Gene associated with resistance to rhizome rot of radix morindae officinalis and application thereof

Abstract

The application belongs to the field of molecular breeding, and discloses a gene related to the resistance of Radix Morindae Officinalis stem base rot and application thereof. The inventors find that two SNP sites of Radix Morindae Officinalis Chr10:24,583,649 and Chr10:24,583,658 are highly related to the resistance of Radix Morindae Officinalis stem base rot through whole genome association analysis of the resistance of Radix Morindae Officinalis stem base rot, and the genotypes of the two SNP sites can be used to identify or assist in identifying the resistance of Radix Morindae Officinalis stem base rot. Compared with the traditional resistance evaluation method which depends on artificial inoculation and disease index scoring, the application can reduce the influence of environmental factors, cultivation sites, plant growth years and artificial scoring differences on the judgment of resistance, and is beneficial to improve the accuracy and efficiency of Radix Morindae Officinalis disease resistance germplasm screening. The method can be used for Radix Morindae Officinalis stem base rot resistance material screening, disease resistance parent selection, molecular marker assisted breeding and accurate evaluation of Radix Morindae Officinalis germplasm resources.

Description

Technical Field

[0001] This invention belongs to the field of molecular breeding, specifically relating to a gene related to resistance to stem rot in Morinda officinalis and its application. Background Technology

[0002] Morinda officinalis (a traditional Chinese medicine) Morinda officinalis Morinda officinalis (also known as Ji Chang Feng, Ba Ji, Ba Ji, Da Ba Ji, etc.) is the dried root of the plant Morinda officinalis, belonging to the Rubiaceae family. It is used to tonify kidney yang, strengthen tendons and bones, and dispel wind and dampness. Its flavor is sweet and pungent, and its nature is slightly warm; it enters the liver and kidney meridians. In traditional Chinese medicine, Morinda officinalis is mainly used to treat symptoms such as impotence, seminal emission, infertility due to cold uterus, irregular menstruation, lower abdominal pain due to cold, rheumatic pain, and weakness of tendons and bones. Morinda officinalis is mainly distributed in Guangdong, Guangxi, Hainan, and Fujian provinces in southern my country, with Zhaoqing and Yunfu in Guangdong being important producing areas. With a long history of medicinal use, Morinda officinalis is one of the "Four Great Southern Herbs" and one of the "Ten Great Guangdong Herbs," possessing high medicinal and industrial value.

[0003] With the continuous expansion of the artificial cultivation area of ​​Morinda officinalis, problems such as germplasm degradation, continuous cropping obstacles, and soil-borne diseases have become increasingly prominent. Among them, Fusarium oxysporum (… Fusarium oxysporum Stem base rot caused by _____ is one of the most serious diseases affecting Morinda officinalis production. This disease mainly damages the base of the stem and roots of the plant. After infection, symptoms such as root rot, browning of vascular bundles, wilting of leaves, weakened plant growth, and even death of the entire plant may occur, seriously affecting the yield and quality of Morinda officinalis.

[0004] Currently, the control of stem base rot in Morinda officinalis production mainly relies on field management, crop rotation, substrate disinfection, and chemical treatment. However, because Fusarium oxysporum can survive in the soil for a long time and Morinda officinalis has a long cultivation cycle, the disease is often difficult to completely control once it occurs. Long-term use of chemical agents may also lead to pesticide residues and environmental pollution. Therefore, screening and cultivating disease-resistant germplasm is the most economical, effective, and environmentally friendly way to control stem base rot in Morinda officinalis.

[0005] Morinda officinalis is a perennial medicinal plant. Traditional disease resistance evaluation mainly relies on observation of natural disease occurrence in the field or statistical analysis of disease index after artificial inoculation. These methods are time-consuming, labor-intensive, and easily affected by environmental conditions, pathogen infection pressure, plant age, cultivation location, and human scoring errors. Especially in seedling stage or large-scale germplasm resource screening, relying solely on phenotypic identification is insufficient to meet the demands for rapid, accurate, and high-throughput screening.

