Method for identifying original material of moutan cortex and application thereof

Abstract

The present application relates to the technical field of Chinese medicinal material molecular identification, and particularly relates to a method for identifying the original of Lycianthes racemosa medicinal material and application thereof ycf1 Application of gene fragment as DNA barcode in identification of plants of Kadsura genus. In view of the identification difficulty of plants of Kadsura genus due to similar morphology and fuzzy classification boundary, the present application first screens and verifies a chloroplast gene fragment ycf1 as a specific DNA barcode. The present application realizes efficient and accurate differentiation of Kadsura peltata and other easily confused species of Kadsura genus in the genuine original of Lycianthes racemosa, which is significantly superior to traditional morphological and conventional medicinal material identification methods.

Description

Technical Field

[0001] This invention relates to the field of molecular identification technology of Chinese medicinal materials, and in particular to a method for identifying the origin of the medicinal material *Spatholobus suberectus* and its application. Background Technology

[0002] Kadurae Caulis is a plant belonging to the Magnoliaceae family, specifically the schisandra chinensis. Kadsura Carburetor The dried stems of *Spatholobus suberectus* are a unique and authentic medicinal herb, listed in the *Pharmacopoeia of the People's Republic of China* (2025 edition). It is warm in nature and has a bitter-sweet taste, possessing the effects of promoting blood circulation, nourishing blood, regulating menstruation, relieving pain, and relaxing muscles and tendons. Clinically, it is widely used to treat menstrual disorders, dysmenorrhea, numbness and paralysis, rheumatic pain, and weakness of qi and blood. In recent years, with the continuous deepening of modern pharmacological research, the pharmacological activities of *Spatholobus suberectus* in antiplatelet aggregation, improving blood circulation, anti-inflammatory analgesia, and immunomodulation have been gradually revealed. Its application value in gynecological diseases, bone and joint diseases, and ischemic cardiovascular and cerebrovascular diseases is becoming increasingly prominent, and market demand is rising year by year.

[0003] However, due to the long-term reliance on wild resources for the medicinal herb *Schisandra chinensis*, coupled with its long growth cycle and slow natural regeneration, over-harvesting has led to the depletion of wild *Schisandra chinensis* resources, exacerbating the supply-demand imbalance. Against this backdrop, the medicinal herb market has seen a proliferation of products using the stems of closely related plants in the *Schisandra* genus as substitutes or adulterants for *Schisandra chinensis*. According to literature reports and market surveys, *Schisandra chinensis* var. *chinensis*... Kadsura heteroclita Schisandra chinensis var. angustifolia Kadsura angustifolia , Schisandra chinensis Kadsura longipedunculata , Maonan Schisandra chinensis Kadsura induta Cold Rice Vine Kadsura oblongifolia Schisandra chinensis from Central and Southern Thailand Kadsura ananosma and Black Tiger Kadsura coccinea The stems of several other plants in the same genus have been found mixed into the circulation of Yunnan chicken blood vine medicinal materials. The above-mentioned adulterants are highly similar to Schisandra chinensis in terms of plant morphology (such as the shape of the stem, cross-sectional characteristics, color, and odor) and medicinal properties. The morphological boundaries between species are blurred, making it difficult to effectively distinguish them using traditional local experience and morphological identification methods.

[0004] Even more serious is the fact that the genus *Schisandra* itself is a taxonomically challenging group to identify, with extensive morphological transitions and overlapping characteristics among species within the genus. Traditional methods of medicinal material identification, such as morphological, microscopic, and physicochemical identification, are not only inaccurate and subjective, but also fail to achieve precise species-level differentiation, and are ineffective for the identification of processed or powdered medicinal samples. This chaotic situation not only severely disrupts the normal order of the *Schisandra chinensis* market, providing opportunities for unscrupulous merchants to sell inferior or counterfeit products, but also directly threatens the clinical safety and efficacy stability of *Schisandra chinensis*. Furthermore, it seriously restricts the development of innovative drugs using *Schisandra chinensis* as a raw material and the scientific improvement of the quality standards of authentic medicinal materials. Therefore, there is an urgent need to establish a molecular identification method that can accurately, rapidly, and specifically distinguish *Schisandra chinensis* from closely related products within the genus of *Schisandra chinensis*, providing reliable technical support for the identification of authenticity, quality monitoring, and sustainable utilization of *Schisandra chinensis*. Summary of the Invention

[0005] The purpose of this invention is to provide a method for identifying the medicinal material of *Spatholobus suberectus* and its application.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides ycf - 4 Application of gene fragments as DNA barcodes in the identification of species of the genus Schisandra.

