SNP molecular marker related to plant height and ear position height of sweet corn and application thereof

Abstract

The present application relates to a SNP molecular marker related to sweet corn plant height and ear height and application thereof, the SNP site is located at the 169,733,977th nucleotide of the 6th chromosome of corn B73 reference genome RefGen_v4;The sequence of the molecular marker is shown as SEQ ID NO:1, and the 201th base from the 5' end presents A / G polymorphism, which can be used for identifying and breeding sweet corn varieties with coordinated plant height and ear height and ideal plant type characteristics.The present application firstly detects a new SNP site in a population composed of F1 hybrid sweet corns through three whole genome association analysis models of MLM, CMLM and BLINK, the site is significantly associated with plant height and ear height, shows outstanding "one cause multiple effects" effect, and can be used as an efficient SNP site for screening ideal plant type at seedling stage.

Description

Technical Field

[0001] This invention relates to the field of agricultural biotechnology, specifically to a SNP molecular marker related to sweet corn plant height and ear height and its application. Background Technology

[0002] The reason sweet corn has a crisp and tender taste, unlike regular corn, is due to a natural mutation in its starch synthesis-related genes, which prevents sugar from being effectively converted into starch. This mutation has been fixed through traditional hybridization and selection, resulting in the common sweet corn varieties we see today. Because the kernels are high in sugar, low in starch, and have a high water content, sweet corn is considered a healthy choice that helps control blood sugar or weight. However, these same characteristics also lead to poor seed emergence and weaker seedling growth, thus requiring significantly different cultivation and management practices compared to regular corn.

[0003] Ideal sweet corn varieties should possess moderate plant height and relatively low ear height to enhance lodging resistance and adaptability to mechanized operations. However, both are typical quantitative traits, regulated by multiple genes and easily influenced by the environment. Traditional breeding methods, relying on field phenotypic identification in the later stages of growth, are time-consuming and inefficient. Marker-assisted selection (MAS) offers a more efficient means to improve complex traits.

[0004] Currently, some molecular markers associated with maize plant height have been reported. For example, patent CN202510882966.0 discloses the SNP (Single Nucleotide Polymorphism) marker Chr1:SNP-25,296,496 located on chromosome 1, which is significantly associated with plant height in temperate and tropical / subtropical maize. Patent CN202610518757.2 discloses a combination of molecular markers located on chromosome 7 that are closely linked to both plant height and ear height in maize. However, these markers are all derived from common maize, and their effects and application value in the specific genetic context of sweet maize have not been confirmed. Furthermore, there is a lack of markers that are significantly associated with both plant height and ear height simultaneously, enabling "one trait with multiple effects" selection, requiring separate screening in breeding, which is costly. In addition, existing technologies lack robust markers for sweet maize that have been validated by multiple GWAS (Genome-Wide Association Study) models. Summary of the Invention

[0005] The purpose of this invention is to provide a SNP molecular marker related to sweet corn plant height and ear height and its application, in order to solve the problem of the lack of specific markers that are significantly associated with both traits of sweet corn plant height and ear height.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0007] SNP molecular markers associated with sweet maize plant height and ear height are provided. The SNP sites are located at nucleotide 169,733,977 on chromosome 6 of the RefGen_v4 reference genome of maize B73.

[0008] The molecular marker sequence is shown in SEQ ID NO:1, with the 201st base from the 5' end exhibiting A / G polymorphism.

[0009] Furthermore, when the genotype at the 201st site of the molecular marker is AA, sweet corn exhibits relatively high plant height and ear height traits;

[0010] When the genotype at the 201st locus of the molecular marker is GG, sweet corn exhibits relatively low plant height and ear height traits.

[0011] On the other hand, specific primers for detecting the molecular markers as described above are provided, said specific primers being PCR amplification primers, the sequences of which are shown in SEQ ID NO:2 and SEQ ID NO:3.

[0012] On the other hand, the application of the molecular markers or specific primers described herein in identifying sweet corn varieties in which plant height and ear height are coordinated is provided.