[0006] With the development of plant genomics and molecular marker technology, SNP molecular markers have been widely used in plant germplasm resource identification, disease resistance gene localization, and marker-assisted breeding due to their wide distribution, genetic stability, suitability for high-throughput detection and automated typing. Genome-wide association study (GWAS) can utilize linkage disequilibrium relationships in natural populations to statistically associate whole-genome SNP markers with target phenotypes, thereby locating candidate loci and candidate genes controlling complex traits.

[0007] Currently, there is a lack of stable SNP molecular markers for identifying resistance to stem rot in Morinda officinalis, as well as practical detection methods for screening resistant parents, evaluating resistant germplasm resources, and using molecular marker-assisted breeding. Therefore, it is necessary to develop an SNP molecular marker that is significantly associated with resistance to stem rot in Morinda officinalis and to establish corresponding detection methods and application schemes. Summary of the Invention

[0008] The purpose of this invention is to overcome at least one deficiency of the prior art and to provide a gene related to resistance to stem rot of Morinda officinalis and its application.

[0009] The technical solution adopted in this invention is: A first aspect of the invention provides: a SNP molecular marker associated with resistance to stem rot in Morinda officinalis, said SNP molecular marker being selected from at least one of the following two SNP loci located on chromosome 10 of the Morinda officinalis reference genome: The first SNP site is located at Chr10:24,583,649, and the polymorphic base at this site is either T or A; The second SNP site is located at Chr10:24,583,658, and the polymorphic base at this site is either T or C.

[0010] In some instances, the stem rot of Morinda officinalis is caused by Fusarium oxysporum (… Fusarium oxysporum )cause.

[0011] A second aspect of the present invention provides: a method for identifying resistance to stem base rot in Morinda officinalis, comprising the following steps: Take samples of Morinda officinalis and extract its genomic DNA; The genotype of the SNP molecular marker described in the first aspect of the present invention in the genomic DNA was determined by detection; Based on the genotype, resistance to stem rot of Morinda officinalis was determined.

[0012] In some instances, resistance to stem rot in Morinda officinalis was determined based on the combined genotype of two SNP molecular markers, where: The combined genotype TT_TT corresponds to resistance to stem base rot in Morinda officinalis. The combined genotype AA_CC or the combined genotype TA_TC corresponds to low resistance to stem rot in Morinda officinalis.

[0013] In some instances, the Morinda officinalis sample is selected from at least one of Morinda officinalis leaves, stems, roots, callus tissue, and seedlings.

[0014] A third aspect of the invention provides the use of primer pairs or gene probes that specifically amplify or recognize the SNP molecular markers described in the first aspect of the invention in the preparation of a reagent for identifying resistance to stem rot in Morinda officinalis.

[0015] In some instances, the primer pairs include allele-specific primers for detecting the T and A alleles at Chr10:24,583,649 loci, and allele-specific primers for detecting the T and C alleles at Chr10:24,583,658 loci.

[0016] In some instances, the primer pair is any one of the following: KASP typing primer set, PARMS typing primer set, CAPS / dCAPS typing primer set, ARMS-PCR typing primer set, Sanger sequencing amplification primer set, high-throughput sequencing amplification primer set, or mass spectrometry typing primer set.

[0017] In some instances, the nucleotide sequences of the primer pairs are: forward primer: ATTGAACTTCATTTTAGACGAT (SEQ ID NO.1); reverse primer: TTACTAGAATACACTTCAATCACAT (SEQ ID NO.2).

[0018] A fourth aspect of the present invention provides: a method for breeding Morinda officinalis plants resistant to stem base rot, comprising: Detecting the combined genotype of the SNP molecular markers described in the first aspect of this invention in the genome of Morinda officinalis samples; The Morinda officinalis sample with the combined genotype TT_TT was selected as the parent for breeding Morinda officinalis with stem base rot resistance.

[0019] The beneficial effects of this invention are: Through genome-wide association analysis of resistance to stem base rot in Morinda officinalis, the inventors discovered for the first time that two SNP loci, Chr10:24,583,649 and Chr10:24,583,658, are highly correlated with resistance to stem base rot in Morinda officinalis. By detecting the genotype of these two SNP loci, they can be well used to identify or assist in the identification of resistance to stem base rot in Morinda officinalis.

