Discrimination detection reagent, method and application of different genotypes of PRRSV based on RT-RAA combined with CRISPR / Cas12a

Abstract

The application discloses a different genotype PRRSV identification detection reagent, method and application based on RT-RAA combined with CRISPR / Cas12a, wherein the RT-RAA amplification system comprises a first primer pair like SEQ ID No:1 and SEQ ID No:2, a second primer pair like SEQ ID No:6 and SEQ ID No:7; the CRISPR / Cas12a detection system comprises a first crRNA like SEQ ID No:3 and a second crRNA like SEQ ID No:8; and the ssDNA report system is a fluorescent report probe. The application realizes rapid, sensitive, specific and low equipment-dependent field identification detection of PRRSV type 1 and type 2 based on the cascade reaction of RT-RAA and CRISPR Cas12a and the targeted selection of specific targets.

Description

Technical Field

[0001] This invention relates to the fields of molecular animal infectious diseases, veterinary virology and molecular diagnostics, and specifically to reagents, methods and applications for the identification and detection of different genotypes of PRRSV based on RT-RAA combined with CRISPR / Cas12a. Background Technology

[0002] Porcine Reproductive and Respiratory Syndrome (PRRS, commonly known as "blue ear disease") is a viral infectious disease caused by PRRSV that seriously threatens the global pig industry.

[0003] PRRSV exists in two main genotypes. PRRSV1 (European type) is prototyped with the Lelystad strain, first isolated and identified in the Netherlands in 1991 (GenBank accession number M96262). PRRSV2 (North American type) is prototyped with the VR2332 strain, isolated and identified in the United States in 1992 (GenBank accession number U87392). The two types share only 50% to 70% nucleotide homology and 50% to 60% amino acid homology, showing significant genetic differentiation. Although the two types share commonalities in genomic organization and viral particle structure, they differ fundamentally in their genetic evolutionary pathways, antigenic characteristics, and biological properties, and there is a lack of effective cross-immune protection between the two types.

[0004] In China, PRRSV2 has long been the dominant strain, and its evolution has gone through several stages. Early on, the classic strain CH1a was the representative, first isolated and identified in China in 1996, marking the formal introduction of PRRSV2 into the country. In 2006, the emergence of a highly pathogenic variant (HPPRRSV) triggered a large-scale epidemic. HPPRRSV, represented by strain JXA1, features a discontinuous deletion of 30 amino acids in the Nsp2 region, significantly enhancing pathogenicity and mortality. Subsequently, the NADC30 variant, belonging to sublineage 1.8, gradually became prevalent. This variant is characterized by a discontinuous deletion of 131 amino acids in the Nsp2 region, exhibiting stronger genetic recombination capabilities and immune evasion characteristics. In recent years, the NADC34 variant (sublineage 1.5, with a continuous deletion of 100 amino acids in the Nsp2 region) and the QYYZ variant (Lineage 3) have also been detected in multiple provinces, demonstrating the continued increase in the genetic diversity of PRRSV2.

[0005] The prevalence of PRRSV1 in China cannot be ignored. In 2011, domestic scholars first isolated and identified wild-type PRRSV1 from clinical samples, overturning the previous understanding that only PRRSV2 was prevalent in China. In the following decade, the detection rate of PRRSV1 in several densely pig-farming areas in North China, East China, and South China has shown a year-on-year upward trend, with the positive rate in some provinces rising from less than 5% initially to over 20%. Epidemiological survey data indicates that a pattern of co-prevalence of PRRSV1 and PRRSV2 has basically formed in Chinese pig farms, and mixed infection of the two types is becoming increasingly serious. Since there is no effective cross-immunity between PRRSV1 and PRRSV2, immunization with a single genotype vaccine cannot prevent infection with the other genotype, and mixed infection leads to higher clinical losses and a more complex control situation. Therefore, rapid and accurate differential diagnosis of PRRSV1 and PRRSV2 is of vital importance for epidemic prevention and control, evaluation of vaccine efficacy, and the formulation of eradication strategies.