[0013] Furthermore, a method is provided for identifying sweet corn varieties with coordinated plant height and ear height. Genomic DNA of the sweet corn to be tested is extracted, and PCR amplification is performed using the specific primers described above. After obtaining the amplification product, the amplification product is sequenced to detect the genotype at locus 169,733,977 on chromosome 6. The plant height and ear height traits of the sweet corn are identified based on the base type.

[0014] On the other hand, the application of the molecular markers or specific primers described herein in the breeding of sweet corn varieties in which plant height and ear height are coordinated is provided.

[0015] Furthermore, a method is provided for breeding sweet corn varieties with coordinated plant height and ear height, characterized by:

[0016] Genotyping of sweet corn breeding materials at the SNP loci was performed during the seedling stage, and single plants with the target genotype were selected for subsequent hybridization or backcrossing.

[0017] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0018] This invention provides a novel SNP molecular marker associated with plant height and ear height in sweet maize and its application. For the first time, in a population composed of F1 hybrids of sweet maize, a new SNP locus located at 169,733,977 bp on chromosome 6 was independently and repeatedly detected using three genome-wide association analysis models: MLM (Mixed Linear Model), CMLM (Compressed Mixed Linear Model), and BLINK (Bayesian-information and Linkage-disequilibrium Iteratively Nested Keyway). This locus showed highly significant associations with both plant height (p=4.32E-04) and ear height (p=2.04E-05), with a phenotypic variation explained (PVE) as high as 0.64, demonstrating a prominent "one factor, multiple effects" effect. This SNP site is located within the known gene Zm00001d039086 (encoding a CHUP1-like protein), which is involved in chloroplast photoinduced localization and provides functional clues for the coordinated regulation of plant height and ear height. Validation has shown that this marker can serve as an efficient material for screening ideal plant types during the seedling stage. Attached Figure Description

[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other embodiments can be obtained from these drawings without creative effort.

[0020] Figure 1 The diagrams provided in this invention illustrate the distribution of SNP chip markers and the population structure analysis of sweet maize inbred lines. (A) shows the physical distribution of 9,433 SNP markers on the 10 chromosomes of maize; (B) shows a clustering diagram based on Roger's genetic distance using the neighbor-joining method; (C) shows the population structure of each material when K=4; and (D) shows a three-dimensional scatter plot based on principal component analysis (PCA).

[0021] Figure 2 The diagrams show a comparison of plant height and ear height phenotypes for intra-group and inter-group hybrid combinations provided by this invention. (A) is a comparison diagram of plant height phenotypes; (B) is a comparison diagram of ear height phenotypes.

[0022] Figure 3Manhattan plot and QQ plot for GWAS analysis provided by this invention. Wherein, (A) is plant height (PH); (B) is ear height (EH); the arrow indicates the SNP marker site (Chr6: 169,733,977) described in this invention.

[0023] Figure 4 Box plots comparing plant height (A) and ear height (B) phenotypic values ​​among different genotype sweet corn materials provided in this invention. The box plots in the figure show the phenotypic distribution of the AA, AG, and GG genotypes. * indicates P < 0.05. Detailed Implementation

[0024] To facilitate understanding of the present invention, a more complete description will be given below with reference to the accompanying drawings. Preferred embodiments of the invention are shown in the drawings. However, the invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the invention.

[0025] In the description of this invention, it should be understood that all technical and scientific terms used have the same meaning as commonly understood by one of ordinary skill in the art. In case of conflict, the definitions in this specification shall prevail. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art, the reagents used in the embodiments are commercially available products, and the devices used in the embodiments are existing devices. The limitation on the means, reagents, or devices should not be construed as a limitation on the present invention. Means, reagents, or devices of the same type that solve the same technical problem are all within the protection scope of the present invention.

[0026] In the description of this invention, it should be understood that when a quantity, concentration, or other value or parameter is expressed as a range, a preferred range, or a range defined by a series of upper and lower preferred values, this should be understood as specifically disclosing all ranges formed by any pair of any upper or preferred value with any lower or preferred value, regardless of whether the range is disclosed individually. When numerical ranges are described herein, unless otherwise stated, the range is intended to include its endpoints and all integers and fractions within that range.