[0020] The combined genotype constructed based on these two SNP loci was significantly correlated with the disease index of *Morinda officinalis* stem base rot, with the average disease index of the TT_TT genotype material being significantly lower than that of the AA_CC and TA_TC genotype materials. Therefore, this invention can identify or assist in the identification of *Morinda officinalis* stem base rot resistance at the DNA level, offering advantages such as short detection cycle, stable results, simple operation, and suitability for seedling screening and large-scale germplasm resource evaluation. Compared with traditional resistance evaluation methods relying on artificial inoculation and disease index scoring, this invention can reduce the influence of environmental factors, cultivation location, plant age, and differences in human scoring on resistance assessment, thus improving the accuracy and efficiency of *Morinda officinalis* disease-resistant germplasm screening. This method can be used for screening *Morinda officinalis* stem base rot resistant materials, selecting resistant parents, molecular marker-assisted breeding, and precise evaluation of *Morinda officinalis* germplasm resources. Attached Figure Description

[0021] Figure 1 This section shows the overall distribution of SNP variations and DG candidate sites across the entire genome of *Morinda officinalis*. From the outside in, it sequentially displays the 11 chromosomes, GWAS signals for DG, SNP density, FST, log2 (Pi ratio), DeltaTajima's D, and candidate site distribution between the large-leaf and small-leaf populations. Red diamonds represent core candidate sites, and orange dots represent secondary candidate sites. Dashed lines represent GWAS threshold lines at different levels.

[0022] Figure 2 This is a Manhattan plot of genome-wide association analysis of resistance to stem rot in Morinda officinalis.

[0023] Figure 3 This is a distribution map of GWAS candidate sites for resistance to stem rot in Morinda officinalis.

[0024] Figure 4 This is a local correlation signal diagram of the candidate segment Chr10:24.58 Mb.

[0025] Figure 5 This is a linkage disequilibrium analysis diagram of two SNP sites, Chr10:24,583,649 and Chr10:24,583,658.

[0026] Figure 6 This is a graph showing the relationship between the combined genotypes of two SNP loci, Chr10:24,583,649 and Chr10:24,583,658, and the disease index.

[0027] Figure 7 This is a diagram illustrating the structure and function of candidate genes adjacent to the Chr10:24.58 Mb candidate region.

[0028] Figure 8 This is a diagram showing the expression patterns of candidate genes before and after Fusarium oxysporum infection. Detailed Implementation

[0029] The technical solution of the present invention will be further illustrated below with examples. Example 1: Construction of natural populations of Morinda officinalis and identification of stem base rot resistance phenotype

[0030] This embodiment uses 226 *Morinda officinalis* materials identified through molecular identification and phenotypic survey as research subjects. The materials were sourced from the traditional *Morinda officinalis* producing areas of Guangdong Province, including different sampling locations such as Zhaoqing and Yunfu. Each material underwent uniform cultivation and management after transplanting to minimize the impact of environmental differences on disease resistance evaluation.

[0031] The tested pathogen was *Fusarium oxysporum*, isolated from the diseased roots of *Morinda officinalis* infected with stem base rot. Fusarium oxysporum MOF-1.

[0032] After activating and culturing Fusarium oxysporum MOF-1, a spore suspension was prepared. Morinda officinalis plants with uniform growth were selected for artificial inoculation using a combination of needle pricking and root drenching, or equivalent artificial inoculation methods. After inoculation, suitable humidity and temperature conditions were maintained to promote pathogen infection.

[0033] After inoculation, the disease incidence of the plants was observed. The disease severity was graded based on indicators such as the degree of rot in the roots and stem base of Morinda officinalis, the degree of wilting, and the degree of growth inhibition. The disease index or disease grade-related phenotypic value (DG) was calculated. The higher the DG value, the higher the susceptibility of the material; the lower the DG value, the stronger the disease resistance of the material.

[0034] Based on whole-genome SNP data from 226 Morinda officinalis accessions, this study obtained a total of 5,950,342 high-quality variant sites, covering 11 chromosomes. Figure 1 The number of SNPs varies across chromosomes. Chr1, Chr2, and Chr4 have relatively high numbers of SNPs, at 642,860, 610,854, and 635,399 respectively; while Chr7 and Chr10 have relatively low numbers of SNPs, at 444,126 and 458,327 respectively. Overall, SNP variations are distributed across all 11 chromosomes, providing a basis for genome-wide association analysis of disease index (DG).

