KASP molecular marker for identifying soybean fusarium root rot resistance on chromosome 10 and application thereof

Abstract

The application discloses a KASP molecular marker for identifying soybean rhizoctonia solani root rot resistance located on chromosome 10 and application thereof, and belongs to the technical field of molecular marker assisted breeding. The application aims to provide an effective method for identifying soybean rhizoctonia solani root rot resistance. The application provides a KASP molecular marker for identifying soybean rhizoctonia solani root rot resistance, wherein the KASP molecular marker is shown in SEQ ID NO. 1 or SEQ ID NO. 2. The KASP molecular marker is suitable for rapid screening and molecular marker assisted breeding of soybean rhizoctonia solani root rot resistance grading.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker-assisted breeding technology, specifically relating to a KASP molecular marker located on chromosome 10 for identifying soybean resistance to Fusarium root rot and its application. Background Technology

[0002] Soybeans ( Glycine max Soybean root rot, as an important oilseed and protein crop, significantly impacts global food security due to its yield and quality. Many diseases can easily occur during its growth and development, leading to yield reduction and quality degradation in severe cases. Soybean root rot, a soil-borne fungal disease affecting soybean production, can occur throughout the entire soybean growth cycle. Severe damage can cause plant death, resulting in substantial yield losses. The pathogenic fungi causing this disease mainly include those of the genus *Fusarium* (*Fusarium*). Fusarium spp .), Pythium ( Pythium spp Phytophthora (.), Phytophthora ( Phytophthora spp .) and Rhizoctonia spp. ( Rhizoctonia spp Soybean Fusarium Root Rot (FORR) is susceptible to Fusarium oxysporum (…). Fusarium oxysporum Infection by *Fusarium oxysporum* occurs when *Fusarium oxysporum* survives in diseased plant debris in the soil as chlamydospores and mycelium. After germination, its conidia form germ tubes that directly invade the soybean roots through wounds or young root tips—naturally weak points. The mycelium grows between cell tissues, invading the vascular bundles and obstructing water transport. It secretes toxins such as fusaric acid, which disrupt cell membrane permeability, interfere with mitochondrial function, and cause metabolic disorders. Mycelia and conidial masses are produced at the base of the diseased plant stem, and spores are carried into the soil by water, completing the annual cycle. When soybeans are infected with *Fusarium oxysporum*, brown sunken spots appear on the taproot and lateral roots, sometimes encircling the taproot in severe cases. Later stages may involve root rot, a reduction in lateral and fibrous roots, and yellowing and wilting of leaves. Currently, control methods for *Fusarium oxysporum* root rot mainly rely on fungicides and seed treatment. Seed treatment is time-sensitive; it is effective during the seedling stage, but its effectiveness decreases significantly when applied during the flowering and podding stages, which are crucial for yield formation. Chemical fungicides are costly and pose environmental risks. Furthermore, pathogens develop resistance to the same fungicide over time. Therefore, breeding disease-resistant varieties is the most economical, efficient, and environmentally friendly sustainable strategy for controlling soybean root rot (caused by Fusarium oxysporum).

[0003] In traditional soybean breeding, the selection of disease resistance traits mainly takes place in the field and laboratory. For phenotypic identification, field work requires suitable disease nurseries, while laboratory work involves a series of steps including pathogen propagation, inoculation, and phenotypic identification. Both field and laboratory identification require considerable time and effort and are prone to subjective errors. This is because these traits are unstable at the individual plant level in early generations (e.g., F2, F3), and factors such as pleiotropic effects reduce the accuracy of phenotypic selection. To avoid these problems, marker-assisted selection (MAS) technology, using DNA molecular markers tightly linked to the target trait, allows breeders to quickly screen individuals carrying disease resistance genes directly at the seedling stage. This eliminates the need for disease nurseries and a series of laboratory phenotypic assessments, accelerating the breeding process and improving efficiency and accuracy. Over the past few decades, linkage and association analyses have located hundreds of quantitative trait loci (QTLs) associated with disease resistance in the soybean genome, providing theoretical support for the application of MAS. Summary of the Invention

[0004] The purpose of this invention is to provide an effective method for identifying soybean resistance to Fusarium root rot.

[0005] This invention provides a KASP molecular marker for identifying soybean resistance to Fusarium root rot, wherein the KASP molecular marker is shown in SEQ ID NO.1 or SEQ ID NO.2.

