A U-shaped optical fiber probe, a virus detection device based on fiber-optic sensing and CRISPR / Cas, and a virus detection method
Patent Information
- Application Number
- CN202610756123.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-28
- Publication Date
- 2026-08-21
AI Technical Summary
[0005]针对现有病毒检测技术依赖扩增、操作复杂、设备要求高的问题,本发明提供了一种U形光纤探针、基于光纤传感与CRISPR/Cas的病毒检测装置及病毒检测方法,通过将CRISPR/Cas的特异性识别与光纤传感的高灵敏度相结合,实现了对病毒核酸的快速、高灵敏、无扩增检测
(1)本发明提供一种U形光纤探针,基于回音壁模式(WGM)的U形光纤探针能够以超高灵敏度检测光纤局部的折射率变化,通过核酸链将ZnO@Au连接到探针表面,有效调控了光纤探针表面的倏逝场,并且由ZnO@Au构成的异质结能进一步增强Au纳米颗粒(AuNPs)产生的局域表面等离子体共振(LSPR)效应,大大提高了探针的整体灵敏度;
Smart Images

Figure CN122609753A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biosensing and molecular diagnostics technology, and specifically relates to a U-shaped optical fiber probe, a virus detection device based on optical fiber sensing and CRISPR / Cas, and a virus detection method. Background Technology
[0002] In recent years, CRISPR / Cas systems have been widely used in molecular diagnostics due to their high specificity. Among them, the Cas12a protein can activate non-specific cleavage activity after recognizing target nucleic acids, making it suitable for signal amplification and conversion. However, most CRISPR-based detection methods still rely on preliminary nucleic acid amplification steps (such as RPA and LAMP), which not only increases operational complexity and contamination risk but also prolongs detection time.
[0003] Fiber optic sensors, with their advantages of high sensitivity, resistance to electromagnetic interference, and ease of miniaturization, have been widely used in the field of biochemical detection. In particular, fiber optic sensors based on whispering-gallery mode (WGM) or surface plasmon resonance (SPR) can achieve ultra-high sensitivity responses to changes in the refractive index of analytes. However, existing fiber optic biosensors are mostly used for protein or small molecule detection, and their direct application to the detection of amplified viral nucleic acids still faces challenges such as insufficient sensitivity and complex signal conversion mechanisms.
[0004] Therefore, combining fiber optic sensors with virus detection to develop a rapid, highly sensitive, and simplified on-site virus detection technology that does not require nucleic acid amplification has significant practical application value. Summary of the Invention
[0005] To address the problems of existing virus detection technologies that rely on amplification, are complex to operate, and have high equipment requirements, this invention provides a U-shaped optical fiber probe, a virus detection device based on optical fiber sensing and CRISPR / Cas, and a virus detection method. By combining the specific recognition of CRISPR / Cas with the high sensitivity of optical fiber sensing, rapid, highly sensitive, and amplification-free detection of viral nucleic acids is achieved.
[0006] To achieve the above objectives, the present invention provides a U-shaped optical fiber probe, the U-shaped optical fiber probe comprising a U-shaped optical fiber substrate, the U-shaped optical fiber substrate comprising a U-shaped coreless optical fiber and single-mode optical fibers respectively connected to both ends of the coreless optical fiber; ZnO@Au heterojunction nanoparticles are immobilized on the surface of the coreless optical fiber by means of ssDNA reporter molecules. The ZnO@Au heterojunction nanoparticles have a core-shell structure, wherein the core structure is a thin sheet composed of ZnO nanoparticles and coated with Au.
[0007] This invention connects ZnO@Au to the probe surface via nucleic acid chains, effectively modulating the evanescent field on the fiber optic probe surface. Furthermore, the heterojunction composed of ZnO@Au can further enhance the local surface plasmon resonance (LSPR) effect generated by Au nanoparticles (AuNPs), greatly improving the overall sensitivity of the probe.
[0008] Preferably, the radius of curvature of the optical fiber probe is 4mm-5mm; the duty cycle of the Au particles in the ZnO@Au heterojunction nanoparticles is 20%-30%; the particle size of the ZnO nanoparticles is 10nm-20nm; and the thickness of the ZnO sheet is 40nm-60nm. Bending of optical fiber leads to a further increase in optical loss, primarily composed of bending loss and transition loss. Transition loss occurs in the region where the fiber begins to bend, as the change in optical path curvature causes some light to leak out, even though total internal reflection was initially satisfied. Pure bending loss occurs in fiber segments with constant curvature, where the longer optical path on the outer side of the bend compared to the inner side causes wavefront distortion in the bending region, resulting in some energy being radiated outwards. The loss decreases exponentially with increasing radius of curvature. This application selected a radius of curvature of 4.5 mm, which ensures relatively low optical loss while maintaining a compact probe size suitable for subsequent inspection.
[0009] Preferably, the ssDNA reporter molecule comprises a pair of ssDNAs having the base sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2; the 5' end of the ssDNA with the base sequence shown in SEQ ID NO: 1 is modified with a carboxyl group, and the 3' end of the ssDNA with the base sequence shown in SEQ ID NO: 2 is modified with a thiol group.
[0010] Under the same technical concept, the present invention also provides a virus detection device based on fiber optic sensing and CRISPR / Cas, the virus detection device including a broadband light source, a U-shaped fiber optic probe, a spectrometer, a CRISPR / Cas reaction unit, and a temperature control platform; The light emitted by the broadband light source enters from one end of the U-shaped fiber probe through an optical fiber, and the output light enters the spectrometer from the other end of the U-shaped fiber probe. The CRISPR / Cas reaction unit is placed on a temperature control platform. During detection, the U-shaped tip of the U-shaped fiber probe is placed in the microfluidic chamber or test tube of the CRISPR / Cas reaction unit.