[0007] Preferably, the species of the Schisandra genus include Schisandra insularis, Schisandra heteromorpha, Schisandra angustifolia, Schisandra chinensis, Schisandra pubescens, Schisandra chinensis ... and Schisandra chinensis.

[0008] Preferably, the ycf1 The sequence numbers of the gene fragments are PZ572531, PZ572532, PZ572533, PZ572534, PZ572535, PZ572541, PZ572542, PZ572543, PZ572536, PZ572537, PZ572538, PZ572539, PZ572540, PZ572529, PZ572530, PZ572526, and PZ5725. 27. One of PZ572528, PZ572521, PZ572522, PZ572523, PZ572524, PZ572525, PZ572547, PZ572548, PZ572544, PZ572545, PZ572546, PZ572520, PZ572518, PZ572515, PZ572516, PZ572517, and PZ572519.

[0009] Preferably, the ycf1 Gene fragments are used to distinguish the genuine *Schisandra chinensis* from *Schisandra chinensis* and its closely related species.

[0010] This invention provides a method for identifying the medicinal material of *Spatholobus suberectus*, comprising the following steps: detecting the presence of... ycf1 The sequence of the gene fragment will be used to test the sample. ycf1 Gene fragment sequences and plants of the genus Schisandra. ycf1 The gene reference sequence is compared. If the sequence to be tested matches that of Schisandra chinensis, the sequence will be determined by comparison. ycf1 If the sequence clusters into one branch, the sample to be tested is identified as genuine Yunnan chicken blood vine.

[0011] Preferably, the sample to be tested contains ycf1 The method for processing gene fragments includes the following steps: (1) Extract DNA from the sample to be tested; (2) Using the extracted DNA as a template, amplification was performed. ycf1 PCR amplification of gene fragments using primer pairs; (3) Sequencing the PCR amplification products yielded... ycf1 The sequence of a gene fragment.

[0012] Preferably, the amplification ycf1 The primer pairs for the gene fragments are shown in SEQ ID NO: 1 and 2.

[0013] This invention provides a PCR detection kit for identifying the original medicinal material of *Spatholobus suberectus*, comprising the aforementioned primer pair.

[0014] Preferably, it also contains DNA polymerase, dNTPs, and PCR buffer.

[0015] This invention provides ycf1 Application of gene fragments in the preparation of kits for identifying species of the genus Schisandra.

[0016] Preferably, the kit is used to distinguish between *Schisandra chinensis*, the original source of *Schisandra chinensis*, and closely related species of the same genus.

[0017] Compared with the prior art, the present invention has the following beneficial effects: First, addressing the challenge of identifying species in the genus Schisandra with similar morphology and blurred taxonomic boundaries, this invention is the first to screen and verify chloroplast gene fragments. ycf1As a specific DNA barcode, this invention achieves efficient and accurate differentiation between the authentic *Schisandra chinensis* (Yunnan chicken blood vine) and its closely related, easily confused species, significantly superior to traditional morphological and conventional medicinal material identification methods. Experimental Example 1 shows that this fragment (728 bp in length) in a phylogenetic analysis covering 8 species and 35 samples can cluster all *Schisandra chinensis* individuals into one lineage and completely distinguish them from 7 other common confused species, achieving a 100% identification resolution. In comparison, the concurrent comparison... petN-psbM, ndhF-rpl32, ndhF Other candidate fragments can only distinguish a few species, resulting in extremely low identification efficiency. This comparative result strongly proves... ycf1 The specificity and superiority of the fragment for identifying the original form of *Spatholobus suberectus* provide a reliable molecular marker for determining the authenticity of medicinal materials.