[0035] The DG values ​​of 226 Morinda officinalis materials showed continuous variation, indicating that the resistance to stem rot in Morinda officinalis is a complex quantitative trait, which is suitable for genome-wide association analysis. Example 2: Extraction, resequencing, and SNP detection of Morinda officinalis genomic DNA

[0036] Healthy young leaves were collected from each sample of Morinda officinalis material, and genomic DNA was extracted using plant genomic DNA extraction methods.

[0037] In some cases, approximately 100 mg of leaf powder ground in liquid nitrogen was added to preheated CTAB lysis buffer and lysed in a 65°C water bath. After extraction with chloroform-isoamyl alcohol, DNA was precipitated with isopropanol. After washing with 70% ethanol, the DNA was dissolved in TE buffer or sterile water, and RNase A was added to remove RNA. The purity of the extracted DNA was determined by Nanodrop, and its integrity was assessed by agarose gel electrophoresis.

[0038] DNA samples that passed quality inspection were used to construct paired-end sequencing libraries, and whole-genome resequencing was performed using the Illumina high-throughput sequencing platform to obtain raw sequencing data.

[0039] Fastp software was used to perform quality control on the raw sequencing data to obtain high-quality Clean Reads. The Clean Reads were aligned to the Morinda officinalis reference genome using bwa software in mem mode, and the alignment results were sorted and filtered using samtools software.

[0040] SNP and InDel detection were performed using deepvariant software, and genotype, base sequencing quality, and read alignment quality were verified using samtools mpileup and scripts.

[0041] To obtain a high-quality SNP dataset, the following filtering is performed: Screening for non-biallelic loci; Sites with a minimum allele frequency (MAF) < 0.05 were screened out; Sites with a deletion rate >20% were removed.

[0042] After the above filtering, a high-quality SNP dataset covering the entire genome of Morinda officinalis was obtained for subsequent population genetics analysis and GWAS analysis. Example 3: GWAS analysis of resistance to stem base rot in Morinda officinalis

[0043] Based on a high-quality SNP dataset, principal component analysis, population structure analysis, and phylogenetic assessment were performed on 226 Morinda officinalis samples to control for the influence of natural population genetic background on association analysis.

[0044] Using stem basal rot disease DG as the phenotypic value and high-quality SNP loci as genotypic data, genome-wide association analysis was conducted using the GAPIT platform.

[0045] In some instances, multiple models such as GLM, MLM, CMLM, MMLM, SUPER, FarmCPU, and BLINK can be used for analysis, and the results of different models can be comprehensively compared to improve the reliability of candidate site screening. The results are then displayed using a Manhattan plot. Figure 2 ).

[0046] A multi-level significance thresholding system was used to screen candidate associated loci, including the nominal suggestive threshold, the effective suggestive threshold, the LD-corrected threshold, and the full Bonferroni threshold. Candidate loci that appeared repeatedly across models, had strong statistical support, and were biologically significant were given priority for retention.

[0047] GWAS results showed that resistance to stem rot in Morinda officinalis is a complex quantitative trait controlled by multiple loci, with candidate association signals distributed across multiple chromosomes. Figure 3 Among them, Chr10:24,583,649 loci showed the highest statistical support, P=9.29E-9, -log10(P)=8.03, exceeding the LD-corrected threshold and approaching the full Bonferroni threshold. Figure 4 ).

[0048] Neighboring sites Chr10:24,583,658 also showed strong association signals. Local LD ​​analysis showed that Chr10:24,583,649 was highly linked to Chr10:24,583,658 (r² = 0.957), indicating that the main association signal in this region could converge to a local genetic unit composed of two high-LD SNPs. Figure 5 and Figure 6 ).