[0011] The broadband light source is used to provide stable broadband incident light for the U-shaped fiber probe, excite the whispering gallery mode in the U-shaped fiber probe, and ensure that the output interference spectrum has sufficient signal-to-noise ratio and contrast. The U-shaped fiber probe is a U-shaped sensing structure made by fusing single-mode fiber and coreless fiber and tapering. Its surface is successively treated with hydroxylation and aminosilanization to modify ssDNA reporter molecules. The surface of the U-shaped fiber probe is connected with ZnO@Au heterojunction nanomaterials through DNA complementary pairing to improve sensitivity. The U-shaped sensing structure of the U-shaped fiber probe is used to excite the whispering-gallery mode, so that its evanescent field interacts strongly with the surface environment, and the CRISPR / Cas recognition and cleavage reaction is converted into the shedding of ZnO@Au, which causes a change in the local refractive index of the U-shaped fiber probe, and finally modulates the resonant wavelength of the output interference spectrum. The CRISPR / Cas12a system can specifically recognize target viral nucleic acid sequences and cleave ssDNA reporter molecules. This invention combines an optical fiber probe with the CRISPR / Cas12a system to construct an amplification-free biosensing platform. Incident light generated by a broadband light source (BBS) excites a wave-mass spectrometer (WGM) in the sensing region of a U-shaped optical fiber probe. Different WGMs interfere with each other, outputting a resonance spectrum. ZnO@Au is attached to the surface of the optical fiber probe via a pair of partially complementary ssDNA reporter molecules. When the target viral nucleic acid is present, the CRISPR / Cas12a system is activated and begins cleaving the ssDNA, causing the locally loaded ZnO@Au on the optical fiber probe to detach, resulting in changes in the LSPR absorption peak and the WGM resonance valley. This spectral shift demodulates the analyte information.
[0012] The spectrometer is used to acquire and digitize the interference spectrum output by the U-shaped fiber probe in real time, monitor the dynamic changes in the position of the resonance valley of the interference spectrum, and provide raw data for subsequent signal demodulation and quantitative analysis. The CRISPR / Cas reaction unit is used to provide a specific biomolecular recognition and signal transduction core for the detection device. When monkeypox virus nucleic acid is present in the sample to be tested, CrRNA guides the Cas protein to specifically bind to the target sequence and activate its trans-cleavage activity, cleaving the ssDNA reporter molecule fixed on the surface of the U-shaped optical fiber probe, thereby triggering the generation of subsequent optical signals. The temperature control platform is used to ensure that the ambient temperature of the CRISPR / Cas reaction unit is 37°C, providing the optimal temperature environment for the Cas enzyme reaction.
[0013] Preferably, the broadband light source emits a spectrum ranging from 1520 nm to 1608 nm, the spectrometer measures from 700 nm to 1700 nm, and has a wavelength resolution of 0.05 nm. The CRISPR / Cas reaction unit includes CrRNA designed for non-conserved gene regions in the virus, Cas protein, a reaction buffer for containing the sample to be tested, and a microfluidic chamber or test tube for containing the reaction buffer.
[0014] Preferably, the CRISPR / Cas reaction unit is a monkeypox virus CRISPR / Cas reaction unit; wherein the Cas protein is Cas12a; and the CrRNA designed for conserved gene regions in monkeypox virus contains the base sequence shown in SEQ ID NO:11-13.
[0015] More preferably, the CrRNA sequences shown in SEQ ID NO:11 and SEQ ID NO:12 are used together to detect monkeypox virus.
[0016] Monkeypox virus is a zoonotic pathogen that has caused outbreaks in many countries around the world since 2022, posing a serious threat to public health. Currently, the gold standard for laboratory diagnosis of monkeypox virus is real-time quantitative polymerase chain reaction (qPCR). Although this method is accurate, it relies on sophisticated instruments, a professional operating environment, and a long amplification time, making it difficult to promote and apply in primary healthcare, field screening, and resource-limited areas.
[0017] The virus detection device based on fiber optic sensing and CRISPR / Cas provided by this invention can solve the problems of existing monkeypox virus detection technology, which relies on amplification, is complicated to operate, and has high equipment requirements. Based on the base sequence CrRNA shown in SEQ ID NO: 3 and SEQ ID NO: 4, it can realize on-site detection of monkeypox virus without nucleic acid amplification, which is rapid, highly sensitive, and has simplified equipment.
[0018] Under the same technical concept, the present invention also provides a virus detection method based on a virus detection device using fiber optic sensing and CRISPR / Cas, comprising the following steps: S1. Fabrication and functionalization of U-shaped fiber optic probes: S1.1 Preparation of U-shaped fiber probe: Single-mode fibers are fused to both ends of a coreless fiber, the spliced fibers are tapered and bent into a U-shape and encapsulated using a mold to obtain a U-shaped fiber substrate; the U-shaped fiber substrate is immersed in piranha solution and washed with anhydrous ethanol to complete surface hydroxylation; the U-shaped fiber substrate is immersed in ATPES solution and then dried to introduce and solidify amino groups on the surface. This invention constructs a sensing structure by fusion splicing two segments of single-mode fiber (SMF) with one segment of coreless fiber (CLF). When the fundamental mode propagating in the SMF core enters the CLF, the abrupt change in normalized frequency excites multiple higher-order linear polarization modes (LPMs), which taper the fusion splice structure. The taper process significantly enhances the evanescent field around the fiber, thereby improving the sensitivity of the sensing structure, while also reducing the bending stiffness of the fiber, facilitating subsequent bending. The ssDNA with the base sequence shown in SEQ ID NO: 1 is dissolved and activated, and an ssDNA solution is prepared under alkaline conditions. The U-shaped optical fiber substrate is inserted into the ssDNA solution, and the ssDNA reporter molecule is fixed on the surface of the U-shaped optical fiber substrate to obtain a U-shaped optical fiber probe modified with ssDNA. S1.2 Preparation and functionalization of ZnO@Au heterojunction nanoparticles: ZnO nanoparticles were uniformly dispersed in an etching solution and the mixture was irradiated with a xenon lamp; the surface-etched ZnO nanoparticles were collected by centrifugation, redissolved, and then PVP powder and gold source were added. The mixture was then ultrasonically treated to obtain ZnO@Au heterojunction nanoparticles. The ssDNA with the base sequence shown in SEQ ID NO: 2 was reduced, and the ZnO@Au heterojunction nanoparticles were mixed with the reduced ssDNA and reacted. The mixture was then filtered through an ultrafiltration membrane to obtain ZnO@Au heterojunction nanoparticles modified with ssDNA reporter molecules. S1.3. Conjugate the U-shaped fiber probe with ZnO@Au: Heat the U-shaped fiber probe modified with ssDNA in Tris-HCl buffer, and then immerse it in a solution of ZnO@Au heterojunction nanoparticles modified with ssDNA reporter molecules. Design and fabrication of S2 and CRISPR / Cas reaction units: S2.1 CrRNA design of CRISPR / Cas reaction unit: CrRNA is designed based on the amplification products obtained from the conserved region of the virus to be detected. Each CrRNA consists of two parts: a backbone sequence and a spacer sequence. The reverse complementary sequence of the T7 promoter sequence is also added to the 3′ end of the designed single-stranded CrRNA template. S2.2 Preparation of the designed CrRNA: Annealing extension reaction: Using a single-stranded CrRNA template and the T7 promoter sequence as templates, a double-stranded CrRNA transcription template containing the T7 promoter sequence is generated through an annealing extension reaction; In vitro transcription: The obtained double-stranded CrRNA transcription template was added to the in vitro transcription system to transcribe CrRNA; CrRNA purification: Enzyme-free water and DNase I were added to the completed in vitro transcription system, mixed, and incubated. The entire incubation liquid was then transferred to an EP tube, Bind solution was added, and the mixture was mixed and allowed to stand. Anhydrous ethanol was added and shaken well. The resulting mixture was transferred to a centrifuge column placed in a collection tube and centrifuged. Washing buffer was added, and the mixture was centrifuged again, discarding the eluent. This process was repeated twice. The centrifuge column was then placed in a collection tube, centrifuged, and the cap was opened to allow it to air dry and remove residual ethanol. Finally, the adsorption column was placed in an EP tube, enzyme-free water was added, and the tube was centrifuged to complete the purification. S3. Virus Detection: The sample to be tested is added to the microfluidic chamber or test tube in the CRISPR / Cas reaction unit, and the U-shaped tip of the U-shaped fiber probe is placed in the microfluidic chamber or test tube in the CRISPR / Cas reaction unit. If the target nucleic acid is present in the sample, the CrRNA in the CRISPR / Cas reaction unit guides the Cas protein to recognize and cleave the ssDNA reporter molecule, causing ZnO@Au to detach from the fiber surface, resulting in a local refractive index change. The whispering-gallery mode of the U-shaped probe is excited by a broadband light source, and the resonant valley shift of the output spectrum is monitored in real time using a spectrometer. Based on the quantitative relationship between the shift amount and the viral nucleic acid concentration, amplification-free and highly sensitive detection is achieved.