[0027] Furthermore, the method involves multiple steps, which should not be construed as a limitation on the order of the steps. Technical solutions obtained by changing the order of steps when solving the same technical problem are also within the scope of protection of this invention.

[0028] This invention is the first to discover a novel SNP molecular marker in a sweet corn population, located within the known gene Zm00001d039086 and significantly associated with both plant height and ear height, through multi-environmental phenotypic identification and multi-model GWAS analysis. It also provides its detection method and application, enabling simultaneous screening of two key plant type traits by a single marker, and significantly improving the efficiency of marker-assisted selection.

[0029] Specifically, the SNP molecular markers associated with sweet maize plant height and ear height are shown in SEQ ID NO:1, with an A / G polymorphism at the 201st base from the 5' end. The SNP site is located at nucleotide 169,733,977 on chromosome 6 of the maize B73 reference genome RefGen_v4.

[0030] SEQ ID NO:1:

[0031] tctgccagcgagcctttgctgatgcaggtgttggttttggcctccccactgctgaaaggctgacgccgtctccttcaactcctgaaaggcgcgcatcgta tcgacgtcgaaaccgcctgcaaactgcaacgaatggtatgggactgagcacaacaatatgcagcaaactatacaagcttgaagggctgctgagcatatca gcaacgtacangagcaagtggcgagtggtttacctggtgcactctgaaggcaaatcggactccttgaagcaccagctcctcttcgtcagggccgacctgt atggcctgaatctctgaggaaaccctcctcaggtacttcattgccagcttcactgattgcagtttgatctgcacgtaagacccggcttgtcatcaaaatgc Where n is either a or g.

[0032] The present invention also provides specific primers for detecting the above-mentioned molecular markers, including upstream primer SEQ ID NO:2 and downstream primer SEQ ID NO:3, for PCR amplification and Sanger sequencing detection.

[0033] The aforementioned molecular markers or specific primers can be used to identify sweet corn varieties with coordinated plant height and ear height. Specifically, genomic DNA is extracted from the sweet corn to be tested, and PCR amplification is performed using the aforementioned specific primers. After obtaining the amplification products, the amplification products are sequenced to detect the genotype at locus 169,733,977 on chromosome 6. The plant height and ear height traits of sweet corn are identified based on the base type.

[0034] When the genotype at the 201st molecular marker locus is AA, sweet corn exhibits relatively high plant height and ear height traits; when the genotype at the 201st molecular marker locus is GG, sweet corn exhibits relatively low plant height and ear height traits; and when the genotype is AG, it indicates a heterozygous genotype. Through identification, sweet corn varieties with both high and low plant height and ear height can be screened out early, rapidly narrowing down the range for later breeding of sweet corn varieties with coordinated plant height and ear height and ideal plant type.

[0035] The aforementioned molecular markers or specific primers can be used to breed sweet corn varieties with coordinated plant height and ear height. Specifically, during the seedling stage, genotyping of the aforementioned SNP loci is performed on sweet corn breeding materials, and single plants with the target genotype are selected for subsequent hybridization or backcrossing. If the target genotype is GG, a short-stalked sweet corn variety with a low ear position will be bred; if the target genotype is AA, a tall-stalked sweet corn variety with a high ear position will be bred.

[0036] In addition, kits for detecting SNP molecular markers can be prepared based on the present invention, comprising the aforementioned specific primers, probes or sequencing reagents for specific detection of SNP sites.

[0037] Example 1: Analysis of population structure and classification of heterosis groups of sweet maize inbred lines

[0038] 1. Plant material and SNP chip typing:

[0039] This embodiment used 68 sweet corn inbred lines as the population structure analysis material. Genotyping was performed using a custom SNP chip containing 9,433 markers. Figure 1 As shown in (A), 9,433 SNP markers are evenly distributed across the 10 chromosomes of maize, covering the entire genome. After quality control, 8,484 high-quality SNP markers were retained for subsequent analysis.