[0049] The sequences of wild-type Chr10:24583250-24583950 are as follows: TATTTACTTGTTCACACAGAGTCTTTATCTAAATATATTTACATGCTCACACAGAGTCTTT ATTGAAC TTCATTTTAGACGATTAAATCATATATTTTGAAAATTAATCGTTTCAAGTTTATAATTTATAACAATAAGTTTTATTGTAAAAGTAAAATTTATAATAATTTTAGGTTAAATTTCATTGTATAATTAAAACTTATTAATTTAAATATTGAAAATCTCTCCATTGTCAAAACAA CAACATTAAATTCCTTTCTTAGTTCTTAAGTTTTGTATAGCCAATTAATTATCTAAGTATAAACAAAAATTACAATTAAAAAACTCAAAATGTCTTAATTTATTTAGATTTTCACAAGAAGGTTCAATCTCAATTTCTTTTTTAGATTTTCACTTTTA A TATTTAGT C TTTTGCTTTATACACATAAGTGTGCTATTTTGAATTAGATATTTGATATTTTAATTAAAAAGTTGGTGAAATTACATCATGGGTTACAGTTTTGTAATTAACTTTTTGCTTTT AT GTGATTGAAGTGTATTCTAGTAA TTAAGATTATTTTTTTTATATATTGGTATGAGAATCTAATTATATTGATTTTTTCCCTCAAAAGGTTTTACTAATTTTTTTATTTAATACAATTTCATTTAACAAGTTAGTGGTACATAAACTATTTTGGGTTCTATTGTAAATTTAGTTATTA (SEQ ID NO.3), wherein the bolded and underlined portion is the SNP site of the present invention. Example 4: Relationship between combined Chr10:24,583,649 and Chr10:24,583,658 genotypes and disease index

[0050] Based on the genotypes of the two SNP loci Chr10:24,583,649 and Chr10:24,583,658, 226 Morinda officinalis materials were divided into three main combined genotypes: TT_TT, AA_CC, and TA_TC. Figure 7 ).

[0051] Among them, there were 142 TT_TT combined genotype materials, 67 AA_CC combined genotype materials, and 15 TA_TC combined genotype materials.

[0052] The statistical results are as follows: TT_TT 142 4.39 Lower disease index or stronger disease resistance AA_CC 67 6.40 Higher disease index or higher risk of infection TA_TC 15 6.67 Higher disease index or higher risk of infection Since a higher DG value indicates a higher degree of susceptibility, the TT_TT genotype corresponds to a lower disease index or a stronger tendency to resist disease, while the AA_CC and TA_TC genotypes correspond to a higher disease index or a higher risk of disease.

[0053] Further analysis using the Kruskal-Wallis test revealed significant differences in DG among the three combined genotypes (P = 2.81E-14). Pairwise comparisons showed significant differences between AA_CC and TT_TT, and between TA_TC and TT_TT, but no significant difference between AA_CC and TA_TC.

[0054] To exclude the influence of leaf type, age, and sampling origin on the association results, Leaf Type, Age, and County were included as covariates in the model. The results showed that the Chr10 co-genotype effect remained significant after adding covariates. Compared to the TT_TT co-genotype, the AA_CC co-genotype effect value was β=1.347, P=7.50E-5; the TA_TC co-genotype effect value was β=1.563, P=0.00453. These results indicate that the relationship between the Chr10 co-genotype and stem rot disease (DG) in Morinda officinalis is not entirely explained by differences in leaf type, age, or origin, demonstrating good stability and application value. Example 5: Candidate Gene and Regulatory Region Analysis

[0055] The SNP loci Chr10:24,583,649 and Chr10:24,583,658 are located in or near the regions associated with G. officinalis_021719 and G. officinalis_021718. This region may involve pseudogene regions, intergene regulatory regions, or adjacent gene regulatory regions. Figure 8 ).

[0056] Further analysis revealed that this candidate region may be enriched with DOF-type transcription factor binding sites. Allelic variations at Chr10:24,583,658 may alter the number or binding strength of DOF-type transcription factor binding sites, thereby affecting the expression of neighboring genes or the activity of non-coding regulatory elements. Since plant disease resistance responses are often closely related to transcriptional regulation, cell wall reinforcement, signal transduction, and the expression of defense genes, this region may participate in the formation of resistance to Morinda officinalis stem rot by regulating neighboring disease resistance-related genes or non-coding RNAs.