[0018] Secondly, the method of this invention is simple to operate, has good reproducibility, and a high sequencing success rate, possessing good practicality and promotional value. The selected... ycf1 The short sequence fragment (728 bp) and high primer amplification efficiency ensured 100% success rates for both PCR and bidirectional sequencing, guaranteeing the integrity and accuracy of the sequence data. The method clearly defines the complete process and key parameters for DNA extraction, PCR amplification, sequence assembly, and phylogenetic tree construction, ensuring the stability and reproducibility of the identification results. Furthermore, this invention is applicable to medicinal material samples from various sources (including dried vine stems and fresh leaves), unaffected by sample morphology or processing status, meeting the practical needs for rapid, batch identification in the medicinal material market and providing a convenient and reliable technical means for quality monitoring of *Spatholobus suberectus* (Yunnanese chicken blood vine) medicinal materials.

[0019] Third, this invention has significant practical implications for ensuring the safety of clinical use of *Spatholobus suberectus* (Yunnan chicken blood vine), regulating market order, and promoting the resource protection and sustainable utilization of this unique medicinal material. Due to the increasing scarcity of wild resources, the market is rife with counterfeit products, seriously threatening clinical efficacy and patient safety. This method can accurately distinguish genuine from counterfeit products at the molecular level, eliminating efficacy deviations and safety hazards caused by errors in the original source, and strongly supporting the pharmacopoeia's strict adherence to the original source of *Spatholobus suberectus*. Simultaneously, this technology provides solid technical support for the investigation of germplasm resources of *Spatholobus suberectus*, the selection of superior varieties, standardized cultivation, and the research and development of related medicines and health products, helping to promote the standardized and scientific development of this authentic medicinal material industry and achieve a balance between resource protection and rational utilization. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0021] Picture 1 For based on ycf1 Fragment-based system evolutionary tree.

[0022] Picture 2 for petN-psbM Phylogenetic trees are constructed from fragment sequences.

[0023] Picture 3 for ndhF-rpl32 Phylogenetic trees are constructed from fragment sequences.

[0024] Picture 4 for ndhF Phylogenetic trees are constructed from fragment sequences. Detailed Implementation

[0025] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0026] Table 1 shows the gene fragments and their NCBI sequence numbers of the Schisandra spp. samples analyzed.

[0027] Example 1

[0028] 1. DNA extraction

[0029] Approximately 1 g of *Spatholobus suberectus* (Yunnanese chicken blood vine) was taken as a sample for testing. After thorough grinding with liquid nitrogen, DNA was extracted using a DNA extraction kit from Tiangen Biotech Co., Ltd. Following the extraction, the extracted DNA was quality-tested using 1% agarose gel electrophoresis. After quality testing, the remaining DNA sample was stored at 4°C for further experiments.

[0030] 2. PCR amplification and product sequencing

[0031] Gene fragment amplification: The following primers were synthesized by the biotechnology company: (forward primer: GCTTTAGGACTCGGCAATAAATC (as shown in SEQ ID NO: 1); reverse primer: CCAGAATCGCAGAAACCCATT (as shown in SEQ ID NO: 2)). The gene fragment was amplified using rTaq DNA polymerase (model: DR001B) from Dalian Baosheng Biotechnology Co., Ltd. The PCR reaction system in Table 2 was used to prepare the PCR solution. The PCR amplification program was as follows: 94°C 3 min; [35 cycles: 94°C 60 s; 57°C 30 s; 72°C 80 s]; 72°C 10 min.

[0032] Table 2 PCR amplification reaction system

[0033] PCR amplification products were detected by 1.5% agarose gel electrophoresis at 110 V for 30 min. After SYBR Green I staining, the gel was observed and photographed using a gel imaging system. Once the PCR amplification products met the quality requirements after electrophoresis, they were sent to Sangon Biotech (Shanghai) Co., Ltd. for purification and bidirectional sequencing.

[0034] 3. Data Analysis

[0035] After obtaining the sequencing results, the sequencing peak diagram returned by the sequencing company was first proofread using the sequence assembly software CodonCodeAligner V 2.06 (CodonCode Co., USA) to remove low-quality sequences and primer regions. The specific method is as follows: using 20 bp The base windows are slid from the 5' end and 3' end of the sequence, respectively. If there are more than 2 bases with a Q value ≤ 20 in the window, one base is deleted and the sliding continues until the number of bases with a Q value ≤ 20 in the window is less than or equal to 2, at which point the window stops sliding. Then, the contig software is used to assemble the sequences and Bioedit V 7.2.5 is used for multiple sequence alignment and error checking to obtain the final sequence as the sequence to be identified.

