods, marker types, and environmental conditions, the QTL mapping results for wheat yellow mosaic virus resistance vary considerably among different mapping populations. The stability, repeatability, and breeding applicability of the discovered loci remain limited, restricting the fine mapping, functional analysis, and breeding transformation applications of related genes.

[0005] The middle and lower reaches of the Yangtze River are important wheat-producing areas in my country and also one of the regions most severely affected by wheat yellow mosaic virus (YMVV). Identifying YMVV resistance loci in wheat germplasm resources from this region and further developing KASP functional markers that can be directly applied to breeding practices is of great significance for improving the utilization efficiency of disease-resistant germplasm resources, promoting marker-assisted selection breeding, and accelerating the breeding of new YMVV-resistant varieties. Summary of the Invention

[0006] To address the aforementioned problems, this invention is based on the first-ever discovery of loci associated with wheat yellow mosaic virus resistance. QYm- 2B.1 This paper presents a KASP primer set and its applications. This primer set enables rapid and accurate genotyping of target loci, providing technical support for screening wheat yellow mosaic virus-resistant materials and marker-assisted breeding.

[0007] To achieve the above objectives, the present invention provides a set of KASP primers related to resistance to wheat yellow mosaic virus. QYm _rs54449, the KASP primer set is used to detect yellow mosaic virus resistance-related loci located on wheat chromosome 2B. QYm-2B.1 The QYm-2B.1 The physical location of the site on the Chinese Spring reference genome IWGSC RefSeq v2.1 is 103,830,084 bp. The KASP primer set includes the forward competitive primer rs54449-F1 with the nucleotide sequence shown in SEQ ID NO.1, the forward competitive primer rs54449-F2 with the nucleotide sequence shown in SEQ ID NO.2, and the reverse universal primer rs54449-R with the nucleotide sequence shown in SEQ ID NO.3.

[0008] A second aspect of the present invention provides the application of the above-described KASP primer set in any of the following: (1) Detection of resistance-related loci for wheat yellow mosaic virus QYm-2B.1 genotype; (2) Testing wheat yellow mosaic virus resistance; (3) Develop wheat varieties with high resistance to yellow mosaic virus.

[0009] A third aspect of the present invention provides a method for detecting resistance to wheat yellow mosaic virus, comprising the following steps: (1) Using the genomic DNA of the wheat material to be tested as a template, fluorescent PCR amplification was performed using the above-mentioned KASP primer set; (2) Perform fluorescence signal scanning and genotype cluster analysis on the amplification products to determine the properties of the test material. QYm-2B.1 Genotype at the locus; (3) Determine wheat yellow mosaic disease resistance based on genotype test results.

[0010] Specifically, in step (2), it is determined that the material to be tested... QYm-2B.1 The method for determining the genotype of a locus is as follows: when the amplified product shows a blue fluorescent signal clustered on the Y-axis in the genotyping clustering diagram, it is determined to be the TT genotype; when it shows a red fluorescent signal clustered on the X-axis, it is determined to be the CC genotype.

[0011] The results showed that the incidence of wheat yellow mosaic virus (YHSV) in wheat materials carrying the TT genotype was significantly lower than that in wheat materials carrying the CC genotype, indicating that the TT genotype was the dominant genotype associated with resistance to YHSV. The wheat materials tested were preferably from the wheat-growing region of the middle and lower reaches of the Yangtze River.

[0012] Specifically, in step (1), the fluorescent PCR amplification system includes: 2.5 μL of template DNA at a concentration of 120 ng / μL, 5 μL of 2×KASP Master Mix, 0.14 μL of KASP Assay Mix, and ddH2O to bring the total to 10 μL; wherein each 100 μL of KASP Assay Mix includes: 12 μL of rs54449-F1 at a concentration of 100 μM, 12 μL of rs54449-F2 at a concentration of 100 μM, 30 μL of rs54449-R at a concentration of 100 μM, and 46 μL of ddH2O; The PCR amplification program was as follows: thermal activation at 94℃ for 15 min; denaturation at 94℃ for 20 s, annealing and extension at 61–55℃ for 1 min, for 10 cycles, with the annealing and extension temperature decreasing by 0.6℃ per cycle; denaturation at 94℃ for 20 s, annealing and extension at 55℃ for 1 min, for 29 cycles. The amplified products were incubated at 30℃, and fluorescence signals were collected.

