Molecular marker of functional of a major gene of salt tolerance in pea (PsPMD) and application thereof

Abstract

This invention discloses a major gene for salt tolerance in peas. PsPMD Functional molecular markers and their applications belong to the field of plant molecular breeding technology. This invention, through genome-wide association analysis, identified a SNP locus significantly associated with salt tolerance at position 357872321 bp on pea chromosome 5, named PMD_357872321. This locus exhibits an A / G polymorphism, located in the coding region of the PsPMD gene, causing a missense mutation c.101A>G, p.His34Arg. Based on this locus, a KASP primer combination was developed, enabling precise identification of pea salt-tolerant genotypes via fluorescence signals. The molecular marker genotyping accuracy of this invention exceeds 90%, enabling rapid, high-throughput differentiation between salt-tolerant genotypes (A / A) and salt-sensitive genotypes (G / G) at the seedling stage. This significantly shortens the breeding cycle, improves the efficiency of salt-tolerant pea breeding, and is suitable for marker-assisted selection of pea varieties in saline-alkali land.

Description

Technical Field

[0001] This invention belongs to the field of biomolecular technology, specifically relating to a major gene related to salt tolerance in peas. PsPMD Functionally relevant KASP molecular markers and methods for using these markers to assist in the breeding of salt-tolerant pea varieties. Background Technology

[0002] pea( Pisum sativum Peas (L.) are an important edible legume crop. They not only provide high-quality protein but also possess ecological functions such as biological nitrogen fixation and soil fertility improvement, making them a preferred crop for saline-alkali land development. However, existing major varieties generally have poor salt tolerance, and salt stress can lead to a significant decline in photosynthetic physiological indicators, restricting the large-scale cultivation of peas in saline-alkali areas.

[0003] Salt tolerance in peas is a complex quantitative trait, controlled by multiple genes and easily influenced by the environment. Traditional breeding methods rely on phenotypic selection, which is time-consuming, inefficient, and inaccurate. With the release of the pea reference genome and the development of sequencing technology, SNP-based molecular marker-assisted selection has become a highly efficient breeding method. Kompetitive allele-specific PCR (KASP) technology has advantages such as high throughput, low cost, and high accuracy, and has been widely used in crop molecular breeding. However, stable and usable functional KASP molecular markers are still lacking for pea salt tolerance breeding. Summary of the Invention

[0004] To address the problems of existing pea salt tolerance breeding methods, such as the lack of efficient molecular markers, long breeding cycles, and low accuracy, the purpose of this invention is to provide a gene associated with the major salt tolerance gene in peas. PsPMD This method involves functionally related KASP molecular markers, specific primers for these KASP molecular markers, and auxiliary breeding methods. First, genome-wide association analysis (GWAS) is used to obtain SNPs functionally associated with salt tolerance genes. Then, the SNPs are converted into KASP markers for verification. These markers are then used to amplify the materials to be identified. Based on the genotype, the salt tolerance allelic variation of the samples is determined, thereby achieving rapid identification of salt tolerance genotypes and improving breeding efficiency.

[0005] This invention locates the major salt tolerance gene using GWAS analysis. PsPMD Furthermore, based on functional missense mutations in its coding region, KASP molecular markers were developed, enabling rapid and accurate identification of pea salt tolerance and providing a core tool for salt-tolerant pea breeding.

[0006] To achieve the above objectives, the present invention provides the following technical solution: 1. This invention first constructed a core pea germplasm population containing 515 accessions, and then identified its salt tolerance phenotype and genotype. The salt tolerance phenotype was determined in Hangzhou in 2024 using a randomized block design, with three replicates per accession. Peas grown for four weeks were subjected to a 7-day stress of 300 mM NaCl. Plant height, fresh weight, dry weight stress / control ratio, and leaf yellowing were used as indicators of salt tolerance, ultimately obtaining phenotypic data on salt tolerance. Genome-wide association analysis was performed using an EMMAX mixed linear model, and a highly significant association locus was found on chromosome 5 (P = 1.63 × 10⁻⁶). -8 ), locked gene is PsPMD (Pisum_028085).

[0007] This site represents a SNP mutation. PMD _357872321, located on chromosome 5 of the ZW1 reference genome at 357872321 bp, has a polymorphism of A / G and belongs to... PsPMD Nucleotide 101 of the gene CDS causes a missense mutation: c.101A>G, p.His34Arg.