[0019] Preferably, the spliced optical fiber tapering to U-shape described in step S1.1 specifically includes: placing the spliced optical fiber in an oxyhydrogen flame tapering machine to draw it into a micro-nano optical fiber with a waist diameter of 15-25 micrometers and a taper angle of 0.073-0.082 radians; bending the tapered optical fiber into a U-shape with a curvature radius of 4-5 millimeters and placing it in a Pek mold for encapsulation. The specific steps for dissolving and activating the ssDNA with the base sequence shown in SEQ ID NO: 1 include preparing an ssDNA solution under alkaline conditions: adding 1.5-2.5 μL of 45-55 mmol EDC solution and 7.5-8.5 μL of 50 mmol NHS solution to 45-55 μL of EMS solution with a pH of 6, and reacting in the dark for 30 minutes to activate the carboxyl groups; after the reaction, adding 85-95 μL of PBS buffer with a pH of 7.8 to adjust the entire solution to an alkaline environment, finally obtaining an ssDNA solution with a concentration of 2 μmol. The centrifuge speed adjustment range in step S1.2 is 0-8000 r / min, and the centrifugation speed is 8000 rpm; the redissolved solution is a 1:1 mixture of ethanol and water; the gold source is a 1% chloroauric acid solution; the ssDNA reduction treatment of the base sequence shown in SEQ ID NO: 2 is performed using TCEP; the reaction temperature of the mixed reaction is -20℃; and the reaction time is 2 h. The heating temperature in step S1.3 is 95°C and the heating time is 3 minutes.
[0020] Preferably, the virus to be detected is monkeypox virus, and the CRISPR / Cas reaction unit is used; the CrRNA in step S2.1 contains the base sequence shown in SEQ ID NO:11-13.
[0021] Preferably, the specific composition of the annealing and extension reaction system described in step S2.2 includes: 3.5-4.5 μL of CrRNA single-stranded template, 3.5-4.5 μL of T7 promoter, 9.5-10.5 μL of enzyme-free water, and 1.5-2.5 μL of 10xTaq buffer; the thermal cycling process includes: denaturation at 95°C for 5 minutes; annealing at 25°C for 60 minutes; and finally storage at 4°C. The in vitro transcription reaction system comprises: 3.5-4.5 μL of annealing reaction product, 9.5-10.5 μL of NTP buffer mixture, 1.5-2.5 μL of T7 polymerase mixture, and 13.5-14.5 μL of enzyme-free water; The composition of the CrRNA purification reaction system includes: Incubation system: 25-35 μL of CrRNA transcription system, 15-25 μL of enzyme-free water, and 1.5-2.5 μL of DNase I; Mixed centrifugation system: 95-105 μL Bind solution, 145-155 μL anhydrous ethanol; Washing system: 495-505 μL of cleaning solution; Adsorption purification system: 35-45 μL of enzyme-free water; The centrifugation speed was 13,000 rpm, and the time was 1 minute.