[0013] Through the above technical solution, the present invention achieves the following beneficial effects: 1. This invention, based on wheat materials from the middle and lower reaches of the Yangtze River, combined with yellow mosaic virus disease severity assessment and genome-wide association analysis, identified resistance-related loci located on chromosome 2B. QYm-2B.1 This locus originates from germplasm resources in wheat-growing areas prone to yellow mosaic disease and has good breeding value.

[0014] 2. This invention is aimed at QYm-2B.1 The developed KASP primer group produces clear and stable genotyping results, enabling rapid and accurate identification of disease-resistant genotypes. It is suitable for high-throughput, low-cost detection of large-scale breeding materials.

[0015] 3. The KASP primer set described in this invention is not limited by the wheat growth period and can be used for early screening of superior genotypes resistant to yellow mosaic virus, evaluation of resistant materials, and aggregation breeding of disease-resistant loci, thereby improving the efficiency of molecular breeding for wheat resistance to yellow mosaic virus. Attached Figure Description

[0016] Figure 1 The results of genome-wide association analysis (GWAS) on wheat yellow mosaic virus resistance are shown; A is the Manhattan plot, B is the QQ plot, and the arrows in A indicate significant association sites. QYm-2B.1 ; Figure 2 KASP primer set markers for this invention QYm The results of the _rs54449 genotyping test are shown. The horizontal and vertical axes in the figure represent the fluorescence signal intensity of HEX and FAM, respectively. The black dots are negative controls (NTC, ddH2O), and the blue and red dots represent different genotypes. Detailed Implementation

[0017] The specific embodiments of the present invention will be described in detail below with reference to examples. It should be understood that the specific embodiments described herein are for illustration and explanation only and are not intended to limit the present invention.

[0018] GWAS utilizes abundant genetic variation and linkage disequilibrium (LD) information in natural populations, combining whole-genome genotype and phenotypic data to conduct association analysis, thereby achieving efficient discovery of loci associated with target traits. This method can not only locate major effect loci but also discover minor effect loci that are difficult to detect with traditional linkage analysis, thus becoming an important tool for the genetic analysis of complex quantitative traits. Based on the significantly associated SNP loci obtained from GWAS, molecular markers can be further developed and applied to breeding practices to achieve rapid detection and targeted selection of superior allelic variations. However, current research on using natural populations to conduct GWAS to discover wheat yellow mosaic virus resistance loci is still relatively limited, and functional marker resources that can be directly applied to breeding practices remain scarce. For SNP loci significantly associated with target traits, competitive allele-specific PCR (KASP) technology can accurately identify single-base differences. It offers advantages such as high throughput, relatively low cost, high automation, and stable and reliable genotyping results, meeting the high-throughput detection needs of large-scale breeding populations. It has become one of the most widely used genotyping technologies in marker-assisted selection breeding of crops (Semagn K, et al. (2014) Single nucleotide polymorphism genotyping using Kompetitive Allele Specific PCR (KASP): overview of the technology and its application in crop improvement. MolBreeding, 33:1-14). Therefore, this invention, based on wheat materials from the middle and lower reaches of the Yangtze River, combined with yellow mosaic virus disease severity assessment and genome-wide association analysis, identified resistance-related loci located on chromosome 2B. QYm-2B.1 and targeting QYm-2B.1 A KASP primer set was developed. Specific embodiments are as follows. Various processes and methods not described in detail in the following examples are conventional methods known in the art. Unless otherwise specified, the reagents, equipment, etc., used in the examples are commercially available. The wheat materials used in this invention are germplasm resources preserved at the Jiangsu Provincial Germplasm Resource Bank (Crops)—College of Agriculture, Yangzhou University, and are available for use by experts and researchers in the field.

