A kasp molecular marker method related to high content of barley anthocyanin and application thereof

Abstract

The application discloses a high-content KASP molecular marker method related to high-content anthocyanin of highland barley and application thereof, and belongs to the technical field of molecular markers. The application develops a group of KASP molecular marker primers by analyzing a highland barley genome and aiming at a SNP site (T / C base variation exists) at a position of 601139487 on the 4th chromosome. The primer group comprises two specific upstream primers and one downstream primer, and can accurately distinguish T and C alleles. Experiments show that highland barley materials with genotypes of T:T or T:C at the position of 601139487 on the 4th chromosome have significantly higher grain anthocyanin content than materials with a genotype of C:C. The KASP marker detection method based on the above primer group has advantages of high accuracy, rapidness, low cost, simple operation and the like, is suitable for screening of large-scale breeding populations, can be used for breeding of highland barley varieties with high anthocyanin content, and has important application value.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker technology, specifically relating to a KASP molecular marker method related to high anthocyanin content in highland barley and its application. Background Technology

[0002] Highland barley ( Hordeum vulgare L. var. nudum Barley is an important food crop in the Qinghai-Tibet Plateau region, rich in various nutrients. Among them, anthocyanins are natural water-soluble pigments with strong antioxidant activity, beneficial to human health, and giving barley grains their unique purple, blue, and other colors. Barley varieties with high anthocyanin content have significant advantages in the development of functional foods and market value. However, the determination of anthocyanin content in traditional breeding relies on chemical extraction and spectrophotometry, a cumbersome, time-consuming process that requires destructive sampling, making large-scale screening difficult in early generations. Therefore, developing molecular markers closely related to anthocyanin content is crucial for improving breeding efficiency and accuracy.

[0003] KASP (Kompetitive Allele-Specific PCR) technology identifies SNP sites using fluorescent probes and has advantages such as high throughput, low cost, and simple operation, making it widely used in marker-assisted selection. Identifying key SNP sites controlling anthocyanin accumulation and developing KASP markers can greatly accelerate the breeding process of highland barley varieties with high anthocyanin content. Summary of the Invention

[0004] To address the problems of low detection efficiency and difficulty in early screening of barley anthocyanin content in existing technologies, this invention provides a KASP molecular marker method related to high barley anthocyanin content and its application.

[0005] This invention, through genome-wide association analysis, identified a SNP locus at position 601139487 on chromosome 4 of barley, significantly associated with anthocyanin content in the grains, exhibiting a T / C base variation. Phenotypic association analysis showed that materials with homozygous (T:T) or heterozygous (T:C) T alleles had significantly higher anthocyanin content than those with homozygous (C:C) alleles. Based on this locus, this invention designed a set of KASP primers (SEQ ID No. 1~3), where two upstream primers specifically recognize the T and C alleles, respectively, and are linked to different fluorescent tags (FAM / HEX). Genotyping can be rapidly determined by fluorescence signal typing.

[0006] Specifically, this invention provides a molecular marker primer combination, which consists of two specific upstream primers and one downstream primer; The two specific upstream primers are a first upstream primer for detecting whether position 601139487 on chromosome 4 of barley is a T base and a second upstream primer for detecting whether position 601139487 on chromosome 4 of barley is a C base. The downstream primer can be used together with the first upstream primer or the second upstream primer to amplify the fragment containing the site.

[0007] Further, the first upstream primer contains the nucleotide sequence shown in SEQ ID No. 1, the second upstream primer contains the nucleotide sequence shown in SEQ ID No. 2, and the downstream primer contains the nucleotide sequence shown in SEQ ID No. 3.

[0008] Further, the nucleotide sequence of the first upstream primer is shown in SEQ ID No. 1, the nucleotide sequence of the second upstream primer is shown in SEQ ID No. 2, and the nucleotide sequence of the downstream primer is shown in SEQ ID No. 3.

[0009] Furthermore, the 5' ends of the first upstream primer and the second upstream primer are respectively connected to different fluorescent tag sequences.

[0010] Furthermore, the different fluorescent tag sequences are the FAM fluorescent tag sequence and the HEX fluorescent tag sequence, respectively.

[0011] The present invention also provides a kit comprising the above-described molecular marker primer combination.

[0012] This invention also provides a method for identifying the anthocyanin content of highland barley, comprising the following steps: S1. Extract genomic DNA from the barley sample to be tested; S2. Using the genomic DNA obtained in step S1 as a template, perform PCR amplification using the molecular marker primer combination described in any one of claims 1 to 5 to obtain PCR products; S3. Genotyping the PCR products obtained in step S2: The genotype of the PCR product is T:T, T:C, or C:C; If the genotype of the PCR product is T:T, it is determined to be a high-anthocyanin-content type; If the genotype of the PCR product is T:C, it is determined to be a type with medium anthocyanin content; If the genotype of the PCR product is C:C, it is determined to be a low-anthocyanin type.