[0040] 2. Group structure analysis:

[0041] Population structure analysis was performed on 68 sweet corn inbred lines. Based on 8,484 high-quality SNP markers, the population structure was inferred using STRUCTURE software, and the optimal number of subpopulations, K=4, was determined. Cluster analysis divided the 68 inbred lines into 4 subpopulations. Figure 1 As shown, the clustering diagram ( Figure 1 (B) Group structure diagram ( Figure 1 (C) and principal component analysis ( Figure 1 (D) both support the division of the 68 inbred lines into 4 subgroups (AD).

[0042] 3. Preparation of hybrid combinations and phenotypic identification:

[0043] Twenty-five representative inbred lines were selected from four subpopulations as hybridization parents. An incomplete diallel cross design was used, resulting in a total of 122 F1 hybrids. These 122 F1 hybrids underwent multi-environment field trials in Xi'an, Shaanxi Province, and Ledong County, Hainan Province, between 2021 and 2023. At maize maturity, plant height (PH, cm) and ear height (EH, cm) were measured. The best linear unbiased prediction (BLUP) for each F1 hybrid was extracted using a linear mixture model for association analysis.

[0044] Descriptive statistical analysis was performed on the phenotypic data of 122 F1 hybrids, and the results are shown in Table 1. The coefficient of variation for plant height was 13.19%, and the coefficient of variation for ear height was 20.84%, indicating rich phenotypic variation in both traits within the population. The broad-sense heritability (H²) for plant height was 0.58, and the broad-sense heritability (H²) for ear height was 0.50, indicating that these two traits are strongly regulated by genetic factors and are suitable for genetic mapping analysis. The absolute values ​​of skewness and kurtosis of the phenotypic data were both less than 1, conforming to the characteristics of a normal distribution and meeting the prerequisites for GWAS analysis.

[0045] Table 1. Descriptive statistical analysis of plant height and ear height in the F1 population (n=122)

[0046]

[0047] 4. Validation of heterosis groups:

[0048] Based on the four subgroups identified through population structure analysis, hybrid combinations were divided into inter-subgroup hybrid combinations (hybridization of parents from different subgroups) and intra-subgroup hybrid combinations (hybridization of parents within the same subgroup). Multi-environment joint ANOVA was performed on plant height and ear height, and the results are shown in Table 2. The hybridization type (inter-subgroup / intra-subgroup hybridization) effect had a significant impact on both plant height (PH) and ear height (EH) (P < 0.01), indicating that heterotic groups identified based on SNP markers can effectively predict the performance of hybrid combinations. The hybrid genotype effect reached a highly significant level on both traits (P < 0.001), indicating that genetic factors play a dominant role in phenotypic variation. The location effect also reached a highly significant level (P < 0.001), indicating that the environment has a significant impact on plant height and ear height.

[0049] Table 2. Joint ANOVA F-values ​​of plant height and ear height in sweet corn hybrids under multiple environmental conditions.

[0050]

[0051] Note: ** and *** represent P<0.01 and 0.001, respectively.

[0052] like Figure 2 As shown, the plant height of the interpopulation hybrid combinations ( Figure 2 (A) and ear height ( Figure 2 (B) The phenotypic values ​​were significantly higher than those of the hybrid combinations within the group, indicating that the heterosis groups based on SNP markers can effectively guide the selection of strong heterosis hybrid combinations.

[0053] Example 2: GWAS Analysis and SNP Marker Discovery

[0054] 1. GWAS analysis:

[0055] F1 genotypes were inferred from parental SNP microarray genotyping results. High-quality SNPs were retained for GWAS analysis after quality control. GWAS analysis was performed on 122 F1 hybrids using GAPIT3 software. Three models—MLM, CMLM, and BLINK—were employed, with the Q and K matrices as covariates. A p < 1 / N significance threshold was used.