[0008] The molecular marker is of type KASP, and its sequence is shown in SEQ ID No. 1, where nucleotide 101 is an A / G polymorphic site. ATGGAGAGATGGGTATCGCGATCCGGTTTATCTTCACTGCAGAGAACCAGTCTGAACAAGATAGACACAAATCTTGTGTCGGCATTTGTGGAAAGATGGC[A / G]TCTAGAGACATCTTTATTTCACATGCCGTTTGGTGAAATGAGCATTACTCTAGATGATGTCGCATGTCTACTACACTTGCCCATCAGGGGTATCTTCTGGSEQ ID No: 1.

[0009] 2. The KASP primers for detecting the molecular marker shown in SEQ ID No. 1 consist of a specific forward primer Primer1, a specific forward primer Primer2, and a universal reverse primer, with the following specific sequence: PMD_ 357872321 KASP primer: PMD_ 357872321Primer1:5'-GTGAAATAAAGATGTCTCTAGAC-3'; PMD_357872321Primer2: 5'-GTGAAATAAAGATGTCTCTAGAT-3'; PMD_ 357872321Primer1 and PMD_ Primer2 consists of two specific primers, each linked to a different fluorescent group; PMD_ 357872321Primer_Common: 5'-TTATCTTCACTGCAGAGAACCAG-3'.

[0010] Furthermore, among them PMD_ 357872321Primer1 connects to the FAM group. PMD_ 357872321 Primer2 connects to the HEX group.

[0011] KASP: Competitive allele-specific PCR.

[0012] 3. The present invention also provides a kit comprising the above-mentioned KASP primers.

[0013] 4. The KASP primers and kits containing KASP primers described above can be used for the identification of salt-tolerant genotypes in peas or for molecular marker-assisted breeding of salt-tolerant pea varieties.

[0014] 5. A method for breeding pea varieties with different salt tolerance capabilities using KASP primers, which are functional molecular markers of the major pea salt tolerance gene. The method specifically includes the following steps: S1. Extract genomic DNA from pea plant samples; S2. Using the DNA extracted in S1 as a template, KASP amplification is performed using the KASP primers described in this invention; The KASP primer sequences are shown in SEQ ID No. 2 to SEQ ID No. 4.

[0015] S3. Read the fluorescence signal detected by the KASP reaction. If the genomic DNA of the plant sample shows a single fluorescence signal carried by the specific forward primer Primer1, the sample can be identified as a salt-tolerant homozygous genotype A / A. If the genomic DNA of the plant sample shows a single fluorescence signal carried by the specific forward primer Primer2, the sample can be identified as a salt-sensitive homozygous genotype G / G. When both Primer1 and Primer2 show fluorescence signals simultaneously, the pea germplasm is identified as a heterozygous A / G genotype. The salt tolerance of this genotype is between that of the A / A homozygous salt-tolerant line and the G / G homozygous sensitive line, and it can be used as an intermediate hybridization material for salt tolerance breeding.

[0016] Furthermore, in the method for breeding pea varieties with different salt tolerance, Primer1 is linked to the FAM group, and Primer2 is linked to the HEX group; the FAM signal is A / A (salt-tolerant homozygous genotype); and the HEX signal is G / G (salt-sensitive homozygous genotype).

[0017] Furthermore, in the method for breeding pea varieties with different salt tolerance, the KASP reaction detection also includes the 2X KASPMaster mix reagent.

[0018] Furthermore, in the method for breeding pea varieties with different salt tolerance, the total volume of the KASP reaction system is 10 μl, which contains 2.0 μl template DNA (10–50 ng), 5.0 μl 2× KASP Master Mix, 0.2 μl primer mixture (10 μM), and the remainder is made up with ddH2O.

[0019] Furthermore, in the method for breeding pea varieties with different salt tolerance, the PCR reaction program for KASP reaction detection is as follows: pre-denaturation at 94℃ for 15 minutes, denaturation at 94℃ for 20 seconds, gradient annealing at 61~55℃ for 60 seconds, with the annealing temperature decreasing by 0.6℃ in each cycle, extension at 55℃ for 60 seconds, for 10 cycles; then denaturation at 94℃ for 20 seconds, annealing at 55℃ for 60 seconds, extension for 60 seconds, for 26 cycles.

