A colored highland barley related KASP molecular marker method and application thereof

Abstract

The application discloses a colored highland barley related KASP molecular marker method and application thereof, and belongs to the technical field of molecular markers. The application finds a SNP site significantly related to seed color through whole genome association analysis at the 9,399,166th position of the 2nd chromosome of highland barley, and T / C base variation exists. Among them, the T allele is highly associated with colored seeds (blue, purple and black), and the C allele is highly associated with colorless seeds (green). A set of KASP molecular marker primers are developed based on the site, and the genotypes of the site can be accurately distinguished. The marker detection method provided by the application has the advantages of high throughput, rapidness, low cost, simple operation and the like, can be used for non-destructive screening at the seedling stage, greatly improves the breeding efficiency of colored highland barley varieties, and has important application value.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker technology, specifically relating to a KASP molecular marker method for colored highland barley and its application. Background Technology

[0002] Highland barley ( Hordeum vulgare L. var. nudum Barley (blue, purple, and black) is a major grain crop on the Qinghai-Tibet Plateau, with its grains exhibiting diverse colors, including cyan, blue, purple, and black. Colored barley is rich in antioxidants such as anthocyanins, possessing higher nutritional value and market premium, making it an important target for functional food development and specialty variety breeding (Analysis of Quality Differences among Different Barley Varieties in Tibet, Barley and Cereal Science 2017, 34(1):28-32,41). However, seed color phenotypes cannot be directly observed in the early stages of breeding (seedling stage), and traditional methods require waiting until grain maturity for identification, severely restricting the breeding process. Furthermore, color traits are regulated by multiple genes, and environmental factors may also affect performance. Therefore, developing stable and reliable molecular markers for high-throughput screening in early generations is crucial for accelerating colored barley breeding.

[0003] KASP (Kompetitive Allele-Specific PCR) technology, with its advantages of high specificity, low cost, and ease of operation, has been widely used in SNP genotyping. Discovering key SNP sites controlling seed color and developing corresponding KASP markers can provide an efficient tool for improving the quality of highland barley. Summary of the Invention

[0004] To address the problems of existing technologies for identifying colored highland barley, which rely on mature grains, have long cycles, and are inefficient, this invention provides a KASP molecular marker method for screening colored highland barley.

[0005] This invention, through genome-wide association analysis (GWAS), identified a SNP locus (T / C variant) at position 9,399,166 of chromosome 2 in barley that is significantly associated with seed color. Genotypic and phenotypic association analysis of a large number of germplasm resources confirmed that the T allele is closely associated with blue, purple, and black (collectively referred to as colored) seeds, while the C allele is closely associated with cyan (referred to as colorless) seeds. Based on this locus, this invention designed a set of KASP primers (SEQ ID No. 1~3), where two upstream primers specifically recognize the T and C alleles, respectively, and are linked to FAM and HEX fluorescent tags, respectively. Genotyping can be accurately determined by fluorescence signal typing.

[0006] Specifically, this invention provides a molecular marker primer combination, which consists of two specific upstream primers and one downstream primer; The two specific upstream primers are a first upstream primer for detecting whether the 9th, 399th, 166th position on the second chromosome of barley is a T base and a second upstream primer for detecting whether the 9th, 399th, 166th position on the second chromosome of barley is a C base. The downstream primer can be used together with the first upstream primer or the second upstream primer to amplify the fragment containing the 9th, 399th, 166th position on the second chromosome of barley.

[0007] Further, the first upstream primer contains the nucleotide sequence shown in SEQ ID No. 1, the second upstream primer contains the nucleotide sequence shown in SEQ ID No. 2, and the downstream primer contains the nucleotide sequence shown in SEQ ID No. 3.

[0008] Further, the nucleotide sequence of the first upstream primer is shown in SEQ ID No. 1, the nucleotide sequence of the second upstream primer is shown in SEQ ID No. 2, and the nucleotide sequence of the downstream primer is shown in SEQ ID No. 3.

[0009] Furthermore, the 5' ends of the first upstream primer and the second upstream primer are respectively connected to different fluorescent tag sequences.

[0010] Furthermore, the different fluorescent tag sequences are the FAM fluorescent tag sequence and the HEX fluorescent tag sequence, respectively.

[0011] The present invention also provides a kit comprising the above-described molecular marker primer combination.

[0012] This invention also provides a method for screening the color of highland barley seeds, comprising the following steps: S1. Extract genomic DNA from the barley sample to be tested; S2. Using the genomic DNA obtained in step S1 as a template, perform PCR amplification using the molecular marker primer combination described in any one of claims 1 to 5 to obtain PCR products; S3. Genotyping the PCR products obtained in step S2: The genotype of the PCR product is T:T, T:C, or C:C; if the genotype of the PCR product is T:T, the barley seed is determined to be colored, and the colored type is blue, purple, or black. If the PCR product genotype is C:C, it is determined to be colorless, and colorless is cyan.