[0006] Existing PRRSV detection technologies each have their own limitations. Virus isolation and identification (VI) is considered the gold standard, but this method is cumbersome, has high biosafety requirements, and typically takes several days to weeks from sample inoculation to identification, failing to meet the needs of rapid on-site diagnosis. Enzyme-linked immunosorbent assay (ELISA) indirectly determines the virus by detecting serum antibodies, but it suffers from an immune window period, making false negatives common in the early stages of infection. Furthermore, ELISA cannot distinguish between vaccine-immunized animals and wild-type infected animals, limiting its diagnostic value in farms with complex immunization backgrounds. Conventional reverse transcription polymerase chain reaction (RT-PCR) and real-time quantitative PCR (RT-qPCR) technologies offer high sensitivity and specificity, but both rely on sophisticated thermal cyclers to achieve temperature cycling, with each test taking 1.5 to 2 hours. They also have high requirements for power supply and equipment in the laboratory, limiting their widespread application in grassroots veterinary stations and farms.

[0007] The emergence of isothermal nucleic acid amplification technology has provided a new approach to overcome the limitations of temperature-controlled instruments. Techniques such as reverse transcription loop-mediated isothermal amplification (RTLAMP), recombinase polymerase amplification (RPA), and RT-RAA can achieve efficient amplification of target sequences under isothermal conditions, significantly simplifying instruments. However, isothermal amplification technology alone often faces the problem of false positives due to nonspecific amplification. This is caused by factors such as high primer design complexity and strong mismatch tolerance under isothermal conditions, which to some extent affects the reliability of detection results.

[0008] The appropriate selection of target genes is a core prerequisite for ensuring the accuracy of differential diagnosis. Current PRRSV detection methods mostly target the open reading frame 5 (ORF5) gene, which encodes the envelope glycoprotein GP5. This protein contains multiple neutralizing epitopes and is a key immunogen that induces the host to produce neutralizing antibodies. However, the GP5 protein is under intense immune selection pressure, and the mutation rate of its encoding gene, ORF5, is among the highest in the genome, with frequent nucleotide substitutions and amino acid variations, resulting in significant sequence differences between different subpopulations. With the emergence of novel recombinant subpopulations such as NADC30 and NADC34, detection kits targeting ORF5 face the risk of false negatives and are unsuitable as a stable and reliable diagnostic target.

[0009] In summary, the co-circulation and mixed infection of PRRSV1 and 2 in China is becoming increasingly serious, and existing detection technologies face varying degrees of technical bottlenecks in terms of speed, equipment dependence, and specificity.

[0010] Therefore, the present invention urgently needs to solve the problem of constructing a novel differential diagnostic method based on the RT-RAA and CRISPR Cas12a cascade reaction and selectively targeting specific targets to achieve rapid, sensitive, specific and equipment-independent on-site differential detection of PRRSV1 and 2. Summary of the Invention

[0011] In view of the above-mentioned prior art, the purpose of this invention is to address the technical bottlenecks in the existing PRRSV type 1 and type 2 detection technologies in terms of speed, equipment dependence, and specificity, and to provide a rapid, sensitive, specific, and equipment-independent identification detection reagent and method for different genotypes of PRRSV based on RT-RAA combined with CRISPR / Cas12a.