[0019] Example 1: Genome-wide association analysis and QTL identification of wheat yellow mosaic virus resistance (1) Test materials and identification of wheat yellow mosaic disease resistance: This example uses 279 wheat varieties bred in the middle and lower reaches of the Yangtze River in the past 30 years as the research object to carry out identification of the incidence level of wheat yellow mosaic disease (Wang Ruqin, Fan Dejia, He Zhentian, et al. (2024) Study on resistance of wheat yellow mosaic disease of 279 varieties (lines) in the middle and lower reaches of the Yangtze River. Journal of Nuclear Agricultural Sciences, 38(6):1005-1011). In the two growing seasons of 2023-2024 and 2024-2025, the above materials were planted in the wheat yellow mosaic disease nursery field of Lixiahe Agricultural Research Institute, Yangzhou City, Jiangsu Province. Each variety was planted in 2 rows with a row length of 1 m, and 50 seeds were evenly sown in each row, with 2 replicates. A disease survey was conducted during the peak period of wheat yellow mosaic disease from the winter after sowing to the greening stage the following year. Disease severity was assessed using a 0-3 grade evaluation standard, following the method published in (Chen Xitong. (2019) Mining and Identification of Wheat Yellow Mosaic Resistance Genes. Shandong Agricultural University). During the field survey, the symptoms of yellow mosaic disease were clearly distinguishable among the materials, meeting the requirements for disease severity assessment. In addition, using the same experimental method, the disease severity of 220 wheat accessions (named the YR population by the applicant, as shown in Table 4) randomly selected from high-generation (F7 / F8) breeding materials constructed by hybridizing widely promoted varieties in the middle and lower reaches of the Yangtze River (including Zhenmai 9, Yangmai 158, Ningmai 9, Yangmai 11, Yangfumai 3, Yangfumai 9311, etc.) were evaluated. This data was used for subsequent marker development verification.

[0020] (2) Genotyping and Quality Control: The genomes of the tested varieties were scanned using an 800k wheat genome chip (Chengdu Tiancheng Future Technology Co., Ltd., Chengdu). TASSEL V5.2.13 software was used for quality control of the chip genotypic data, removing markers with a minimum allele frequency ≤5% and a deletion rate exceeding 10%, to obtain high-quality SNP marker data for subsequent association analysis (Khan H, et al. (2022) Genome-wide association study for grain yield and component traits in bread wheat). Triticum aestivum L.). FrontGenet, 13:982589).

[0021] (3) Genome-wide association analysis and identification of resistance loci: Based on the phenotypic data of yellow mosaic disease incidence level of 279 wheat varieties and the SNP genotype data after quality control, genome-wide association analysis was carried out using the R language GAPIT3 software package (Lipka AE, et al. (2012) GAPIT: genome association and prediction integratedtool. Bioinformatics, 28(18): 2397-2399). The FarmCPU method was selected for GWAS analysis (Liu XL, et al. (2016) Iterative usage of fixed and random effect models for powerful and efficient genome wide association studies. PLOS Genet, 12(2):e1005767). The Bonferroni correction results and data distribution were used to determine the GWAS results. A wide association study reveals the genetic architecture of coleoptile length in wheat. (Theor Appl Genet, 130:391-401). GWAS analysis detected nine QTLs significantly associated with wheat yellow mosaic virus resistance, distributed on chromosomes 2B, 3D, 4A, 5A, 5D, 6D, and 7B (Table 1). One novel QTL was located on chromosome 2B. QYm-2B.1 Significantly associated with resistance to wheat yellow mosaic virus ( Figure 1 Its peak marker is rs54449, the allelic variant type is T / C, and its physical location on the Chinese Spring reference genome IWGSC RefSeq v2.1 is 103,830,084 bp, with the highest association significance ( P =1.21×10 -12 The phenotypic explanation rate was 4.19%, indicating significant potential for breeding applications.

[0022] Table 1. GWAS localization results of Yellow Mosaic Disease

[0023] Example 2: Development, screening and validation of KASP molecular markers (1) In order to better understand the wheat yellow mosaic disease resistance-related loci located by GWAS in Example 1 QYm-2B.1 Furthermore, through breeding applications, it can be developed into a KASP marker suitable for high-throughput genotyping. Specifically, with QYm-2B.1 The peak marker rs54449 was used as the target site. Sequence information of 200 bp upstream and downstream of this SNP was retrieved. Multiple sets of PCR amplification primers were designed using PrimerPremier5 (http: / / www.premierbiosoft.com / primerdesign / ). The quality of the designed primers was then screened using DNAMAN, and primer specificity was further detected using the Ensembl Plants database. Finally, the selected primer sequences were converted into KASP primers (Yang Qingqing, Tang Jiaqi, Zhang Changquan, et al. (2022) Application and Prospect of KASP Marker Technology in Major Crops. Biotechnology Bulletin, 38(04):58-71). The KASP primer sequences are shown in Table 2. Each KASP primer set consists of three sequences: a forward competitive primer F1, which is formed by linking the FAM tag sequence with the corresponding amplification primer sequence; a forward competitive primer F2, which is formed by linking the HEX tag sequence with the corresponding amplification primer sequence; and a reverse universal primer, which is the corresponding amplification primer sequence. The nucleotide sequences of the FAM tag and HEX tag sequences are as follows: FAM tag sequence (SEQ ID NO.4): 5' GAAGGTGACCAAGTTCATGCT 3' (can bind FAM fluorescent groups); HEX tag sequence (SEQ ID NO.5): 5' GAAGGTCGGAGTCAACGGATT 3' (can be combined with HEX fluorescent groups); Primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. (https: / / www.sangon.com / ).