[0056] 2. GWAS results:

[0057] like Figure 3 As shown in Table 3, a SNP locus (polymorphism A / G) significantly associated with both plant height and ear height was detected at 169,733,977 bp on chromosome 6. This locus was significantly detected in all three models: MLM, CMLM, and BLINK, and its peak was clearly visible in the Manhattan plot. Figure 3 (As indicated by the arrow). Figure 3 The QQ plot shows that the observed P-value is in good agreement with the expected P-value, indicating that the association results are reliable and there is no serious population stratification bias.

[0058] Table 3. SNP loci significantly associated with plant height and ear height.

[0059]

[0060] Note: MAF (Minor Allele Frequency); PVE (Phenotypic Variation Explained).

[0061] As shown in Table 3, the p-value of this locus in plant height was 4.32E-04, the p-value in ear height was 2.04E-05, the phenotypic variation explained rate (PVE) was 0.64, and the minimum allele frequency (MAF) was 0.22.

[0062] Candidate gene annotation shows that the SNP site is located within gene Zm00001d039086. This gene encodes a CHUP1-like protein, which is involved in photoinduced localization of chloroplasts and is associated with plant height regulation.

[0063] Example 3: Independent Verification of SNP Tags

[0064] 1. Test materials and primer design:

[0065] Ninety-five independent sweet maize inbred lines or hybrids were used as validation materials. A pair of specific PCR amplification primers were designed based on the flanking sequence of the SNP site shown in SEQ ID NO:1.

[0066] Upstream primer: 5'-ATGCAGGTGTTGGTTTTGGC-3' (SEQ ID NO:2);

[0067] Downstream primer: 5'-AGCTGGTGCTTCAAGGAGTC-3' (SEQ ID NO:3).

[0068] The primer pair amplifies a fragment of 256 bp in length, covering the target SNP site and its upstream and downstream flanking sequences.

[0069] 2. DNA extraction and PCR amplification:

[0070] Genomic DNA was extracted from the leaves of seedlings using a modified CTAB method. Using the genomic DNA as a template, PCR amplification was performed using primers shown in SEQ ID NO:2 and SEQ ID NO:3. The PCR amplification program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles; final extension at 72℃ for 5 min.

[0071] 3. Sanger sequencing and genotyping:

[0072] After verification by agarose gel electrophoresis, the PCR products were subjected to Sanger sequencing. The base sequences at positions 169,733,977 on chromosome 6 were read from the sequencing peak diagram: A / A homozygous peak indicates the AA genotype, G / G homozygous peak indicates the GG genotype, and A / G double peak indicates the AG heterozygous genotype.

[0073] 4. Verification Results

[0074] The genotyping and phenotypic statistics of the 95 validation materials are shown in Table 4. The average plant height of the AA genotype materials (52 materials) was 206.61 cm and the average ear height was 77.93 cm; the average plant height of the GG genotype materials (12 materials) was 129.47 cm and the average ear height was 47.02 cm.

[0075] Table 4 Genotypic grouping and phenotypic validation of sweet corn materials

[0076]

[0077] Analysis of variance showed that the average plant height and ear height of the AA genotype material were significantly higher than those of the GG genotype material (P < 0.05). Figure 4 As shown, the plant height of the AA genotype material ( Figure 4 A) and ear height ( Figure 4 B) The phenotypic values ​​were significantly higher than those of the GG genotype material, while the AG heterozygous material was in between. This result confirms that the SNP marker (Chr6:169,733,977) described in this invention can effectively distinguish the genetic potential of plant height and ear height in sweet corn materials at the seedling stage: the AA genotype indicator material has relatively high potential for plant height and ear height, while the GG genotype indicator material has relatively low potential for plant height and ear height.

[0078] Example 4: Other optional detection methods

[0079] In addition to the PCR amplification combined with Sanger sequencing method described above, those skilled in the art can also use conventional genotyping techniques in the art to detect the SNP sites described in this invention using the flanking sequences of the SNP sites disclosed in this invention (SEQ ID NO:1), including but not limited to ARMS-PCR, TaqMan probe method, SNP microarray method, KASP method, etc. These methods are all based on the SNP site information disclosed in this invention and can be implemented without inventive effort; therefore, they should fall within the protection scope of this invention.