[0012] To achieve the above objectives, this invention provides a diagnostic reagent for different genotypes of PRRSV based on RT-RAA combined with CRISPR / Cas12a, specifically comprising an RT-RAA amplification system, a CRISPR / Cas12a detection system, and an ssDNA reporter system; wherein... The RT-RAA amplification system includes: The PRRSV 1 type RT-RAA primer pair consists of ORF6 P1 F (SEQ ID No:1, YRSAKWKTGTKTKYSYHKRSSSSSGMGWAYAY, 32nt, degenerate sequence) and ORF6 P1 R (SEQ ID No:2, ASMKCTYKTKYSSCSCMMMRCRMGRSGCTCCG, 32nt, degenerate sequence). This primer pair targets the conserved region in the middle and lower part of the PRRSV 1 type ORF6 gene, with an expected amplification product length of 160bp. The degenerate base design covers the natural variation sites between various subgroups of type 1, ensuring compatible amplification capability for different lineages such as GD2022 and GZ11-G1. The degenerate bases represent R for A / G, Y for C / T, S for G / C, W for A / T, K for G / T, M for A / C, and H for A / C / T. The PRRSV 2 type RT-RAA primer pair consists of ORF6 P2 F (SEQ ID No:6, TGCTTYTGGCGTTTTCYATYACYTACACGCCR, 32nt, degenerate sequence) and ORF6 P2 R (SEQ ID No:7, CCCATRGTRAGYGCRACYYTRTTTGTGCACTC, 32nt, degenerate sequence). This primer pair targets the conserved region in the middle and lower part of the PRRSV 2 type ORF6 gene, with an expected amplification product length of 175bp. The degenerate base design covers the variation sites between various subgroups of type 2, ensuring compatible amplification capability for different lineages such as CH-1a, JXA1, NADC30, NADC34, and QYYZ. The degenerate bases represent R for A / G, Y for C / T, M for A / C, H for A / C / T, V for A / C / G, and B for C / G / T. RT-RAA amplification premix contains Tris HCl (pH 8.0), magnesium acetate, dNTPs, ATP, creatine phosphate, creatine kinase, recombinase UvsX, accessory protein UvsY, single-strand binding protein GP32, reverse transcriptase, and a large fragment of Bsu DNA polymerase.

[0013] The CRISPR / Cas12a detection system includes: The PRRSV 1 type crRNA, with the sequence SEQ ID No:3 (UAUUUCUACUAAGUGUAGAUCGUCGUAAAGUGCUGCAGGUCUCCA, 45nt), is composed of a DR region (SEQ ID No:4, 21nt) and a Spacer region (SEQ ID No:5:CGUCGUAAAGUGCUGCAGGUCUCCA, 20nt). The Spacer region of this crRNA is completely complementary to the target sequence inside the PRRSV 1 type RT-RAA amplicon. The target region is adjacent to the 5' TTTC3' PAM site. This Spacer region has a 7-base mismatch with the corresponding region of the PRRSV 2 type template, forming a dense mismatch barrier in the Cas12a seed sequence region, completely blocking the activation ability of the type 2 amplicon. The PRRSV2 type crRNA, with the sequence SEQ ID No:8 (UAUUUCUACUAAGUGUAGAUCGACUGCUGGGGCUUUUGCACCUC), is composed of a DR region (SEQ ID No:4, 21nt) and a Spacer region (SEQ ID No:9:CGACUGCUGGGGCUUUUGCACCUC, 20nt). The Spacer region of this crRNA is completely complementary to the target sequence inside the PRRSV2 type RT-RAA amplicon. The target region is adjacent to the 5' TTTG3' PAM site. This Spacer region has 5 base mismatches with the PRRSV1 type template in the seed sequence region, which spatially hinders the R loop formation and conformational activation of Cas12a. The LbCas12a protein is derived from strain ND2006 of the Lachnospiraceae family. This protein maintains high cleavage activity in the temperature range of 37°C to 42°C, which perfectly matches the temperature range of RT-RAA amplification. The corresponding direct repeat (DR region) sequence is UAUUUCUACUAAGUGUAGAU (SEQ ID No:4, 21nt). After transcription, it forms a stable left-handed pseudoknot secondary structure, which is the conserved backbone region that the Cas12a protein recognizes and binds to. CRISPR Cas12a detection buffer containing Tris HCl (pH 7.5), NaCl, MgCl2, DTT, and BSA.