[0022] The above-described solution of the present invention has the following beneficial effects: (1) This invention provides a U-shaped fiber probe. The U-shaped fiber probe based on the whispering-gallery mode (WGM) can detect local refractive index changes in the fiber with ultra-high sensitivity. By connecting ZnO@Au to the probe surface through nucleic acid chains, the evanescent field on the fiber probe surface is effectively controlled. Furthermore, the heterojunction composed of ZnO@Au can further enhance the local surface plasmon resonance (LSPR) effect generated by Au nanoparticles (AuNPs), which greatly improves the overall sensitivity of the probe. (2) The virus detection device based on fiber optic sensing and CRISPR / Cas provided by this invention does not require nucleic acid amplification and directly detects viral nucleic acid, avoiding the contamination risk, operational complexity and equipment dependence caused by amplification, and shortening the detection time to within 9 minutes; combining the high specificity of CRISPR / Cas with fiber optic sensing and further improving the sensitivity of the system through ZnO@Au heterojunction, the detection limit is as low as 10. 0 The copy number per microliter can distinguish different branches of monkeypox virus and other poxviruses; at the same time, it has a wide range of applicability and can design CrRNA based on different viruses to adjust the CRISPR / Cas reaction device for nucleic acid detection of different types of viruses. (3) The virus detection of the present invention achieves quantitative analysis of viral nucleic acid by real-time monitoring of spectral shift, which is highly consistent with the qPCR results. Attached Figure Description
[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0024] Figure 1 This is a schematic diagram of the detection device of the present invention; Figure 2 This is a schematic diagram of the structure of a U-shaped fiber optic probe; Figure 3 Loss calculation for U-shaped fiber optic probes; Figure 4 For optical field simulation and four-layer film structure simulation calculation in U-shaped fiber optic probe; Figure 5 Design diagram of CrRNA for CRISPR / Cas12a; Figure 6 Optimization design diagram for CRISPR / Cas12a system components; Figure 6 (b1) CRISPR fluorescence assays validated that using the two target sequences selected for WMPXV was superior to using either sequence alone; optimization of the amplified CRISPR system: Figure 6 (b2) Cas12a concentration, Figure 6 (b3) Buffer type and Figure 6 (b4) CrRNA concentrations were systematically screened to establish optimal reaction conditions; Figure 7 SEM images and XPS spectral characterizations of ZnO@Au; Figure 8 Real-time detection curves of monkeypox virus nucleic acid at different concentrations are shown, where (a) is the real-time detection curve of monkeypox virus nucleic acid at different concentrations of WMPXV, (b) is the real-time detection curve of monkeypox virus nucleic acid at different concentrations of CMPXV, and (c) is the real-time detection curve of fiber optic probe at 10 0 -10 5 The maximum wavelength shift generated when detecting WMPXV targets at a concentration gradient of copy / μL was fitted using a logarithmic curve. (d) represents the maximum wavelength shift of the fiber probe at a concentration gradient of 10 μL. 0 -10 5The maximum wavelength shift generated when detecting CMPXV targets under a concentration gradient of copy / μL was fitted with a logistic curve. (e) is the detection signal of the fiber optic probe with ZnO@Au functionalization, and (f) is the detection signal of the fiber optic probe without ZnO@Au functionalization. Figure 9 Comparison of clinical sample test results with qPCR; Figure 10 The resonance spectrum of the U-shaped fiber probe prepared in Example 1; Detailed Implementation To make the technical problems, solutions, and advantages of this invention clearer, a detailed description will be provided below with reference to the accompanying drawings and specific embodiments. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.
[0025] In the description of this invention, it should be noted that the terms "center," "upper," "lower," "left," "right," "vertical," "horizontal," "inner," and "outer," etc., indicate the orientation or positional relationship based on the orientation or positional relationship shown in the accompanying drawings. They are used only for the convenience of describing the invention and for simplifying the description, and do not indicate or imply that the device or element referred to must have a specific orientation, or be constructed and operated in a specific orientation. Therefore, they should not be construed as limitations on the invention. Furthermore, the terms "first," "second," and "third" are used for descriptive purposes only and should not be construed as indicating or implying relative importance.
[0026] In the description of this invention, it should be noted that, unless otherwise explicitly specified and limited, the terms "installation," "connection," and "linking" should be interpreted broadly. For example, they can refer to a locking connection, a detachable connection, or an integral connection; they can refer to a mechanical connection or an electrical connection; they can refer to a direct connection or an indirect connection through an intermediate medium; and they can refer to the internal connection of two components. Those skilled in the art can understand the specific meaning of the above terms in this invention based on the specific circumstances.
[0027] Furthermore, the technical features involved in the different embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.
[0028] Figure 1 The diagram shows the structure of the detection device of the present invention, which includes: a broadband light source, a U-shaped fiber optic probe, a spectrometer, a CRISPR / Cas reaction unit, and a temperature control platform.
[0029] Figure 2This is a schematic diagram of the structure of a U-shaped fiber optic probe. The U-shaped fiber optic probe includes a U-shaped fiber optic substrate, which is a U-shaped sensing structure made by fusing single-mode fiber and coreless fiber and drawing a tapered shape. The waist diameter is 20 micrometers, the cone angle is 0.078 radians, and the radius of curvature is 4.5 millimeters.
[0030] ZnO@Au heterojunction nanoparticles are immobilized on the surface of the coreless optical fiber via ssDNA reporter molecules; the duty cycle of Au particles in the ZnO@Au heterojunction nanoparticles is 20%-30%; the particle size of ZnO nanoparticles is 10nm-20nm; and the thickness of the ZnO sheet composed of ZnO nanoparticles is 40nm-60nm.
[0031] This invention proposes a method for detecting monkeypox virus based on the above-mentioned device, which includes the following steps: 1. Fabrication and functionalization of U-shaped fiber optic probes: 1-1. Preparation of U-shaped fiber optic probe: A 2.4 mm coreless fiber was cut, and single-mode fibers were fused to both ends. The spliced fiber was placed in an oxyhydrogen flame drawing machine and drawn into a micro / nano fiber with a waist diameter of 20 μm and a taper angle of 0.078 radians. The drawn fiber was bent into a U-shape with a radius of curvature of 4.5 mm and encapsulated in a PEK mold. The U-shaped fiber optic probe was immersed in a piranha solution (concentrated sulfuric acid: hydrogen peroxide = 7:3) for several hours, then removed and washed with anhydrous ethanol to complete surface hydroxylation. The U-shaped fiber optic probe was immersed in a 10% ATPES solution for several hours and then placed in a 100°C oven to introduce and solidify the amino groups on the surface. It was then washed with deionized water to remove the physically adsorbed ATPES. The 5' end modified carboxyl group of the ssDNA reporter molecule (synthesized by Sangon Biotech) was dissolved in 50 μL of pH 6 EMS solution, and 2 μL of 50 mmol EDC solution and 8 μL of 50 mmol EDC solution were added. A 2 μmol NHS solution was prepared and reacted in the dark for 30 minutes to activate the carboxyl groups. After the reaction, 90 μL of PBS buffer with a pH of 7.8 was added to adjust the entire solution to an alkaline environment, resulting in a 2 μmol ssDNA solution. A U-shaped fiber optic probe was inserted into the ssDNA solution. The amino groups modified on the fiber optic spontaneously reacted with the carboxyl groups on the ssDNA reporter molecules in the ssDNA solution to form amide bonds, thereby immobilizing the ssDNA reporter molecules on the fiber optic surface. 1-2. Preparation of ZnO@Au and surface coupling of ssDNA reporter molecules with ZnO@Au: ZnO nanoparticles were uniformly dispersed in an etching solution (potassium tetraborate: sodium sulfite = 1:1), and the mixture was irradiated with a xenon lamp; subsequently, the etched ZnO particles were collected by centrifugation at 8000 rpm; the etched ZnO particles were redissolved in a 1:1 mixture of ethanol and water, and then PVP powder and a 1% chloroauric acid solution were added, followed by 30°C treatment. ZnO@Au particles were obtained by ultrasonic treatment for minutes; ssDNA reporter molecules with thiol-modified 3' ends were reduced using TCEP; then, ZnO@Au particles were mixed with the reduced ssDNA reporter molecules and reacted at -20°C for 2 hours; during this process, thiol groups formed Au-S bonds with the gold surface, thereby enabling conjugation between the ssDNA reporter molecules and ZnO@Au particles; ssDNA reporter molecules that did not undergo conjugation were removed by filtration through a 50 kDalton ultrafiltration membrane. 1-3. Conjugate the U-shaped fiber probe with ZnO@Au: Heat the U-shaped fiber probe modified with ssDNA in Tris-HCl buffer at 95°C for 3 minutes, and then immerse it in a solution of ZnO@Au particles modified with ssDNA reporter molecules. The ssDNA modified on the fiber surface and the ssDNA on the ZnO@Au surface will spontaneously complement each other, thereby fixing the ZnO@Au particles on the surface of the U-shaped fiber probe. The two ssDNA reporter molecule sequences used above, linked to optical fiber and ZnO@Au, are as follows: SEQ ID NO: 1: CTTTACTCAACCCCCCCCCGAGAGCAGGACG SEQ ID NO: 2: CGTCCTGCTCTC; 2. Design and fabrication of CRISPR / Cas reaction units: In CRISPR / Cas reaction units, the specificity of the reaction is determined by the CrRNA. This invention designs CrRNA by selecting target sequences in the c3l and g2r regions of Central African monkeypox virus (CMPXV) and West African monkeypox virus (WMPXV) sequences; the c3l region sequence of CMPXV is shown in SEQ ID NO: 3; this target sequence differs significantly from other poxviruses (including mousepox (SEQ ID NO: 5), cowpox (SEQ ID NO: 4), and camelpox (SEQ ID NO: 6) sequences), thus exhibiting good specificity (for example,...). Figure 5 The CrRNA designed in the C3L region is shown in SEQ ID NO:13.