[0013] Furthermore, in the high-anthocyanin type, the anthocyanin content is >400 µg / g; in the medium-anthocyanin type, the anthocyanin content is 100~400 µg / g; and in the low-anthocyanin type, the anthocyanin content is <100 µg / g.

[0014] Furthermore, the barley sample is a barley leaf sample.

[0015] Furthermore, the PCR amplification reaction system includes KASP 2×PCR mix, genomic DNA of the barley sample to be tested, and the molecular marker primer combination as described in any one of claims 1 to 5.

[0016] Furthermore, the PCR amplification reaction program is as follows: 95℃ for 15 min; 95℃ for 10 s, 65℃ for 60 s, 10 cycles, decreasing by 1℃ per cycle; 95℃ for 10 s, 57℃ for 60 s, 30 cycles; 30℃ for 30 s.

[0017] The present invention also provides the application of the above-mentioned molecular marker primer combination in identifying or assisting in the identification of barley anthocyanin content typing, in the preparation of a kit for identifying barley anthocyanin content typing, or in the assisted breeding of barley with high anthocyanin content.

[0018] The present invention has achieved the following beneficial effects: The KASP molecular marker provided by this invention can accurately distinguish the T / C genotype at locus 601139487 on chromosome 4 of barley materials, and the genotype is highly correlated with anthocyanin content. This method eliminates the need for anthocyanin extraction, requires only a small amount of leaf DNA, and can be performed non-destructively at the seedling stage, significantly shortening the breeding cycle. Furthermore, this method is simple to operate, low in cost, and suitable for screening large-scale breeding populations, providing a powerful molecular tool for improving the quality of barley.

[0019] Obviously, based on the above description of the present invention, and according to common technical knowledge and conventional methods in the field, various other modifications, substitutions or alterations can be made without departing from the basic technical concept of the present invention.

[0020] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following examples. Attached Figure Description

[0021] Figure 1 The Manhattan plot of genome-wide association analysis (GWAS) of anthocyanin content in highland barley shows a significant association at locus 601139487 on chromosome 4.

[0022] Figure 2A bar chart comparing the anthocyanin content of barley grains from two genotypes (T:T and C:C) shows that the content of the T:T genotype is significantly higher than that of the C:C genotype. Detailed Implementation

[0023] The raw materials and equipment used in this invention are all known products, obtained by purchasing commercially available products.

[0024] The following experiments, where no temperature is specified, are reactions conducted under normal temperature conditions, which is room temperature, or 25±5℃.

[0025] Example 1: Design of KASP molecular marker primer combinations related to anthocyanin content in highland barley The experimental materials of highland barley used in this embodiment totaled 42 samples, including varieties with known high anthocyanin content (purple, black and blue kernels) and low anthocyanin content (blue kernels).

[0026] 1. Anthocyanin content determination and phenotypic grading Mature highland barley grains were harvested, hulled, and ground into powder. Anthocyanins were extracted using a methanol-hydrochloric acid extraction method. The absorbance was measured at 530 nm using a UV-Vis spectrophotometer. A standard curve was plotted using cyanidin-3-glucoside as a standard, and the total anthocyanin content (µg / g) was calculated. The content test results are shown in Table 1. Based on the content, the materials were divided into three groups: high content (>400µg / g), medium content (100~400 µg / g), and low content (<100µg / g).

[0027] 2. Sample Collection and DNA Extraction Young leaves were collected during the seedling stage, flash-frozen in liquid nitrogen, and stored at -80℃. Genomic DNA was extracted using the CTAB method, following the same procedures as conventional methods. Finally, the DNA was dissolved in ddH2O, and its concentration and quality were determined.

[0028] 3. SNP site determination and primer design Based on previous GWAS results ( Figure 1 A T / C SNP exists at locus 601139487 on chromosome 4 of barley (genome version information: e!DAL-PGP Repository-PGSB_full-length-LTR-retrotransposons-v1__Barley__Morex.gff.gz), and this SNP is significantly associated with anthocyanin content (P<1×10⁻). 6 () Figure 2 For this site, the following KASP primer set was designed: First upstream primer (recognizes the T allele, with a FAM tag attached to the 5' end): SEQ ID No.1: 5'-[ GAAGGTGACCAAGTTCATGCTGGTGTCACCTTGCACCACTCT-3' Second upstream primer (recognizes the C allele, with a HEX tag attached to the 5' end): SEQ ID No.2: 5'-[ GAAGGTCGGAGTCAACGGATT GGTGTCACCTTGCACCACTCC-3' Downstream primer (universal): SEQ ID No.3: 5'-TGCGGTCGATGACGGGTGG-3' The underlined portion represents the fluorescent tag sequence, with the 3' terminal bases of the specific sequence corresponding to the T and C alleles, respectively. The amplification product is 118 bp in length.