[0006] This invention provides a primer combination for amplifying the above-mentioned KASP molecular marker, with the forward primers shown in SEQ ID NO.3 and SEQ ID NO.4, and the reverse primer shown in SEQ ID NO.5.

[0007] This invention provides the application of the above-mentioned primer combination in the preparation of a kit for identifying soybean resistance to Fusarium root rot.

[0008] This invention provides a kit for identifying soybean resistance to Fusarium root rot, the kit comprising the primer combination described above.

[0009] To further specify, the kit also includes KASP Master Mix, F-HEX, and F-FAM.

[0010] This invention provides an application of the above-mentioned primer combination in identifying or assisting in the identification of soybean resistance to Fusarium root rot.

[0011] This invention provides the application of the above-mentioned kit in identifying or assisting in the identification of soybean resistance to Fusarium root rot.

[0012] This invention provides a method for identifying soybean resistance to Fusarium root rot. The specific steps of the method are as follows: extract genomic DNA from the soybean sample to be tested, perform PCR amplification of the soybean sample genomic DNA using the above-mentioned primer combination, and analyze the genotype.

[0013] To further define the criteria, when the genotyping result of the sample is consistent with the genotype CC of the soybean material resistant to Fusarium root rot, the soybean sample being identified exhibits the trait of resistance to Fusarium root rot; when the genotyping result of the sample is consistent with the genotype AA of the soybean material susceptible to Fusarium root rot, the soybean sample being identified exhibits the trait of susceptibility to Fusarium root rot.

[0014] To further specify, the method for analyzing genotypes is to use ABI Step One PCR to complete genotyping.

[0015] Beneficial Effects: This invention discloses KASP molecular markers closely linked to soybean resistance to Fusarium root rot and their applications. The obtained KASP markers of soybean genes regulating Fusarium root rot resistance provide a novel and simple molecular marker and marker-assisted selection method, suitable for rapid screening and marker-assisted breeding for grading soybean resistance to Fusarium root rot. These molecular markers can detect genotypes of materials with different resistance levels in natural populations and can also be used for molecular-assisted selection breeding of soybean materials with different resistance levels, replacing large-scale phenotypic screening, reducing field workload, and greatly improving the accuracy and efficiency of screening. Attached Figure Description

[0016] Figure 1 The following are GWAS association analysis diagrams: A: Phenotypic diagrams of various levels of soybean resistance to Fusarium root rot via hypocotyl inoculation; B: Histogram of soybean germplasm disease index (DSI) frequency distribution; C: Distribution of SNP variant sites in 530 resequencing accessions; DF: Genome-wide association analysis; H: Information on disease resistance-related SNP sites.

[0017] Figure 2 This is the result of genotyping and phenotypic association verification of molecular marker efficiency in extreme materials with different disease resistance levels in natural soybean populations according to the present invention; Allele1 / Allele1 represents FAM, indicating genotype CC; Allele2 / Allele2 represents HEX, indicating genotype AA; yellow indicates negative control with no signal; Figure 3 The results of the genotyping and phenotypic association verification in extreme materials with different disease resistance levels are shown in this invention; Allele1 / Allele1 represents FAM, indicating genotype CC; Allele2 / Allele2 represents HEX, indicating genotype AA; yellow indicates negative control with no signal. Detailed Implementation

[0018] Example 1. Development of KASP molecular markers for soybean resistance to Fusarium root rot 1. The resistance of 530 re-sequencing soybean germplasm resources to Fusarium root rot was identified using the hypocotyl inoculation method in etiolated seedlings. Figure 1 A), after statistical analysis, the disease index data of 530 resequencing germplasm resources conformed to a normal distribution ( Figure 1 B), and the soybean genotype data from different sources showed significant variation ( Figure 1 C). Association analysis of disease index and genotype in resequencing soybean germplasm resources was performed using GLM and MLM methods, respectively. Figure 1 (DG), a total of 10 significant SNP loci were screened, and the locus information is as follows: Figure 1 As shown in H.

[0019] 2. The 41250185 bp locus on chromosome 10 of soybean Wm82.a2.v1 is highly correlated with the soybean resistance to Fusarium root rot. The genotype at this locus is C or A. The genotype CC indicates resistance, and the genotype AA indicates susceptibility. Molecular markers (SEQ ID NO.1 and SEQ ID NO.2) were developed for this locus (SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5). The accuracy and efficiency of KASP marker detection were verified using extreme materials shown in Table 2. Finally, KASP molecular markers closely linked to the soybean resistance to Fusarium root rot were obtained.