[0080] Example 5: Application of SNP markers in sweet corn breeding

[0081] In sweet corn breeding, tender leaves of the breeding materials to be tested were taken during the seedling stage, and genotyping was performed according to the method in Example 3. Selection was based on the test results: if the goal was to breed short-stalked, low-ear-position varieties, GG genotype plants were selected; if the goal was to breed tall-stalked, high-ear-position varieties, AA genotype plants were selected. If the goal was to breed varieties with ideal and coordinated stalk and ear height, other plants were selected. Using seedling marker-assisted selection can significantly shorten the breeding cycle.

[0082] In summary, the SNP molecular markers provided by this invention have the following technical advantages:

[0083] 1. One cause, multiple effects; synergistic improvement:

[0084] For the first time, a single SNP marker significantly associated with both plant height and ear height was provided in sweet maize, enabling simultaneous screening of two key plant type traits with a single marker and significantly improving the efficiency of marker-assisted selection.

[0085] 2. Robust and reliable marking:

[0086] The marker was repeatedly detected in three independent GWAS models: MLM, CMLM, and BLINK, demonstrating extremely robust correlation signals and reducing the risk of false positives.

[0087] 3. Clear functional cues:

[0088] The marker is located within the known gene Zm00001d039086 (CHUP1-like), whose function in model plants provides a reasonable biological explanation for the synergistic genetic regulation of plant height and ear height.

[0089] 4. High selection efficiency:

[0090] Genotyping and selection can be completed during the seedling stage of sweet corn, eliminating the need to wait for the phenotype in the later stages of growth, significantly shortening the breeding cycle and reducing field workload.

[0091] 5. New uses for known genes:

[0092] The SNP site is located within the known gene Zm00001d039086, but this invention reveals for the first time the association between a specific SNP site within this gene and sweet corn plant height and ear height, giving this known gene a new application value—as a molecular marker for improving sweet corn plant architecture.

[0093] The above examples illustrate the present invention only to aid in understanding it and are not intended to limit the scope of the invention. Those skilled in the art can make various simple deductions, modifications, or substitutions based on the principles of this invention.

Claims

1. SNP molecular markers associated with plant height and ear height in sweet maize, characterized by: The SNP site is located at nucleotide 169,733,977 on chromosome 6 of the maize B73 reference genome RefGen_v4; The molecular marker sequence is shown in SEQ ID NO:1, with the 201st base from the 5' end exhibiting A / G polymorphism.

2. The SNP molecular markers related to sweet maize plant height and ear height according to claim 1, characterized in that: When the genotype at the 201st site of the molecular marker is AA, sweet corn exhibits relatively high plant height and ear height traits; When the genotype at the 201st locus of the molecular marker is GG, sweet corn exhibits relatively low plant height and ear height traits.

3. A specific primer for detecting the molecular marker as described in claim 1, characterized in that: The specific primers are PCR amplification primers, and their sequences are shown in SEQ ID NO:2 and SEQ ID NO:

3.

4. The application of the molecular marker as described in claim 1 or the specific primer as described in claim 3 in identifying sweet corn varieties with coordinated plant height and ear height.

5. A method for identifying sweet corn varieties in which plant height and ear height are coordinated, characterized by: Genomic DNA was extracted from the sweet corn to be tested, and PCR amplification was performed using the specific primers described in claim 3. After obtaining the amplification product, the amplification product was sequenced to detect the genotype at the 169,733,977 locus on chromosome 6. The plant height and ear height traits of the sweet corn were identified based on the base type.

6. The application of the molecular marker as described in claim 1 or the specific primer as described in claim 3 in the selection of sweet corn varieties with coordinated plant height and ear height.

7. A method for breeding sweet corn varieties with coordinated plant height and ear height, characterized in that: Genotyping of sweet corn breeding materials at the SNP loci was performed during the seedling stage, and single plants with the target genotype were selected for subsequent hybridization or backcrossing.

Images