[0029] Example 2: KASP labeling verification and correlation analysis with anthocyanin content 1. Genotyping Forty-two barley samples from Example 1 were used to extract leaf DNA, which was diluted to 100 ng / μL. The KASP reaction system (10 μL) consisted of: 5 μL KASP 2×PCR mix, 5 μL DNA template, and 0.14 μL of the KASP primer set mixture from Example 1 (containing two upstream and downstream primers, each at 10 μM). The PCR program was as follows: 95℃ for 15 min; 95℃ for 10 s, 65℃ for 60 s (10 cycles, decreasing by 1℃ per cycle); 95℃ for 10 s, 57℃ for 60 s (30 cycles); 30℃ for 30 s. After amplification, fluorescence scanning was performed using a Bio-Rad CFX96.

[0030] Judgment criteria: FAM signal only → Genotype T:T; HEX signal only → Genotype C:C; Both signals are present → Genotype T:C.

[0031] The genotyping results of the barley samples are shown in Table 1.

[0032] 2. Association Analysis Table 1. Comparison of genotyping and measured anthocyanin content results in highland barley samples Note: In the table, H type represents heterozygous T:C type.

[0033] The genotyping results were compared with the measured anthocyanin content obtained by UV-Vis spectrophotometry in Example 1. The analysis revealed that the T allele significantly increased anthocyanin accumulation in highland barley (P<0.001). Specifically: the average anthocyanin content of T-type highland barley material was 475.2 µg / g, which is high (>400 µg / g); the average anthocyanin content of T-type C was 295.9 µg / g, which is medium (100~400 µg / g); and the average anthocyanin content of C-type C was 12.7 µg / g, which is low (<100 µg / g).

[0034] The above results show that the KASP marker method developed in this invention can efficiently and accurately distinguish the T / C genotype at the 601139487 locus on chromosome 4 of barley, and this genotype is closely related to the anthocyanin content of the grains, and can be used for the breeding of barley varieties with high anthocyanin content.

Claims

1. A molecular marker primer combination, characterized in that, The molecular marker primer combination consists of two specific upstream primers and one downstream primer; The two specific upstream primers are a first upstream primer for detecting whether position 601139487 on chromosome 4 of barley is a T base and a second upstream primer for detecting whether position 601139487 on chromosome 4 of barley is a C base. The downstream primer can be used together with the first upstream primer or the second upstream primer to amplify the fragment containing the site.

2. The molecular marker primer combination according to claim 1, characterized in that, The first upstream primer contains the nucleotide sequence shown in SEQ ID No. 1, the second upstream primer contains the nucleotide sequence shown in SEQ ID No. 2, and the downstream primer contains the nucleotide sequence shown in SEQ ID No.

3.

3. The molecular marker primer combination according to claim 2, characterized in that, The nucleotide sequence of the first upstream primer is shown in SEQ ID No. 1, the nucleotide sequence of the second upstream primer is shown in SEQ ID No. 2, and the nucleotide sequence of the downstream primer is shown in SEQ ID No.

3.

4. The molecular marker primer combination according to any one of claims 1 to 3, characterized in that, The first upstream primer and the second upstream primer have different fluorescent tag sequences attached to their 5' ends.

5. The molecular marker primer combination according to claim 4, characterized in that, The different fluorescent tag sequences are the FAM fluorescent tag sequence and the HEX fluorescent tag sequence, respectively.

6. A reagent kit, characterized in that, The kit comprises the molecular marker primer combination as described in any one of claims 1 to 5.

7. A method for identifying the anthocyanin content of highland barley, characterized in that, Includes the following steps: S1. Extract genomic DNA from the barley sample to be tested; S2. Using the genomic DNA obtained in step S1 as a template, perform PCR amplification using the molecular marker primer combination described in any one of claims 1 to 5 to obtain PCR products; S3. Genotyping the PCR products obtained in step S2: The genotype of the PCR product is T:T, T:C, or C:C; If the genotype of the PCR product is T:T, it is determined to be a high-anthocyanin-content type; If the genotype of the PCR product is T:C, it is determined to be a type with medium anthocyanin content; If the genotype of the PCR product is C:C, it is determined to be a low-anthocyanin type.

8. The identification method according to claim 7, characterized in that, The PCR amplification reaction system includes KASP 2×PCR mix, genomic DNA of the barley sample to be tested, and the molecular marker primer combination as described in any one of claims 1 to 5.

9. The identification method according to claim 7 or 8, characterized in that, The PCR amplification reaction program was as follows: 95℃ for 15 min; 95℃ for 10 s, 65℃ for 60 s, 10 cycles, decreasing by 1℃ per cycle; 95℃ for 10 s, 57℃ for 60 s, 30 cycles; 30℃ for 30 s.

10. The molecular marker primer combination according to any one of claims 1 to 5 is used in identifying or assisting in the identification of barley anthocyanin content typing, in preparing a kit for identifying barley anthocyanin content typing, or in assisting in the breeding of barley with high anthocyanin content.

Images