[0013] Furthermore, if the PCR product genotype is T:C, it is determined to be pending confirmation; other existing technical methods are needed to confirm the seed color.

[0014] Furthermore, the barley sample is a barley leaf sample.

[0015] Furthermore, the PCR amplification reaction system includes KASP 2×PCR mix, the barley genomic DNA to be tested, and the molecular marker primer combination as described in any one of claims 1 to 5.

[0016] Furthermore, the PCR amplification reaction program is as follows: 95℃ for 15 min; 95℃ for 10 s, 65℃ for 60 s, 10 cycles, decreasing by 1℃ per cycle; 95℃ for 10 s, 57℃ for 60 s, 30 cycles; 30℃ for 30 s.

[0017] The present invention also provides the application of the above-mentioned molecular marker primer combination in screening or assisting screening of barley seed color, in preparing a kit for screening barley seed color, or in assisting breeding of colored barley varieties.

[0018] The present invention has achieved the following beneficial effects: The KASP marker provided by this invention can accurately distinguish the T / C genotype of barley materials at loci 9,399,166 on chromosome 2, and the genotype is highly consistent with seed color. This method requires only a small amount of seedling leaf DNA and does not require waiting for grain maturity, enabling early, non-destructive screening and significantly shortening the breeding cycle. Furthermore, this method is simple to operate, low in cost, and suitable for large-scale breeding populations, providing a reliable molecular tool for the targeted breeding of colored barley varieties.

[0019] It should be noted that a core objective of this invention is to provide a seed color-assisted screening method for large-scale barley germplasm resources or early-generation breeding populations. This invention is explicitly distinguished from "identification methods" aimed at precisely identifying the final phenotype of each individual seed. Its technical contribution lies in utilizing the high linkage between the SNP locus at position 9,399,166 on chromosome 2 and the color phenotype to rapidly anchor homozygous extreme materials in large-scale populations. Specifically, this method eliminates the need for tedious field planting or phenotypic evaluation of each sample; it only requires detecting this SNP locus to efficiently eliminate C:C homozygous (colorless) individuals and accurately identify T:T homozygous (colored) individuals. For T:C heterozygous materials with complex genetic backgrounds leading to unstable phenotypes, this invention explicitly categorizes them as "needing further retesting or elimination" and excludes them from direct judgment. Through this "non-diagnostic" screening strategy, the present invention can significantly reduce the workload of effective screening of large-scale populations without relying on complete phenotypic data, significantly save field planting costs and manual recording costs in the early stages of breeding, and provide an efficient and low-cost primary screening tool for molecular marker-assisted selection of barley color traits.

[0020] Obviously, based on the above description of the present invention, and according to common technical knowledge and conventional methods in the field, various other modifications, substitutions or alterations can be made without departing from the basic technical concept of the present invention.

[0021] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following examples. Attached Figure Description

[0022] Figure 1 The Manhattan plot of the genome-wide association analysis (GWAS) of barley seed color shows that locus 9,399,166 on chromosome 2 reached the significant association threshold. Detailed Implementation

[0024] The raw materials and equipment used in this invention are all known products, obtained by purchasing commercially available products.

[0025] The following experiments, where no temperature is specified, are reactions conducted under normal temperature conditions, which is room temperature, or 25±5℃.

[0026] Example 1: Design of KASP molecular marker primer combinations related to colored highland barley The experimental materials of highland barley used in this embodiment totaled 47 samples, covering known color varieties such as blue, purple, black, and cyan. As shown in Table 1.

[0027] 1. Seed color phenotypic identification and grading Harvest mature seeds, observe them visually under natural light and take photos to record their color, classifying them into colored (blue, purple, black) and colorless (cyan) categories.

[0028] 2. Sample Collection and DNA Extraction Young leaves were collected during the seedling stage, flash-frozen in liquid nitrogen, and stored at -80℃. Genomic DNA was extracted using the CTAB method, following the same procedures as conventional methods. Finally, the DNA was dissolved in ddH2O, and its concentration and quality were determined.

[0029] 3. SNP site determination and primer design Based on previous GWAS results ( Figure 1 A T / C SNP exists at locus 9,399,166 on chromosome 2 (genome version information: e!DAL-PGP Repository-PGSB_full-length-LTR-retrotransposons-v1__Barley__Morex.gff.gz), which is significantly associated with seed color (P<1×10⁻). 6For this site, the following KASP primer set was designed (the sequences below are examples; actual sequences can be designed and replaced based on the flanking sequences of the site): First upstream primer (recognizes the T allele, with a FAM tag attached to the 5' end): SEQ ID No. 1: 5'-[ GAAGGTGA CCAAGTTCATGCT CCTTCAAGCCATTGGGTATCGATGAT]-3' Second upstream primer (recognizes the C allele, with a HEX tag attached to the 5' end): SEQ ID No. 2: 5'- GAAGGTCGG AGTCAACGGATT CCTTCAAGCCATTGGGTATCGATGAC-3' Downstream primer (universal): SEQ ID No. 3: 5'-TTGGCCTCAACCATGTCAAGGATTGC-3' The underlined portion is the fluorescent tag sequence, and the 3' terminal bases of the specific sequence correspond to the T and C alleles, respectively. The amplification product is approximately 91 bp in length.