[0036] 4. Origin Identification

[0037] Download the Schisandra genus from the NCBI website ( Kadsura )plant" ycf1 "Using the gene fragment as a reference sequence, the sequence to be identified obtained in Method 3 and the downloaded sequence were used in MEGA software. The NJ method was employed to construct a phylogenetic tree between the sequence to be identified and the reference sequence. The relevant parameters were set as follows:" Test of phylogeny: Bootstrap method; Number of Bootstrap Replications : 1000; Substitutions Type: Nucleotide; Model / Method: p-distance; Substitutions to Include:d:Transitions+Transversions; Gaps / Missing Data Treatment: Complete deletion.

[0038] For example, in the phylogenetic tree, the sequence to be identified is similar to Schisandra chinensis. Kadsura Carburetor of ycf1 If the sequences cluster together, it indicates that the sample being identified is the genuine *Spatholobus suberectus*. However, if the sequence to be identified clusters with those of other species... ycf1 If the genes cluster together, it indicates that the sample being identified is a counterfeit.

[0039] Experimental Example 1

[0040] Verification ycf1 The effectiveness of gene fragments as DNA barcodes in distinguishing genuine *Schisandra chinensis* from its genus *Schisandra chinensis* and its closely related, easily confused species.

[0041] method: Collect the Schisandra genus shown in Table 3 ( Kadsura Thirty-five fresh young leaf samples from different ancestral plants, belonging to eight species of Schisandra chinensis. These samples were amplified according to... ycf1 Gene fragments were detected by agarose gel electrophoresis to obtain all analyzed samples. ycf1 underlying cause Fragment sequence.

[0042] The obtained species and individuals ycf1 underlying cause The sequence, following step 4 of the above method, is used to construct a phylogenetic tree using the NJ method, from... Picture 1 The results show that using fragments " ycf1 "It can be used to study the medicinal materials of *Schisandra chinensis* in Yunnan." Kadsura Carburetor Accurate molecular identification of Schisandra chinensis and its closely related plants revealed that individuals belonging to the same species were accurately divided into one branch, while different species of Schisandra chinensis were divided into different branches. This demonstrates that... ycf1 basis single step It can be used as a DNA barcode for plants in the genus Schisandra. In addition, the sequence is short, only 728 bp in length, and has a high amplification success rate and sequencing success rate (both 100%), which helps to ensure the sequence accuracy of the sample to be tested, thereby improving the accuracy of the identification results.

[0043] Table 3 shows the experimental materials used.

[0044] Experiment Example 2

[0045] Verification petN-psbM The effectiveness of genes as DNA barcodes in distinguishing genuine *Schisandra chinensis* from its genus *Schisandra chinensis* and its closely related, easily confused species.

[0046] method: Collect the Schisandra genus shown in Table 3 ( Kadsura Thirty-five fresh young leaf samples from different ancestral plants, belonging to eight species of Schisandra chinensis. The samples were amplified according to Example 1. petN-psbM Gene fragments were detected by agarose gel electrophoresis to obtain all analyzed samples. petN-psbM Fragment sequence.

[0047] The obtained species and individuals petN-psbM The sequence, following step 4 of the method in Example 1, uses the NJ method to construct a phylogenetic tree, from... Picture 2 The results show that petN-psbM The gene fragments were extremely inefficient at identifying the Schisandra species analyzed, only able to distinguish one species, Schisandra chinensis, and could not accurately identify the eight species analyzed.

[0048] Experimental Example 3

[0049] Verification ndhF-rpl32 The effectiveness of genes as DNA barcodes in distinguishing genuine *Schisandra chinensis* from its genus *Schisandra chinensis* and its closely related, easily confused species.

[0050] method: Collect the Schisandra genus shown in Table 3 ( Kadsura Thirty-five fresh young leaf samples from different ancestral plants, belonging to eight species of Schisandra chinensis. The samples were amplified according to steps 1-3 of the above method. ndhF-rpl32 Gene fragments were detected by agarose gel electrophoresis to obtain all analyzed samples. ndhF-rpl32 Fragment sequence.