[0020] The beneficial effects of this invention are as follows: (1) This invention provides a SNP locus related to the function of the major salt tolerance gene in peas. PMD_ The gene 357872321 exhibits an A / G polymorphism at chromosome 5 at 357872321 bp in the genome of the pea variety Zhewan No. 1 (Zhewan No. 1). Further research was conducted using a related KASP marker for verification. This marker was then used to amplify materials requiring identification. Favorable allelic variations in samples were determined based on their genotype A / G ratio, thus providing a rapid, reliable, and practical molecular tool and detection method for the genetic improvement of salt tolerance traits in peas or for the precise breeding of salt-tolerant varieties.

[0021] (2) The salt tolerance-related SNP loci identified in this invention exhibit significant advantages in molecular breeding applications. KASP primers developed based on these SNP loci can accurately identify and screen salt tolerance genotypes in the early stages of pea seedling growth, completely unaffected by environmental conditions or plant development stages. Compared to traditional salt tolerance phenotypic identification, which requires high-concentration salt stress treatment until obvious symptoms appear, resulting in a long cycle, heavy workload, poor repeatability, and susceptibility to interference from environmental factors such as temperature and light, the molecular markers and KASP primers provided in this invention can assist in the screening of different salt tolerance traits. This allows breeding selection to shift from "phenotype-dependent" to "genotype-driven," enabling high-throughput detection in a short time, significantly saving manpower and resources, and providing ample marker resources for pea genetic diversity analysis, gene mapping, and future molecular breeding. Early elimination of superior individual plants can be achieved under non-stress conditions during the seedling stage, greatly shortening the breeding cycle and significantly improving the efficiency of phenotypic trait selection.

[0022] (3) Compared with traditional phenotypic selection, molecular tool screening results are more reliable and accurate. The present invention provides... PMD_ The 357872321 KASP marker primer detection method boasts an accuracy rate of up to 90%. It can rapidly screen out pea varieties or lines with salt tolerance, increasing pea yield and facilitating the large-scale cultivation of peas in saline-alkali areas. It also helps accelerate the selection and breeding process of peas. Attached Figure Description

[0023] To make the objectives, technical solutions, and beneficial effects of this invention clearer, the following figures are provided for illustration: Figure 1 This represents a partial pea phenotype.

[0024] Figure 2 for PMD KASP marker genotyping diagram of genes associated with the _357872321 marker site.

[0025] Figure 3 for PMD Salt tolerance difference at _357872321 marker sites. Detailed Implementation

[0026] The preferred embodiments of the present invention will now be described in detail with reference to the accompanying drawings. It should be understood that the following embodiments are given for illustrative purposes only and are not intended to limit the scope of the invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from its spirit and essence.

[0027] Unless otherwise specified, the experimental methods used in the following examples are generally performed under conventional conditions or as recommended by the manufacturer.

[0028] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0029] Example 1: This invention first constructed a salt tolerance evaluation population containing 515 core pea germplasm accessions (statistical data of some core germplasm and salt treatment phenotypes are shown in Table 1). The core germplasm population includes germplasm resources obtained through public channels (including improved varieties, local varieties, and wild germplasm preserved in domestic and international gene banks) and commercially available varieties, covering various uses such as vegetable peas, grain peas, and dual-purpose peas (vegetable and seed peas), exhibiting broad genetic diversity. Subsequently, salt tolerance phenotypes and genotypes were identified. Salt tolerance phenotypes were determined in Hangzhou in 2024 using a randomized block design, with three replicates per material. Peas grown for four weeks were subjected to a 7-day stress of 300 mM NaCl. Plant height, fresh weight, dry weight stress / control ratios, and leaf wilting were used as salt tolerance indicators to obtain the final salt tolerance phenotypic data. Genome-wide association analysis was performed using an EMMAX mixed linear model, and a highly significant association locus was obtained on chromosome 5 (P = 1.63 × 10⁻⁶). -8 ), locked gene is PsPMD (Pisum_028085).