[0014] The ssDNA reporting system includes: The ssDNA fluorescent reporter probe has the sequence 5'-TTTTTT-3', with a FAM group (6-carboxyfluorescein) modified at the 5' end and a BHQ1 group (Black Hole Quencher 1) modified at the 3' end. In its intact state, the spatial distance between FAM and BHQ1 is close, and the fluorescence emitted by FAM is effectively quenched by BHQ1, resulting in extremely low background signal. When Cas12a is activated by a specific type amplicon, its non-specific single-stranded DNA trans-cleavage activity cleaves the probe, separating FAM from BHQ1 and releasing the fluorescent signal. The final concentration of the probe in the reaction system (i.e., the CRISPR Cas12a detection system) is 100 nM to 400 nM, a concentration range that ensures sufficient signal intensity while minimizing background noise.

[0015] In the RT-RAA amplification process, the RT-RAA amplification system is 20 μL to 50 μL. The optimal amounts of each component in the reaction system are as follows: Tris HCl (pH 8.0) 20 mM to 100 mM, magnesium acetate 10 mM to 20 mM, dNTPs (dATP, dTTP, dGTP, dCTP each 0.2 mM to 0.5 mM), ATP 1 mM to 5 mM, creatine phosphate 20 mM to 50 mM, creatine kinase 100 ng / μL to 300 ng / μL, recombinase UvsX 100 ng / μL to 300 ng / μL, accessory protein UvsY 30 ng / μL to 80 ng / μL, single-chain binding protein GP32 200 ng / μL to 600 ng / μL, reverse transcriptase 200 U to 500 U, and Bsu... DNA polymerase large fragment 20U to 100U, forward primer 0.3μM to 0.5μM, reverse primer 0.3μM to 0.5μM.

[0016] In the CRISPR Cas12a detection system, the contents of each component are preferably within the following ranges: Tris HCl (pH 7.5) 10mM to 50mM, NaCl 50mM to 200mM, MgCl 25mM to 15mM, DTT 1mM to 10mM, and BSA 0.05% to 0.2% (w / v).

[0017] In the CRISPR / Cas12a detection system, the final concentration of LbCas12a protein is 30 nM to 100 nM, and the molar ratio of LbCas12a protein to crRNA is 1:1 to 1:2. The protein is incubated at room temperature for 10 to 15 minutes to form a ribonucleoprotein complex.

[0018] The present invention also provides a detection method based on the above-mentioned identification reagent, which specifically includes the following steps: (a) RT-RAA isothermal amplification step: Using the nucleic acid of the sample to be tested as a template, RT-RAA isothermal amplification was performed using either PRRSV type 1 specific primer pair or PRRSV type 2 specific primer pair. The amplification temperature was 39℃ to 42℃, and the amplification time was 15 to 25 minutes. The PRRSV type 1 primer pair consisted of the forward primer shown in SEQ ID No:1 and the reverse primer shown in SEQ ID No:2, and the amplification product was 160bp. The PRRSV type 2 primer pair consisted of the forward primer shown in SEQ ID No:6 and the reverse primer shown in SEQ ID No:7, and the amplification product was 175bp. (b) CRISPR Cas12a detection system incubation steps: The amplification product obtained in step (a) is mixed with the pre-packed LbCas12a crRNA ribonucleoprotein complex and ssDNA fluorescent reporter probe, and incubated at 37°C to 39°C for 10 to 15 minutes. The PRRSV 1 type detection uses the crRNA PRRSV1 shown in SEQ ID No:3, and the PRRSV 2 type detection uses the crRNA PRRSV2 shown in SEQ ID No:8. (c) Trans-cutting activation step: In step (b), crRNA guides LbCas12a protein to specifically recognize the target double-stranded DNA sequence in the amplification product of the corresponding genotype, thereby activating the non-specific trans-cutting activity of LbCas12a protein. (d) Fluorescence monitoring and result interpretation steps: The ssDNA fluorescent reporter probe activated in step (c) in the LbCas12a protein non-specific cleavage system releases FAM fluorescent groups. The presence of PRRSV 1 or PRRSV 2 target nucleic acids in the sample is determined by real-time fluorescence detection or endpoint fluorescence interpretation. If a significant increase in fluorescence signal is detected, the corresponding genotype is judged to be positive. If no increase in fluorescence signal is detected, the corresponding genotype is judged to be negative.