[0020] The SNP marker is located at a locus of 41250185 bp on chromosome 10 of soybean genome version Wm82.a2.v1, with genotypes of C or A. The molecular marker is an SNP mutation marker, classified into genotypes C and A. The 50 bp sequences before and after the molecular marker locus are as follows: ATGAGATAATCTTGTCTTATTCTATACAGTAAAATTATGTTTACCGTGTTCTTATGAAACTAATTTTTTCTCTCACTTCTTTATTATGTTTGGTTATAGTT; SEQ ID NO.1.

[0021] or ATGAGATAATCTTGTCTTATTCTATACAGTAAAATTATGTTTACCGTGTTATTATGAAACTAATTTTTTCTCTCACTTCTTTATTATGTTTGGTTATAGTT; SEQ ID NO. 2.

[0022] 3. The sequence of the molecular marker primer combination is as follows: Forward primer F-FAM: 5'-GAAGGTGACCAAGTTCATGCT CTATACARTAAAATTATGTTTACCGTGTTc -3';SEQ IDNO.3; Forward primer F-HEX: 5'-GAAGGTCGGAGTCAACGGATT CTATACARTAAAATTATGTTTACCGTGTTa -3';SEQ IDNO.4; Reverse primer R: 5'-CTCCGCCCCTCGACAAGAA-3'; SEQ ID NO. 5.

[0023] Example 2. Kit for identifying soybean Fusarium root rot The PCR reaction system consisted of: 5.0 μL of 30-50 ng / μL soybean genomic DNA, 5.0 μL of KASP Master Mix, and 0.14 μL of KASP Assay Mix (primer concentrations were all 10 ng / μL and met the molar ratio of F-HEX:F-FAM:R=2:2:5), for a total volume of 10.14 μL.

[0024] Example 3. Detection of KASP molecular marker efficiency. KASP molecular marker detection was performed on natural soybean populations, as detailed below: (1) DNA extraction Genomic DNA was extracted from leaves / seeds of natural soybean populations using the CTAB method.

[0025] (2) PCR amplification The PCR reaction system consisted of: 5.0 μL of 30-50 ng / μL soybean genomic DNA, 5.0 μL of KASP Master Mix, and 0.14 μL of KASP Assay Mix (primer concentrations were all 10 ng / μL and met the molar ratio of F-HEX:F-FAM:R=2:2:5), for a total volume of 10.14 μL.

[0026] The PCR reaction program was as follows: 30℃, 1 minute (read fluorescence signal); 94℃, 15 minutes (pre-denaturation); 94℃, 20 seconds (denaturation); 61℃ (-0.6℃ / cycle) annealing for 60 seconds, 10 cycles; 94℃, 20 seconds (denaturation); 55℃, annealing for 60 seconds, 31-35 cycles. 30℃, 1 minute (read fluorescence signal).

[0027] PCR amplification was performed on the ABI Step One PCR instrument, and the genotyping information could be obtained directly after the instrument detected the fluorescence signal.

[0028] The forward primers F-HEX and F-FAM each have their own fluorescent adapters (red for CC genotype and blue for AA genotype). If the material being tested is homozygous, only one corresponding primer will be selected for amplification. The fluorescence difference indicates whether the tested material is homozygous CC or AA. If the material being tested is heterozygous, both primers will amplify, producing a third fluorescent signal, thus distinguishing heterozygous genotypes.

[0029] Genotyping of natural populations, disease index statistics, and classification of resistance and susceptibility levels (resistance (R, 0 ≤ disease index < 40), susceptibility (S, 40 ≤ disease index < 100)) are shown in Table 1.

[0030] like Figure 2 (Where blue represents the AA genotype susceptible to Fusarium root rot; red represents the CC genotype resistant to Fusarium root rot; and yellow represents the negative control with no fluorescent signal) and as shown in Table 1.

[0031] like Figure 3 The results showed that the disease index of homozygous CC genotype soybean (30.81) was significantly lower than that of AA genotype soybean (65.80). Therefore, the molecular markers of this invention are mainly used for the initial screening of soybean varieties resistant to Fusarium root rot, in order to achieve the purpose of molecular marker-assisted breeding.