[0057] In some instances, transcriptome data, qRT-PCR validation, candidate gene expression pattern analysis, and sequence variation analysis can be further combined to perform functional validation of the candidate region. Example 6: Detection method of SNP molecular markers

[0058] The SNP molecular markers described in this invention can be detected using methods such as KASP, PARMS, CAPS / dCAPS, ARMS-PCR, Sanger sequencing, high-throughput sequencing, gene chips, or mass spectrometry genotyping. The following explanation uses the KASP detection method as an example.

[0059] (a) Sample processing Approximately 100 mg of fresh young leaves of Morinda officinalis to be tested were cut, placed in a clean centrifuge tube, and rapidly ground into a fine powder with liquid nitrogen for genomic DNA extraction.

[0060] (ii) DNA extraction Genomic DNA was extracted from Morinda officinalis using a plant genomic DNA extraction method. After extraction, the concentration and purity of the DNA were determined using Nanodrop; samples with an A260 / A280 ratio of 1.8–2.0 were suitable for subsequent analysis. DNA integrity was assessed using agarose gel electrophoresis.

[0061] (III) SNP site detection The T and A alleles were detected at the Chr10:24,583,649 locus, and the T and C alleles were detected at the Chr10:24,583,658 locus.

[0062] In KASP assays, two different fluorescence signals can be used to distinguish different alleles at the same SNP locus. After the reaction, fluorescence signal readings and genotype clustering analysis are performed.

[0063] Primer sequence design must ensure specificity to accurately amplify the target fragment. The specific primers used in this invention are as follows: Forward primer: 5' ATTGAACTTCATTTTAGACGAT 3' Reverse primer: 5' TTACTAGAATACACTTCAATCACAT 3'.

[0064] In the PCR reaction system, specific primers and probes are added, and the target DNA region is amplified through thermal cycling. After fluorescence signal acquisition, clustering results are analyzed using specialized software to clearly distinguish between homozygous and heterozygous genotypes. For the Chr10:24,583,649 locus, the distribution of T / A alleles directly reflects the genetic characteristics of the sample; similarly, the detection of T / C alleles at the Chr10:24,583,658 locus follows the same logic. The final data must be interpreted in conjunction with the population genetics context to ensure the scientific validity and reliability of the results.

[0065] (iv) KASP reaction system In some instances, the KASP reaction system is as follows: 2×KASP Master Mix 2.5 Genotyping test mixture 0.07～0.14 DNA template 1.0 <![CDATA[ddH2O]]> Upgraded to 5.0 Total 5.0 The preferred concentration of the DNA template is 20–100 ng / μL.

[0066] (v) KASP Reaction Procedure In some instances, the KASP reaction procedure is as follows: Pre-denaturation at 94℃ for 15 min; Denaturation at 94℃ for 20 s, annealing / extending at 61-65℃ for 60 s, decreasing by 0.6-0.8℃ per cycle, for 10 cycles; Denaturation at 94℃ for 20 s, annealing / extending at 55-57℃ for 60 s, 26-35 cycles; After the reaction was completed, fluorescence signal reading and genotype cluster analysis were performed.

[0067] (vi) Result determination After detecting the genotypes at Chr10:24,583,649 and Chr10:24,583,658 loci, the results from the two loci were combined to form a combined genotype.

[0068] If the combined genotype is TT_TT, then the Morinda officinalis material to be tested is determined or assisted in determining that it is a material with a low disease index of stem base rot or a strong disease resistance tendency. If the combined genotype is AA_CC or TA_TC, then the Morinda officinalis material to be tested is determined or further determined to be a material with a high disease index or high risk of stem base rot. Example 7: Application of SNP molecular markers in screening disease-resistant germplasm of Morinda officinalis

[0069] Fresh leaves were collected from the Morinda officinalis germplasm resources to be screened, genomic DNA was extracted, and the genotypes of two SNP loci, Chr10:24,583,649 and Chr10:24,583,658, were detected using the method described in Example 6.