[0024] Table 2 KASP primer design

[0025] (2) To verify the developed KASP primer pair QYm-2B.1 To assess the accuracy of locus detection and the stability of genotyping, 30 samples were randomly selected from the tested natural population. QYm-2B.1Materials with known locus genotypes were used for testing. Refer to Stein et al. (2001) (Stein N, et al. (2001) A new DNA extraction method for high-throughput marker analysis in a large-genome species such as Triticum aestivum (PlantBreed, 120:354-356) Genomic DNA was extracted from fresh leaves using the CTAB method, and then diluted to approximately 120 ng / μL with sterile ddH2O. Subsequently, fluorescent PCR amplification was performed using the KASP primer set shown in Table 2. The reaction system, amplification program, and genotyping method are as follows: KASP reaction system (10 μL): includes 2.5 μL sample DNA (120 ng / μL), 5 μL 2×KASP Master Mix (LGC Genomics, Hoddeston, UK), 0.14 μL KASP Assay Mix, and ddH2O added to bring the total to 10 μL.

[0026] The KASP Assay Mix is ​​prepared as follows: Each 100 μL KASP Assay Mix contains 12 μL of 100 μM rs54449-F1, 12 μL of 100 μM rs54449-F2, 30 μL of 100 μM rs54449-R, and 46 μL of ddH2O.

[0027] KASP reaction procedure: thermal activation at 94℃ for 15 min; denaturation at 94℃ for 20 s, annealing and extension at 61–55℃ for 1 min, 10 cycles, with the annealing and extension temperature decreasing by 0.6℃ per cycle; denaturation at 94℃ for 20 s, annealing and extension at 55℃ for 1 min, 29 cycles. The amplified product was incubated at 30℃, and fluorescence signals were collected.

[0028] Genotyping: Fluorescence signals were scanned and genotyped using an Applied Biosystems ABI Viia7 Real Time PCR System (Thermo Scientific, USA). Specifically: samples clustered near the Y-axis and displaying blue fluorescence indicate the FAM fluorescent group type, corresponding to the TT genotype (TT Type); samples clustered on the X-axis and displaying red fluorescence indicate the HEX fluorescent group type, corresponding to the CC genotype (CC Type); samples clustered near the origin and displaying black fluorescence serve as the blank control (NTC). Results for 30 samples are shown below. Figure 2 The results showed that the KASP primer set had high amplification efficiency, clear genotyping and clustering, and stable detection results; its genotyping results were completely consistent with the gene chip detection results (Table 3), indicating that the primer set could accurately identify... QYm-2B.1 Different allelic variants at a locus can be used for the rapid detection and identification of genotypes related to wheat yellow mosaic virus resistance. The applicant named this KASP molecular marker... QYm _rs54449.

[0029] Table 3. Verification of KASP primer detection results

[0030] Example 3 KASP molecular marker QYm Application of _rs54449 in the identification of wheat yellow mosaic virus resistance To verify the genotyping effect and application value of the KASP marker developed in Example 2 in breeding materials, this example uses the 220 YR population described in Example 1 as the test material, extracts genomic DNA from each line, and utilizes KASP primer sets. QYm _rs54449 QYm-2B.1 The sites were subjected to fluorescent PCR amplification and genotyping. DNA extraction, KASP reaction system, amplification procedure, and genotyping method were all the same as in Example 2.

[0031] The results showed that this KASP primer set could effectively detect [the substance] in the test material. QYm-2B.1 The loci were identified, and different allelic variant types were clearly distinguished. The specific genotype detection results are shown in Table 4.

[0032] Table 4. KASP genotyping results and wheat yellow mosaic disease severity in the YR population.

[0033] Based on the data on the severity of wheat yellow mosaic virus (YCF) disease, SPSS V26.0 software was used to perform statistical analysis and independent samples t-tests on different genotype lines. The results showed that the disease severity of the TT genotype line (0.58) was lower than that of the CC genotype line (1.25), and the difference was highly significant. P <0.001 (Table 5) indicates that the TT genotype is associated with strong resistance to wheat yellow mosaic virus. This KASP marker has good application effects in breeding materials and can be used for rapid screening of superior genotypes resistant to yellow mosaic virus and marker-assisted selection during the breeding process.