[0030] Table 1. Statistical data of some core germplasm and salt treatment phenotypes This site represents a SNP mutation. PMD _357872321, located on chromosome 5 at 357872321 bp in the reference genome of ZW1, has a polymorphism of A / G and belongs to... PsPMD Nucleotide 101 of the gene CDS causes a missense mutation: c.101A>G, p.His34Arg.

[0031] PsPMD The SNP at 357872321 bp of the gene is A / G, and its sequence variation in the population is as follows: ATGGAGAGATGGGTATCGCGATCCGGTTTATCTTCACTGCAGAGAACCAGTCTGAACAAGATAGACACAAATCTTGTGTCGGCATTTGTGGAAAGATGGC[A / G]TCTAGAGACATCTTTATTTCACATGCCGTTTGGTGAAATGAGCATTACTCTAGATGATGTCGCATGTCTACTACACTTGCCCATCAGGGGTATCTTCTGGSEQ ID No.1.

[0032] Design using this sequence PMD_ Two specific primers and one universal primer for 357872321 are provided, and the primer sequences are as follows: PMD_ 357872321 KASP primer: PMD_ 357872321Primer1: 5'-GTGAAATAAAGATGTCTCTAGAC-3'; SEQ ID No. 2; PMD_ 357872321Primer2: 5'-GTGAAATAAAGATGTCTCTAGAT-3'; SEQ ID No. 3; PMD_ 357872321Primer1 and PMD_ Primer2 (357872321) consists of two specific primers, each linked to a different fluorescent group; among them... PMD_ 357872321Primer1 connects to the FAM group. PMD_ 357872321 Primer2 connects to the HEX group.

[0033] PMD_ 357872321Primer_Common: 5'-TTATCTTCACTGCAGAGAACCAG-3'; SEQ ID No. 4.

[0034] Example 2 Verification In this embodiment, 65 pea germplasm accessions were randomly selected from the Vegetable Research Institute of Zhejiang Academy of Agricultural Sciences.

[0035] Salt tolerance phenotypes were identified in 65 randomly selected pea germplasm accessions. Figure 1This section presents partial pea phenotypes. Salt treatment was performed using a soil-based method. Two-week-old pea seedlings were treated with 200 mL of 300 mM NaCl for 7 days. Fresh weight, dry weight, and leaf yellowing were then measured to determine salt tolerance. Each germplasm sample was used as a control group before salt stress treatment. The comprehensive salt tolerance score was calculated by summing the scores of three salt stress phenotypic indicators: fresh weight (0–2 points), dry weight (0–2 points), and leaf yellowing (0–2 points). The scoring rules for each individual indicator were as follows: 2 points for no significant difference in phenotypic value compared to the control under salt treatment, 1 point for moderate suppression of the phenotypic value, and 0 points for severe suppression or loss of the phenotypic value. The comprehensive score ranged from 0 to 6 points, with higher scores indicating stronger salt tolerance, and a maximum score of 6 points corresponding to the highest salt tolerance level.

[0036] Genomic DNA was extracted from pea seedlings using the CTAB method, and KASP analysis was performed using the IntelliQube genotyping platform. The total volume of the PCR reaction system was 10 μl, containing 2.0 μl template DNA (10–50 ng), 5.0 μl 2× KASP MasterMix, 0.2 μl primer mixture (10 μM), and the remainder was made up with ddH2O. The primer mixture consisted of equimolar amounts of allele-specific primers Primer_AlleleFAM and Primer_AlleleHEX, and universal primer Primer_Common, with each primer having a concentration of 3.33 μM in the mixture, and the final reaction concentration was 100 nM. The PCR reaction program for KASP reaction detection is as follows: pre-denaturation at 94℃ for 15 minutes, denaturation at 94℃ for 20 seconds, gradient annealing at 61~55℃ for 60 seconds, with the annealing temperature decreasing by 0.6℃ per cycle, extension at 55℃ for 60 seconds, for 10 cycles; then denaturation at 94℃ for 20 seconds, annealing at 55℃ for 60 seconds, extension for 60 seconds, for 26 cycles.

[0037] Analysis results as follows Figure 2 As shown in the diagram, a red fluorescence signal (FAM signal) indicates that the pea carries the salt-tolerant allele A (HapI), while a blue fluorescence signal (HEX signal) indicates that the pea carries the sensitive allele G (HapII).