[0070] Materials with the TT_TT combined genotype will be prioritized for retention as germplasm resources for stem rot resistance in Morinda officinalis or as parents for disease-resistant breeding. Materials with the AA_CC or TA_TC combined genotypes will be marked as materials with a higher risk of disease. In disease-resistant breeding, their priority as parents can be reduced, or further verification can be performed by combining artificial inoculation with disease index.

[0071] This method allows for the pre-screening of Morinda officinalis materials for disease resistance during the seedling stage or in a disease-free environment, reducing the number of samples required for subsequent artificial inoculation and identification, and improving the efficiency of screening disease-resistant germplasm resources of Morinda officinalis. Example 8: Application of SNP molecular markers in marker-assisted breeding of Morinda officinalis

[0072] In the disease resistance breeding process of Morinda officinalis, materials with excellent agronomic traits, medicinal quality, and disease resistance were selected as parents. The parents and their offspring populations were tested for two SNP loci, Chr10:24,583,649 and Chr10:24,583,658. Individual plants with the combined genotype TT_TT were preferentially selected for subsequent propagation and field evaluation.

[0073] At the same time, comprehensive selection can be carried out by combining indicators such as root traits, oligosaccharide content, yield, leaf type, growth period and field disease resistance performance of Morinda officinalis, thereby improving the efficiency of disease-resistant germplasm selection for Morinda officinalis.

[0074] The above is a further detailed description of the present invention and should not be considered as a limitation on the specific implementation of the present invention. For those skilled in the art, simple deductions or substitutions without departing from the concept of the present invention are all within the protection scope of the present invention.

Claims

1. A SNP molecular marker associated with resistance to stem rot in Morinda officinalis, characterized in that, The SNP molecular markers are selected from at least one of the following two SNP loci located on chromosome 10 of the Morinda officinalis reference genome: The first SNP site is located at Chr10:24,583,649, and the polymorphic base at this site is either T or A; The second SNP site is located at Chr10:24,583,658, and the polymorphic base at this site is either T or C.

2. The SNP molecular marker according to claim 1, characterized in that, The stem base rot of Morinda officinalis is caused by Fusarium oxysporum (… Fusarium oxysporum )cause.

3. A method for identifying resistance to stem base rot in Morinda officinalis, comprising the following steps: Take samples of Morinda officinalis and extract its genomic DNA; The genotype of the SNP molecular marker of claim 1 in the genomic DNA was determined by detection; Based on the genotype, resistance to stem rot of Morinda officinalis was determined.

4. The method according to claim 3, characterized in that, Resistance to stem rot in Morinda officinalis was determined based on the combined genotype of two SNP molecular markers, including: The combined genotype TT_TT corresponds to resistance to stem base rot in Morinda officinalis. The combined genotype AA_CC or the combined genotype TA_TC corresponds to low resistance to stem rot in Morinda officinalis.

5. The method according to claim 3 or 4, characterized in that, The Morinda officinalis samples were selected from at least one of Morinda officinalis leaves, stems, roots, callus tissue, and seedlings.

6. Application of primer pairs or gene probes for specific amplification or recognition of the SNP molecular markers described in claim 1 in the preparation of a reagent for identifying resistance to stem rot in Morinda officinalis.

7. The application according to claim 6, characterized in that, The primer pair includes allele-specific primers for detecting the T and A alleles at the Chr10:24,583,649 locus, and allele-specific primers for detecting the T and C alleles at the Chr10:24,583,658 locus.

8. The application according to claim 6 or 7, characterized in that, The primer pair is any one of the following: KASP typing primer set, PARMS typing primer set, CAPS / dCAPS typing primer set, ARMS-PCR typing primer set, Sanger sequencing amplification primer set, high-throughput sequencing amplification primer set, or mass spectrometry typing primer set.

9. The application according to claim 6, characterized in that, The nucleotide sequences of the primer pairs are as follows: forward primer: ATTGAACTTCATTTTAGACGAT; reverse primer: TTACTAGAATACACTTCAATCACAT.

10. A method for breeding Morinda officinalis plants resistant to stem base rot, characterized in that, include: Detecting the combined genotype of the SNP molecular markers described in claim 1 in the genome of Morinda officinalis samples; The Morinda officinalis sample with the combined genotype TT_TT was selected as the parent for breeding Morinda officinalis with stem base rot resistance.

Images