[0032] Within the G2R region, the target sequences of CMPXV and WMPXV, as shown in SEQ ID NO: 8 and SEQ ID NO: 7, differ by three nucleotides, enabling differentiation between the two monkeypoxvirus branches. This target sequence is specific to other poxviruses (SEQ ID NO: 9); however, this differential region lacks an optimal Cas12 PAM motif; therefore, the suboptimal NTTV motif was chosen. Using a suboptimal PAM may weaken the binding of the Cas protein to the target and significantly prolong detection time. To improve WMPXV detection, we designed an additional CrRNA based on the non-classical AACCPAM motif and combined it with a CrRNA designed using the NTTV motif, resulting in CrRNA sequences shown in SEQ ID NO: 11 and SEQ ID NO: 12. CRISPR fluorescence assays confirmed that this dual CrRNA combination offered significant advantages over using either CrRNA alone.
[0033] The complete genome sequences of the Central African and West African monkeypox virus subtypes were downloaded from the monkeypox virus database of NCBI (National Center for Biotechnology Information, USA) (https: / / www.ncbi.nlm.nih.gov / nuccore / NC_003310.1). These sequences were aligned using MAFFT (https: / / mafft.cbrc.jp / alignment / server / ), and the alignment results were visualized using Jalview software to screen for highly conserved regions. For these conserved regions, the amplification primers were designed according to standard primer design rules, with a T7 promoter sequence (SEQ ID NO:14) added to the 5′ end of the primers. The CrRNA was designed based on amplification products obtained from selected conserved regions of the Central African and West African monkeypox virus subtypes. Each CrRNA consisted of two parts: a backbone sequence and a spacer sequence. An inverse complementary sequence to the T7 promoter sequence was also added to the 3′ end of the designed single-stranded CrRNA template. The designed CrRNA sequence is as follows: G2RCrRNA-TTN (SEQ ID NO:11): CTGGTTACGACGGGTTCGCATCTACACTTAGTAGAAATTCCCTATAGTGAGTCGTATTAATTTC G2RCrRNA-AACC (SEQ ID NO:12):CGTCGTAACCAGCAATACAATCTACACTTAGTAGAAATTCCCTATAGTGAGTCGTATTAATTTC C3LCrRNA (SEQ ID NO:13): GCATATATGGGTCCCATTTATCTACACTTAGTAGAAATTCCCTATAGTGAGTCGTATTAATTTC The specific preparation of the designed CrRNA is as follows: 2-1. Annealing and Extension Reaction: Using single-stranded CrRNA template and the T7 promoter sequence as templates, a double-stranded CrRNA transcription template containing the T7 promoter sequence is generated through an annealing and extension reaction. The specific annealing reaction system includes: 4 μL of single-stranded CrRNA template, 4 μL of T7 promoter, 10 μL of enzyme-free water, and 2 μL of 10x Taq buffer. The thermal cycling process includes: denaturation at 95°C for 5 minutes; annealing at 25°C for 60 minutes; and finally storage at 4°C.
[0034] 2-2. In vitro transcription: 4 μL of the obtained double-stranded CrRNA transcription template was added to a 30 μL in vitro transcription system and incubated overnight at 37°C to transcribe CrRNA. The in vitro transcription reaction system consisted of: 4 μL of annealing reaction product, 10 μL of NTP buffer mixture, 2 μL of T7 polymerase mixture, and 14 μL of enzyme-free water.
[0035] 2-3. CrRNA Purification: Add 20 μL of enzyme-free water and 2 μL of DNase I to the completed 30 μL transcription system, mix well, and incubate at 34°C for 5 minutes. Then transfer all the liquid to a 1.5 mL EP tube, add 100 μL of Bind solution, mix well, and let stand for 10 minutes. Next, add 150 μL of anhydrous ethanol, mix by pipetting, and transfer the mixture to a centrifuge column placed in a collection tube. After standing for 5 minutes, centrifuge at 13000 rpm for 1 minute. Add 500 μL of washing buffer, stand for 5 minutes, centrifuge at the same speed for 1 minute, and discard the eluent. Repeat the washing step once. Then, place the centrifuge column in a collection tube, centrifuge at 13000 rpm for 1 minute, and let it air dry for 5–10 minutes to remove residual ethanol. Finally, place the adsorption column in a new 1.5 mL EP tube, add 40 μL of enzyme-free water, and centrifuge at 13000 rpm for 1 minute to complete the purification.