[0038] Depend on Figure 2 As shown, the KASP molecular marker of this invention achieved highly consistent and well-defined population genotyping results in pea populations. The two genotypes could be clearly distinguished and clustered, resulting in good genotyping performance.

[0039] Based on its salt tolerance performance (see...) Figure 3(Statistical data on genotypes and salt treatment phenotypes of some selected germplasm are shown in Table 2). It was found that lines carrying the A / A genotype had a higher average salt tolerance score, while lines carrying the G / G genotype had a relatively lower average salt tolerance score. Data analysis indicated that the average salt tolerance of lines carrying the A / A genotype was significantly higher than that of the G / G genotype (p = 3.14 × 10⁻⁶). -6 This study confirmed that the marker can effectively distinguish differences in salt tolerance in peas, ultimately achieving the goal of molecular marker screening.

[0040] Table 2. Statistical data of genotypes and salt treatment phenotypes of selected germplasm. Note: The comprehensive salt tolerance score is the sum of three salt phenotype scores: fresh weight (0-2 points), dry weight (0-2 points), and leaf yellowing (0-2 points).

[0041] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the invention by those skilled in the art. Any modifications, equivalent substitutions, or improvements made to the present invention should be included within the scope of protection of the present invention.

Claims

1. A major gene for salt tolerance in peas PsPMD Functional molecular markers, characterized by, The nucleotide sequence of the molecular marker is shown in SEQ ID No. 1, which causes missense mutations: c.101A>G, p.His34Arg.

2. The method for detecting the KASP primers containing the molecular marker described in claim 1, characterized in that, The KASP primers consist of a specific forward primer Primer1, a specific forward primer Primer2, and a universal reverse primer; the sequence of Primer1 is shown in SEQ ID No. 2, the sequence of Primer2 is shown in SEQ ID No. 3, and the sequence of the universal reverse primer is shown in SEQ ID No. 4; the specific forward primers Primer1 and Primer2 are respectively linked to different fluorescent groups.

3. The KASP primer according to claim 2, characterized in that, The specific forward primer Primer1 is linked to the FAM fluorescent group, and the specific forward primer Primer2 is linked to the HEX fluorescent group.

4. A reagent kit, characterized in that, The kit contains the KASP primers as described in claim 2 or 3.

5. The application of the KASP primers of claim 2 or 3, or the kit of claim 4, in the identification of salt-tolerant genotypes in peas.

6. A method for breeding salt-tolerant pea varieties using the KASP primers described in claim 2 or 3, characterized in that, The method specifically includes the following steps: S1. Extract genomic DNA from pea plant samples; S2. Using the DNA extracted in S1 as a template, perform KASP reaction detection using the KASP primers described above; S3. Read the fluorescence signal detected by the KASP reaction. The classification criteria are divided into three types: 1) Only a single fluorescent signal carried by the specific forward primer Primer1 was detected: the sample was a salt-tolerant homozygous genotype A / A; 2) Only a single fluorescent signal carried by the specific forward primer Primer2 was detected: the sample was a salt-sensitive homozygous genotype G / G; 3) Simultaneous detection of fluorescence signals carried by Primer1 and Primer2: The sample is heterozygous genotype A / G and has moderate salt tolerance.

7. The method according to claim 6, characterized in that, Primer1 is attached to the FAM group, and Primer2 is attached to the HEX group.

8. The method according to claim 7, characterized in that, The KASP reaction assay also includes 2×KASP Mastermix reagent.

9. The method according to claim 8, characterized in that, The total volume of the KASP reaction system is 10 μl, which contains 2.0 μl of template DNA, 5.0 μl of 2× KASP Master Mix, 0.2 μl of primer mixture, and the remainder is made up with ddH2O.

10. The method according to claim 6, characterized in that, The reaction procedure was as follows: The PCR reaction procedure for KASP reaction detection was 94℃ pre-denaturation for 15 minutes, 94℃ denaturation for 20 seconds, 61~55℃ gradient annealing for 60 seconds, with the annealing temperature decreasing by 0.6℃ for each cycle, and 55℃ extension for 60 seconds, for 10 cycles; then 94℃ denaturation for 20 seconds, 55℃ annealing for 60 seconds, extension for 60 seconds, for 26 cycles.

Images