[0030] Example 2: KASP marker verification and correlation analysis with seed color 1. Genotyping Leaf DNA was extracted from 47 barley samples from Example 1 and diluted to 100 ng / μL. The KASP reaction system (10 μL) consisted of 5 μL KASP 2×PCR mix, 5 μL DNA template, and 0.14 μL of the KASP primer set mixture from Example 1 (containing two upstream primers and one downstream primer, each at 10 μM). The PCR program was as follows: 95℃ for 15 min; 95℃ for 10 s, 65℃ for 60 s (10 cycles, decreasing by 1℃ per cycle); 95℃ for 10 s, 57℃ for 60 s (30 cycles); 30℃ for 30 s. After amplification, fluorescence scanning was performed using a Bio-Rad CFX96.

[0031] Classification criteria: FAM signal only → Genotype T:T; HEX signal only → Genotype C:C; Both signals are present → Genotype T:C.

[0032] The genotyping results of the barley samples are shown in Table 1.

[0033] 3. Association Results The genotyping results were compared with the actual observed color of mature grains, as shown in Table 1.

[0034] Table 1. Genotyping and Grain Color Comparison of Barley Samples Note: In the table, H type represents heterozygous T:C type.

[0035] Analysis revealed that all T:T type kernels were colored (black, blue, or purple); all C:C type kernels were colorless (cyan). The T:C type kernels exhibited either a colored or colorless appearance, requiring further confirmation of kernel color using other methods.

[0036] The above results show that the KASP marker method developed in this invention can efficiently and accurately distinguish the T / C genotype at locus 9,399,166 on chromosome 2 of barley, and the genotype is closely related to seed color. It can be used for early screening of colored barley and molecular marker-assisted breeding.

Claims

1. A molecular marker primer combination, characterized in that, The molecular marker primer combination consists of two specific upstream primers and one downstream primer; The two specific upstream primers are a first upstream primer for detecting whether the 9th, 399th, 166th position on the second chromosome of barley is a T base and a second upstream primer for detecting whether the 9th, 399th, 166th position on the second chromosome of barley is a C base. The downstream primer can be used together with the first upstream primer or the second upstream primer to amplify the fragment containing the 9th, 399th, 166th position on the second chromosome of barley.

2. The molecular marker primer combination according to claim 1, characterized in that, The first upstream primer contains the nucleotide sequence shown in SEQ ID No. 1, the second upstream primer contains the nucleotide sequence shown in SEQ ID No. 2, and the downstream primer contains the nucleotide sequence shown in SEQ ID No.

3.

3. The molecular marker primer combination according to claim 2, characterized in that, The nucleotide sequence of the first upstream primer is shown in SEQ ID No. 1, the nucleotide sequence of the second upstream primer is shown in SEQ ID No. 2, and the nucleotide sequence of the downstream primer is shown in SEQ ID No.

3.

4. The molecular marker primer combination according to any one of claims 1 to 3, characterized in that, The first upstream primer and the second upstream primer have different fluorescent tag sequences attached to their 5' ends.

5. The molecular marker primer combination according to claim 4, characterized in that, The different fluorescent tag sequences are the FAM fluorescent tag sequence and the HEX fluorescent tag sequence, respectively.

6. A reagent kit, characterized in that, The kit comprises the molecular marker primer combination as described in any one of claims 1 to 5.

7. A method for screening the color of highland barley seeds, characterized in that, Includes the following steps: S1. Extract genomic DNA from the barley sample to be tested; S2. Using the genomic DNA obtained in step S1 as a template, perform PCR amplification using the molecular marker primer combination described in any one of claims 1 to 5 to obtain PCR products; S3. Genotyping the PCR products obtained in step S2: The genotype of the PCR product is T:T, T:C, or C:C; If the genotype of the PCR product is T:T, the barley seed is determined to be colored, and the colored type is blue, purple or black; If the PCR product genotype is C:C, it is determined to be colorless, and colorless is cyan.

8. The screening method according to claim 7, characterized in that, The PCR amplification reaction system includes KASP 2×PCR mix, barley genomic DNA to be tested, and the molecular marker primer combination as described in any one of claims 1 to 5.

9. The screening method according to claim 7 or 8, characterized in that, The PCR amplification reaction program was as follows: 95℃ for 15 min; 95℃ for 10 s, 65℃ for 60 s, 10 cycles, decreasing by 1℃ per cycle; 95℃ for 10 s, 57℃ for 60 s, 30 cycles; 30℃ for 30 s.

10. The use of the molecular marker primer combination according to any one of claims 1 to 5 in screening or assisting in screening barley seed color, in preparing a kit for screening barley seed color, or in assisting in the breeding of colored barley varieties.

Images