[0036] 3. Perform monkeypox virus testing: The sample to be tested (containing monkeypox virus nucleic acid) is added to the microfluidic chamber or test tube in the CRISPR / Cas reaction unit. The U-shaped tip of the U-shaped fiber optic probe is placed in the microfluidic chamber or test tube in the CRISPR / Cas reaction unit. If the target nucleic acid is present in the sample, the CrRNA in the CRISPR / Cas reaction unit guides the Cas protein to recognize and cleave the ssDNA reporter molecule, causing ZnO@Au to detach from the fiber surface, resulting in a local change in refractive index. The whispering-gallery mode of the U-shaped probe is excited by a broadband light source, and the resonant valley shift of the output spectrum is monitored in real time using a spectrometer. Based on the quantitative relationship between the shift amount and the viral nucleic acid concentration, amplification-free and highly sensitive detection is achieved.
[0037] Example 1: Optimization of U-shaped probe structure design The U-shaped fiber optic probe is constructed by splicing two single-mode fiber segments and one coreless fiber segment. The fundamental mode propagating in the single-mode fiber core, upon entering the coreless fiber, excites multiple higher-order linear polarization modes due to the abrupt change in normalized frequency. The spliced fiber is then tapered. This tapering significantly increases the evanescent field around the fiber, improving the sensitivity of the sensing structure. Simultaneously, it reduces the fiber's bending stiffness, which is beneficial for subsequent bending processes. The tapered fiber is then bent into a U-shape to form the initial fiber optic sensing probe. Bending further increases the fiber loss, which mainly consists of bending loss and transition loss. The fiber loss under different radii of curvature is calculated as follows: Figure 3 The loss decreases exponentially with the increase of the radius of curvature.
[0038] Figure 3 Transition loss in Pure bending loss and total loss Calculate using the following equation: (1) (2) (3) in R It is the bending radius, a and V These are the radius and normalized frequency of the CLF. n 2 is the ambient refractive index, and *k* is the wave vector. C (U, W) and D (U, W) It is the transverse phase parameter U and lateral attenuation parameters W The function.
[0039] In this embodiment, a radius of curvature of 4.5 mm is chosen, which results in lower loss and a smaller fiber probe size, which is beneficial for subsequent detection. The cone angle is set to 0.078 radians, the waist diameter is set to 20 micrometers, and the optical field distribution and energy monitoring of each line-biased mode are as follows. Figure 4As shown. At this cone angle, the adiabatic condition is met, and the loss in the cone region is small. At this time, the linear polarization mode in the waist region is distorted into a whispering-gallery mode. wgm3 and wgm5 interfere with each other and output an interference spectrum. wgm directly interacts with the refractive index of the external environment. When the refractive index of the external environment changes, it will cause changes in the propagation constant and optical path of wgm, which in turn will cause changes in the phase difference of the mutual interference modes, resulting in a shift in the output spectrum.
[0040] The resonance spectrum of the U-shaped fiber optic probe in air is as follows: Figure 10 (a) Resonance spectrum in deionized water as follows Figure 10 (b) In liquid environments, the normalized frequency of the optical fiber structure decreases, and the main supported modes are WGM3 and WGM5.
[0041] The U-shaped fiber probe in this embodiment has ultra-high refractive index sensitivity. Combined with the CRISPR / Cas12a and ZnO@Au heterojunction, it can achieve amplification-free detection as low as 10 in a short time. 0 Monkeypox virus at a concentration of copies / μL can be matched to different detection bands by adjusting the AuNP coverage, and can be adapted to a variety of nucleic acid targets by changing the CrRNA, thus meeting a variety of liquid chromatography-spectroscopy detection needs.
[0042] Example 2: Optimization of ZnO@Au preparation process: Transmission electron microscopy (TEM) images of ZnO@Au prepared by sonication for 0-60 minutes are shown below. Figure 7 As ultrasound progressed, gradually denser black dots appeared on the ZnO surface. X-ray photoelectron spectroscopy (XPS) confirmed that these dots were in-situ grown AuNPs. The longer the ultrasound duration, the denser the AuNPs grew on the ZnO surface. Therefore, the duty cycle of the AuNPs on the ZnO surface could be controlled by adjusting the ultrasound duration. Controlling the duty cycle of the AuNPs on the ZnO surface allows for adjustment of the local surface plasmon resonance peak position, matching it with the 1500nm-1600nm band of the demodulated spectrum, thereby significantly improving the refractive index sensitivity of the fiber optic probe. Simultaneously, a higher duty cycle promotes electron transfer from ZnO to Au, enhancing the LSPR effect and light-matter interaction, directly improving detection sensitivity.
[0043] Based on the experimental results, the optimal ultrasonic time is 30 minutes, at which point the LSPR absorption peak matches the broadband light source used.
[0044] Example 3: Optimization of amplification-free CRISPR detection system: (1) Design of monkeypox virus CrRNA Targeting CrRNAs were designed targeting the C3L and G2R regions of Central African monkeypox virus (CMPXV) and West African monkeypox virus (WMPXV). For example... Figure 5 As shown, Figure 5(a1) The target sequence selected for the C3L region of CMPXV showed significant differences from the corresponding regions of other vaccinia viruses (including mousepox, cowpox, and camelpox viruses), demonstrating high interspecies specificity. Within the G2R region, there was a three-nucleotide difference between the target sequences of CMPXV and WMPXV; this enabled the differentiation of the two monkeypox virus lineages. However, this differential region lacked the optimal Cas12 PAM motif (TTTN); therefore, the suboptimal NTTV motif was selected. Using a suboptimal PAM might weaken the binding of the Cas protein to the target and significantly prolong detection time; to improve WMPXV detection, we designed an additional CrRNA based on the non-classical AACC PAM motif (…). Figure 5 (a2) and combined it with CrRNA designed using the NTTV motif ( Figure 5 (a3)).
[0045] (2) Optimal ratio optimization of CRISPR detection system: Based on monkeypox virus and its comparative dual-target and single-target sequences, as well as NEB buffer type, crRNA concentration, and LbCas12a protein concentration; CRISPR / Cas12a system component optimization design data charts are shown below. Figure 6 As shown; Figure 6 (b1) CRISPR fluorescence assays validated that using the two target sequences selected for WMPXV was superior to using either sequence alone. Optimization of the amplification-free CRISPR system: Figure 6 (b2) Cas12a concentration, Figure 6 (b3) Buffer type and Figure 6 (b4) CrRNA concentrations were systematically screened to establish optimal reaction conditions. CRISPR fluorescence assays confirmed that this dual CrRNA combination offered significant advantages over using either CrRNA alone.
[0046] (2.1) Optimization of reaction buffers: Liquid CRISPR fluorescence assays were performed using NEB Buffer r1.1, r2.1, r3.1, HEPES, and water as buffers. Fluorescence was read every minute in clear PCR tubes using a qPCR fluorescence analyzer at 37°C for 40 minutes. Triple replicates were performed for each buffer.