[0051] The obtained species and individuals ndhF-rpl32 The sequence, following step 4 of the method in Example 1, uses the NJ method to construct a phylogenetic tree, from... Picture 3 The results show that ndhF-rpl32 The gene fragments were extremely inefficient at identifying the Schisandra species analyzed, only able to distinguish one species, Schisandra chinensis, and could not accurately identify the eight species analyzed.

[0052] Experiment Example 4

[0053] Verification ndhF The effectiveness of genes as DNA barcodes in distinguishing genuine *Schisandra chinensis* from its genus *Schisandra chinensis* and its closely related, easily confused species.

[0054] method: Collect the Schisandra genus shown in Table 3 ( Kadsura Thirty-five fresh young leaf samples from different ancestral plants, belonging to eight species of Schisandra chinensis. The samples were amplified according to steps 1-3 of the method in Example 1. ndhF Gene fragments were detected by agarose gel electrophoresis to obtain all analyzed samples. ndhF Fragment sequence.

[0055] The obtained species and individuals ndhF The sequence, following step 4 of the method in Example 1, uses the NJ method to construct a phylogenetic tree, from... Picture 4 The results show that ndhF The gene fragments were extremely inefficient at identifying the Schisandra species analyzed, only able to distinguish one species, Schisandra chinensis, and could not accurately identify the eight species analyzed.

[0056] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Application of the ycf1 gene fragment as a DNA barcode in the identification of species of the genus Schisandra.

2. The application according to claim 1, characterized in that, The species of the genus *Schisandra* include *Schisandra insularis*, *Schisandra heteromorpha*, *Schisandra angustifolia*, *Schisandra spp.*, *Schisandra pubescens ...chinensis*, *Schisandra chinensis*, and *Schisandra chinensis* 3. The application according to claim 1, characterized in that, The ycf1 gene is used to distinguish *Schisandra chinensis*, the authentic original species of *Schisandra chinensis*, from closely related species within the same genus; the sequence numbers of the ycf1 gene fragments are PZ572531, PZ572532, PZ572533, PZ572534, PZ572535, PZ572541, PZ572542, PZ572543, PZ572536, PZ572537, PZ572538, PZ572539, PZ572540, PZ572529, and PZ572. One of PZ572526, PZ572527, PZ572528, PZ572521, PZ572522, PZ572523, PZ572524, PZ572525, PZ572547, PZ572548, PZ572544, PZ572545, PZ572546, PZ572520, PZ572518, PZ572515, PZ572516, PZ572517, and PZ572519.

4. A method for identifying the medicinal source of *Spatholobus suberectus*, characterized in that, Includes the following steps: The sequence of the ycf1 gene fragment in the sample to be tested is detected, and the sequence of the ycf1 gene fragment in the sample to be tested is compared with the reference sequence of the ycf1 gene of Schisandra chinensis. If the sequence to be tested and the ycf1 sequence of Schisandra chinensis are clustered into one branch, the sample to be tested is identified as the genuine product of Spatholobus suberectus.

5. The method according to claim 4, characterized in that, A method for detecting the ycf1 gene fragment in a sample to be tested includes the following steps: (1) Extract DNA from the sample to be tested; (2) Using the extracted DNA as a template, PCR amplification was performed using primer pairs for amplifying the ycf1 gene fragment; (3) Sequencing the PCR amplification products to obtain the sequence of the ycf1 gene fragment.

6. The method according to claim 5, characterized in that, The primer pairs for amplifying the ycf1 gene fragment are shown in SEQ ID NO: 1 and 2.

7. A PCR detection kit for identifying the medicinal material origin of *Spatholobus suberectus*, characterized in that, It includes the primer pair as described in claim 6.

8. The reagent kit according to claim 7, characterized in that, It also contains DNA polymerase, dNTPs, and PCR buffer.

9. Application of the ycf1 gene in the preparation of a kit for identifying species of the genus Schisandra.

10. The application according to claim 9, characterized in that, The kit is used to distinguish between the genuine *Schisandra chinensis* var. *yunnanensis* and closely related species of the same genus.

Images