[0032] Table 2 Molecular marker detection of disease index in extreme materials

[0033] Example 4. Method for identifying soybean resistance to Fusarium root rot KASP molecular marker detection was performed on natural soybean populations, as detailed below: (1) DNA extraction Genomic DNA was extracted from leaves / seeds of natural soybean populations using the CTAB method.

[0034] (2) PCR amplification The PCR reaction system consisted of: 5.0 μL of 30-50 ng / μL soybean genomic DNA, 5.0 μL of KASP Master Mix, and 0.14 μL of KASP Assay Mix (primer concentrations were all 10 ng / μL and met the molar ratio of F-HEX:F-FAM:R=2:2:5), for a total volume of 10.14 μL.

[0035] The PCR reaction program was as follows: 30℃, 1 minute (read fluorescence signal); 94℃, 15 minutes (pre-denaturation); 94℃, 20 seconds (denaturation); 61℃ (-0.6℃ / cycle) annealing for 60 seconds, 10 cycles; 94℃, 20 seconds (denaturation); 55℃, annealing for 60 seconds, 31-35 cycles. 30℃, 1 minute (read fluorescence signal).

[0036] PCR amplification was performed on the ABI Step One PCR instrument, and the genotyping information could be obtained directly after the instrument detected the fluorescence signal.

[0037] The forward primers F-HEX and F-FAM each have their own fluorescent adapters (red for CC genotype and blue for AA genotype). If the material being tested is homozygous, only one corresponding primer will be selected for amplification. The fluorescence difference indicates whether the tested material is homozygous CC or AA. If the material being tested is heterozygous, both primers will amplify, producing a third fluorescent signal, thus distinguishing heterozygous genotypes.

[0038] The results of disease index, resistance / susceptibility grading, and molecular marker identification of 83 natural soybean germplasm materials are as follows: As shown in Table 2, soybeans with genotype AA should be susceptible to Fusarium root rot, while soybeans with genotype CC should be resistant to Fusarium root rot. The theoretical results are basically consistent with the measured disease index and resistance / susceptibility grading. Molecular markers can detect different genotypes of materials with different disease indices and resistance / susceptibility gradings in natural populations, further clarifying that these molecular markers can be used for molecular-assisted selection breeding of soybean materials with different disease indices and resistance / susceptibility gradings. (Resistant (R, 0 ≤ disease index < 40), Susceptible (S, 40 ≤ disease index < 100)).

[0039] Table 2 Genotyping and Disease Index Data of Natural Populations

Claims

1. A KASP molecular marker for identifying soybean resistance to Fusarium root rot, characterized in that, The KASP molecular marker is shown in SEQ ID NO.1 or SEQ ID NO.

2.

2. The primer combination for amplifying the KASP molecular marker according to claim 1, characterized in that, The forward primers are shown in SEQ ID NO.3 and SEQ ID NO.4, and the reverse primers are shown in SEQ ID NO.

5.

3. The use of the primer combination described in claim 2 in the preparation of a kit for identifying soybean resistance to Fusarium root rot.

4. The application of the primer combination according to claim 2 in the identification or auxiliary identification of soybean resistance to Fusarium root rot.

5. A kit for identifying soybean resistance to Fusarium root rot, characterized in that, The kit comprises the primer combination as described in claim 2.

6. The reagent kit according to claim 5, characterized in that, The kit also includes KASP Master Mix, F-HEX, and F-FAM.

7. The use of the kit according to claim 5 or 6 in the identification or auxiliary identification of soybean resistance to Fusarium root rot.

8. A method for identifying soybean resistance to Fusarium root rot, characterized in that, The specific steps of the method are as follows: extract genomic DNA from the soybean sample to be tested, perform PCR amplification of the soybean sample genomic DNA using the primer combination described in claim 2, and analyze genotyping.

9. The method according to claim 8, characterized in that, When the genotyping result of the sample is consistent with the genotype CC of soybean material resistant to Fusarium root rot, the soybean sample being identified exhibits the trait of resistance to Fusarium root rot; when the genotyping result of the sample is consistent with the genotype AA of soybean material susceptible to Fusarium root rot, the soybean sample being identified exhibits the trait of susceptibility to Fusarium root rot.

10. The method according to claim 8, characterized in that, The method for analyzing genotypes is to use ABI Step One PCR to perform genotyping.

Images