[0047] (2.2) Optimization of crRNA concentration: Water was used as a negative control, and NEB Buffer r2.1 was used as the reaction buffer to serially dilute crRNA from 400 ng / µL to 50 ng / µL. The reaction conditions and fluorescence acquisition intervals were the same as above, and each concentration gradient was repeated in triplicate.
[0048] (2.3) Optimization of LbCas12a protein concentration: Water was used as a negative control, NEB Buffer r2.1 was used as the reaction buffer, and the crRNA concentration was 100 ng / µL. LbCas12a protein was serially diluted from 10 µM to 2 µM for liquid CRISPR fluorescence assay. The reaction conditions and fluorescence acquisition intervals were the same as above, and each concentration gradient was repeated in triplicate.
[0049] (2.4) Validation of the optimal crRNA for West African monkeypox virus: Using water as a negative control, three experimental groups were set up: two crRNAs with suboptimal motif designs, and a 1:1 mixture of the two. All groups used optimized reaction systems, with a final crRNA concentration of 100 ng / µL (for the mixture, equal volumes of two 200 ng / µL crRNAs were mixed to achieve 100 ng / µL per component). Liquid CRISPR fluorescence assays were performed under the same reaction and fluorescence acquisition conditions as described above, with three replicates for each crRNA group.
[0050] The optimal ratio of the CRISPR detection system is: Cas12a protein concentration 8 µM, CrRNA concentration 100 ng / µL, and NEB Buffer r 2.1.
[0051] Example 4: Detection Process and Performance Testing Plasmid DNA containing the target sequence (concentration gradient: 10) 0 -10 5 The copy number (μL) was mixed with the CRISPR reaction system (Cas12a protein concentration 8 µM, CrRNA concentration 100 ng / µL, NEB Buffer r 2.1) and added to the microfluidic chamber or test tube of the CRISPR / Cas reaction unit. A broadband light source (1500–1600 nm) and a spectrometer were activated to record the output spectrum of the U-shaped fiber optic probe in real time. Results showed that in the presence of the monkeypox virus plasmid, the spectrum underwent a stable blue shift within 9 minutes, and the amount of blue shift was positively correlated with the target concentration, with a detection limit of 10. 0 Copy number / µL, results as follows Figure 8 Using goatpox virus, cowpox virus, and mouse poxvirus nucleic acid standards as negative controls, no significant signal changes were observed. Twenty-six qPCR-confirmed WMPXV clinical pharyngeal swab samples and ten CMPXV culture samples were tested. The qPCR sequences used are shown in SEQ ID NO: 15-18; the qPCR probe sequences used are shown in SEQ ID NO: 19-20. All positive samples showed a significant blue shift signal, while the negative controls showed no signal change, which was completely consistent with the qPCR results. Figure 9 .
[0052] All nucleic acid sequences designed in this invention are shown in the table below: Table 1. All nucleic acid sequences involved in this invention. .
Claims
1. A U-shaped optical fiber probe, characterized in that, The U-shaped optical fiber probe includes a U-shaped optical fiber substrate, which includes a U-shaped coreless optical fiber and single-mode optical fibers respectively connected to both ends of the coreless optical fiber; ZnO@Au heterojunction nanoparticles are immobilized on the surface of the coreless optical fiber by ssDNA reporter molecules. The ZnO@Au heterojunction nanoparticles have a core-shell structure, wherein the core structure is a thin sheet composed of ZnO nanoparticles and coated with Au.
2. The U-shaped fiber optic probe as described in claim 1, characterized in that, The radius of curvature of the optical fiber probe is 4mm-5mm; the duty cycle of Au particles in the ZnO@Au heterojunction nanoparticles is 20%-30%; the particle size of the ZnO nanoparticles is 10nm-20nm; and the thickness of the ZnO sheet is 40nm-60nm.
3. The U-shaped fiber optic probe as described in claim 1, characterized in that, The ssDNA reporter molecule comprises a pair of ssDNAs having the base sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2; the 5' end of the ssDNA with the base sequence shown in SEQ ID NO: 1 is modified with a carboxyl group, and the 3' end of the ssDNA with the base sequence shown in SEQ ID NO: 2 is modified with a thiol group.
4. A virus detection device based on fiber optic sensing and CRISPR / Cas, characterized in that, The virus detection device includes a broadband light source, a U-shaped fiber optic probe, a spectrometer, a CRISPR / Cas reaction unit, and a temperature control platform. The light emitted by the broadband light source is input through an optical fiber from one end of the U-shaped fiber probe as described in any one of claims 1-3, and the output light is output from the other end of the U-shaped fiber probe and enters the spectrometer. The CRISPR / Cas reaction unit is placed on a temperature control platform. During detection, the U-shaped tip of the U-shaped fiber probe is placed in the microfluidic chamber or test tube of the CRISPR / Cas reaction unit.
5. The virus detection device as described in claim 4, characterized in that, The broadband light source emits a spectrum ranging from 1520 nm to 1608 nm, the spectrometer measures from 700 nm to 1700 nm, and has a wavelength resolution of 0.05 nm. The CRISPR / Cas reaction unit includes CrRNA designed for non-conserved gene regions in the virus, Cas protein, a reaction buffer for containing the sample to be tested, and a microfluidic chamber or test tube for containing the reaction buffer.
6. The virus detection device as described in claim 4, characterized in that, The CRISPR / Cas reaction unit is a monkeypox virus CRISPR / Cas reaction unit; wherein the Cas protein is Cas12a; the CrRNA designed for the conserved gene region in monkeypox virus contains the base sequence shown in SEQ ID NO:11-13.