[0034] Table 5. Results of t-test for disease severity of wheat yellow mosaic virus in different genotypes

[0035] Note: *** indicates the significance level. P <0.001.

[0036] In summary, this invention uses natural wheat populations in the middle and lower reaches of the Yangtze River as research material. Through yellow mosaic disease incidence level identification and genome-wide association analysis, it identifies loci significantly associated with wheat yellow mosaic disease resistance and targets... QYm-2B.1 KASP molecular markers were developed at the site. QYm _rs54449. The research results show that this marker can accurately identify... QYm- 2B.1 Different allelic variants at the locus exhibit high amplification efficiency, clear genotyping and clustering, and stable detection results. Further validation in high-generation breeding materials shows that this marker can effectively distinguish different resistance genotypes and is significantly correlated with the severity of wheat yellow mosaic disease. Therefore, the KASP molecular marker provided in this application can serve as an effective tool for identifying wheat yellow mosaic disease resistance and marker-assisted selection, providing technical support for disease-resistant germplasm screening, utilization of superior allelic variants, and breeding of new yellow mosaic disease-resistant varieties.

[0037] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

[0038] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not describe the various possible combinations separately.

[0039] Furthermore, various different embodiments of the present invention can be combined in any way, as long as they do not violate the spirit of the present invention, they should also be regarded as the content disclosed by the present invention.

Claims

1. A set of KASP primers associated with wheat yellow mosaic virus resistance QYm _rs54449, characterized in that, The KASP primer set was used to detect yellow mosaic virus resistance-related loci located on wheat chromosome 2B. QYm-2B.1 The KASP primer set includes the forward competitive primer rs54449-F1 with the nucleotide sequence shown in SEQ ID NO.1, the forward competitive primer rs54449-F2 with the nucleotide sequence shown in SEQ ID NO.2, and the reverse universal primer rs54449-R with the nucleotide sequence shown in SEQ ID NO.

3.

2. The use of the KASP primer set according to claim 1 in any of the following: (1) Detection of resistance-related loci for wheat yellow mosaic virus QYm-2B.1 genotype; (2) Testing wheat yellow mosaic virus resistance; (3) Develop wheat varieties with high resistance to yellow mosaic virus.

3. A method for detecting resistance to wheat yellow mosaic virus, characterized in that, Includes the following steps: (1) Using the genomic DNA of the wheat material to be tested as a template, fluorescent PCR amplification was performed using the KASP primer set described in claim 1; (2) Perform fluorescence signal scanning and genotype clustering analysis on the amplification products to determine the properties of the test material. QYm-2B.1 Genotype at the locus; (3) Determine wheat yellow mosaic disease resistance based on genotype test results.

4. The method according to claim 3, characterized in that, In step (1), the fluorescent PCR amplification system includes: 2.5 μL of template DNA at a concentration of 120 ng / μL, 5 μL of 2×KASP Master Mix, 0.14 μL of KASP Assay Mix, and ddH2O to bring the total to 10 μL; wherein, each 100 μL of KASP Assay Mix includes: 12 μL of 100 μM rs54449-F1, 12 μL of 100 μM rs54449-F2, 30 μL of 100 μM rs54449-R, and 46 μL of ddH2O; The PCR amplification program was as follows: 94℃ thermal activation for 15 min; 94℃ denaturation for 20 s, annealing and extension at 61-55℃ for 1 min, 10 cycles, with the annealing and extension temperature decreasing by 0.6℃ per cycle; 94℃ denaturation for 20 s, 55℃ annealing and extension for 1 min, 29 cycles.

5. The method according to claim 3, characterized in that, In step (2), it is determined that the material to be tested is in QYm-2B.1 The method for determining the genotype of a locus is as follows: when the amplified product shows a blue fluorescent signal clustered on the Y-axis in the genotyping clustering diagram, it is determined to be the TT genotype; when it shows a red fluorescent signal clustered on the X-axis, it is determined to be the CC genotype.

6. The method according to claim 3, characterized in that, In step (3), the method for judging wheat yellow mosaic disease resistance is: the incidence of yellow mosaic disease in wheat materials carrying the TT genotype is significantly lower than that in wheat materials carrying the CC genotype.

Images