7. A virus detection method based on a fiber optic sensing and CRISPR / Cas virus detection device, characterized in that, Includes the following steps: S1. Fabrication and functionalization of U-shaped fiber optic probes: S1.1 Preparation of U-shaped fiber probe: Single-mode fibers are fused to both ends of a coreless fiber, the spliced fibers are tapered and bent into a U-shape and encapsulated using a mold to obtain a U-shaped fiber substrate; the U-shaped fiber substrate is immersed in piranha solution and washed with anhydrous ethanol to complete surface hydroxylation; the U-shaped fiber substrate is immersed in ATPES solution and then dried to introduce and solidify amino groups on the surface. The ssDNA with a 5' end modified with a carboxyl group, as shown in SEQ ID NO: 1, is dissolved and activated. An ssDNA solution is prepared under alkaline conditions. The U-shaped optical fiber substrate is inserted into the ssDNA solution, and the ssDNA reporter molecule is immobilized on the surface of the U-shaped optical fiber substrate to obtain a U-shaped optical fiber probe modified with ssDNA. S1.2 Preparation and functionalization of ZnO@Au heterojunction nanoparticles: ZnO nanoparticles were uniformly dispersed in an etching solution, and the mixture was irradiated with a xenon lamp. The ZnO nanoparticles etched on the surface were collected by centrifugation, redissolved, and then PVP powder and gold source were added. The mixture was then ultrasonically treated to obtain ZnO@Au heterojunction nanoparticles. The ssDNA with a 3' end modified with a thiol group, as shown in SEQ ID NO: 2, was reduced. The ZnO@Au heterojunction nanoparticles were mixed with the reduced ssDNA and reacted. The mixture was then filtered through an ultrafiltration membrane to obtain ZnO@Au heterojunction nanoparticles modified with ssDNA reporter molecules. S1.
3. Conjugate the U-shaped fiber probe with ZnO@Au: Heat the U-shaped fiber probe modified with ssDNA in Tris-HCl buffer, and then immerse it in a solution of ZnO@Au heterojunction nanoparticles modified with ssDNA reporter molecules. Design and fabrication of S2 and CRISPR / Cas reaction units: S2.1 CrRNA design of CRISPR / Cas reaction unit: CrRNA is designed based on the amplification products obtained from the conserved region of the virus to be detected. Each CrRNA consists of two parts: a backbone sequence and a spacer sequence. The reverse complementary sequence of the T7 promoter sequence is also added to the 3′ end of the designed single-stranded CrRNA template. S2.2 Preparation of the designed CrRNA: Annealing extension reaction: Using a single-stranded CrRNA template and the T7 promoter sequence as templates, a double-stranded CrRNA transcription template containing the T7 promoter sequence is generated through an annealing extension reaction; In vitro transcription: The obtained double-stranded CrRNA transcription template was added to the in vitro transcription system to transcribe CrRNA; CrRNA purification: Enzyme-free water and DNase I were added to the completed in vitro transcription system, mixed, and incubated. The entire incubation liquid was then transferred to an EP tube, Bind solution was added, and the mixture was mixed and allowed to stand. Anhydrous ethanol was added and shaken well. The resulting mixture was transferred to a centrifuge column placed in a collection tube and centrifuged. Washing buffer was added, and the mixture was centrifuged again, discarding the eluent. This process was repeated twice. The centrifuge column was then placed in a collection tube, centrifuged, and the cap was opened to allow it to air dry and remove residual ethanol. Finally, the adsorption column was placed in an EP tube, enzyme-free water was added, and the tube was centrifuged to complete the purification. S3. Virus Detection: The sample to be tested is added to the microfluidic chamber or test tube in the CRISPR / Cas reaction unit, and the U-shaped tip of the U-shaped fiber probe is placed in the microfluidic chamber or test tube in the CRISPR / Cas reaction unit. If the target nucleic acid is present in the sample, the CrRNA in the CRISPR / Cas reaction unit guides the Cas protein to recognize and cleave the ssDNA reporter molecule, causing ZnO@Au to detach from the fiber surface, resulting in a local refractive index change. The whispering-gallery mode of the U-shaped probe is excited by a broadband light source, and the resonant valley shift of the output spectrum is monitored in real time using a spectrometer. Based on the quantitative relationship between the shift amount and the viral nucleic acid concentration, amplification-free and highly sensitive detection is achieved.
8. The virus detection method as described in claim 7, characterized in that, The process of drawing the spliced optical fiber into a U-shape in step S1.1 specifically includes: placing the spliced optical fiber in an oxyhydrogen flame drawing machine to draw it into a micro-nano optical fiber with a waist diameter of 15-25 micrometers and a taper angle of 0.073-0.082 radians; bending the drawn optical fiber into a U-shape with a radius of curvature of 4-5 millimeters; and encapsulating it in a Pek mold. The specific steps for dissolving and activating the ssDNA with the base sequence shown in SEQ ID NO: 1 include preparing an ssDNA solution under alkaline conditions: adding 1.5-2.5 μL of 50 mmol EDC solution and 7.5-8.5 μL of 50 mmol NHS solution to 45-55 μL of EMS solution with a pH of 6, and reacting in the dark for 30 minutes to activate the carboxyl groups; after the reaction, adding 85-95 μL of PBS buffer with a pH of 7.8 to adjust the entire solution to an alkaline environment, finally obtaining an ssDNA solution with a concentration of 2 μmol. The centrifuge speed adjustment range in step S1.2 is 0-8000 r / min, and the centrifugation speed is 8000 rpm; the redissolved solution is a 1:1 mixture of ethanol and water; the gold source is a 1% chloroauric acid solution; the ssDNA reduction treatment of the base sequence shown in SEQ ID NO: 2 is performed using TCEP; the reaction temperature of the mixed reaction is -20℃; and the reaction time is 2 h. The heating temperature in step S1.3 is 95°C and the heating time is 3 minutes.
9. The virus detection method as described in claim 7, characterized in that, The virus to be detected is monkeypox virus, and the CRISPR / Cas reaction unit is used. The CrRNA in step S2.1 contains the base sequence shown in SEQ ID NO:11-13.
10. The virus detection method as described in claim 9, characterized in that, The specific composition of the annealing and extension reaction system described in step S2.2 includes: 3.5-4.5 μL of CrRNA single-stranded template, 3.5-4.5 μL of T7 promoter, 9.5-10.5 μL of enzyme-free water, and 1.5-2.5 μL of 10x Taq buffer; the thermal cycling process includes: denaturation at 95°C for 5 minutes; annealing at 25°C for 60 minutes; and finally storage at 4°C. The in vitro transcription reaction system comprises: 3.5-4.5 μL of annealing reaction product, 9.5-10.5 μL of NTP buffer mixture, 1.5-2.5 μL of T7 polymerase mixture, and 13.5-14.5 μL of enzyme-free water; The composition of the CrRNA purification reaction system includes: Incubation system: 25-35 μL of CrRNA transcription system, 15-25 μL of enzyme-free water, and 1.5-2.5 μL of DNase I; Mixed centrifugation system: 95-105 μL Bind solution, 145-155 μL anhydrous ethanol; Washing system: 495-505 μL of cleaning solution; Adsorption purification system: 35-45 μL of enzyme-free water; The centrifugation speed was 13,000 rpm, and the time was 1 minute.