[0019] In a preferred embodiment, the detection method of the present invention further adopts a single-pot, single-tube integrated detection mode, the specific operation steps of which include: A 200 μL thin-walled reaction tube was used as the reaction vessel. The bottom of the tube was pre-loaded with 20 μL of the complete RT-RAA amplification components (i.e., the RT-RAA amplification system). A 5 μL detection droplet containing LbCas12a crRNA ribonucleoprotein complex (i.e., the CRISPR / Cas12a detection system), ssDNA fluorescent reporter probe, and 10% (w / v) trehalose was attached to the inner slant edge of the tube cap. 1.25 μL of 280 mM magnesium acetate initiator solution was spotted onto the inner slant edge of the tube cap. The nucleic acid of the sample to be tested was added to the RT-RAA system at the bottom of the tube. After sealing the reaction tube, it was incubated at 39°C for 15 to 25 minutes to complete the isothermal RT-RAA amplification. The RT-RAA amplification system at the bottom of the tube underwent reverse transcription and isothermal amplification under primer-mediated conditions, producing a large amount of double-stranded DNA amplification products (at this stage, the detection droplets on the tube cap did not participate in the reaction due to physical isolation). After amplification, the reaction tube was centrifuged for 8 to 10 seconds to allow the detection droplets on the tube cap to fall to the bottom and mix with the RT-RAA amplification products (at this stage, magnesium acetate was also introduced into the reaction system to provide the necessary Mg for Cas12a). 2+ (Cofactor); after mixing, incubate at 37°C for 10 to 15 minutes. The activated Cas12a recognizes the corresponding type amplicon and initiates trans-cutting, completing the CRISPR Cas12a trans-cutting detection, and generating a fluorescence signal; the final result is interpreted by fluorescence detection.

[0020] Through the technical solution of the present invention, the identification and detection reagent of the present invention can complete the detection through the above-mentioned single-tube integrated one-pot method, and the amplification system and the detection system can achieve physical isolation and orderly connection in time and space.

[0021] It's important to note that during the identification process, the PRRSV 1-type specific primer pair and its corresponding crRNA-ribonucleoprotein complex are processed in one reaction tube, while the PRRSV 2-type specific primer pair and its corresponding crRNA-ribonucleoprotein complex are processed in another reaction tube. In other words, the specific detection of PRRSV 1 and PRRSV 2 types is not performed simultaneously in the same tube. However, the probes in both reaction tubes are identical. Therefore, in actual field testing, only two reaction tubes need to be processed simultaneously to complete the specific identification of PRRSV 1 and PRRSV 2 types in a short time, significantly improving identification efficiency.

[0022] The technical solution of this invention can be effectively applied to rapid on-site testing in farms, routine testing in primary laboratories, quarantine testing in slaughterhouses, disease prevention and control testing during live pig transportation, and epidemiological monitoring and investigation.

[0023] The detection reaction of this invention is performed in a 200 μL thin-walled reaction tube. 20 μL of RT-RAA amplification system is pre-loaded at the bottom of the tube, forming the amplification zone. 5 μL of detection solution (i.e., the CRISPR / Cas12a detection system and the ssDNA reporter system) is attached to the middle of the inner surface of the tube cap. This solution contains a pre-assembled ribonucleoprotein complex (RNP complex, i.e., a complex of Cas12a protein and its corresponding crRNA type), an ssDNA fluorescent reporter probe, and 10% (w / v) trehalose, forming the detection zone. 1.25 μL of 280 mM magnesium acetate initiator is pre-placed on the inner bevel edge of the tube cap as a transition trigger for the two-stage reaction.

[0024] The 10% trehalose added to the detection droplets serves a triple function. Its high viscosity ensures the droplets adhere firmly to the inner surface of the tube cap, preventing them from detaching during upright placement and constant-temperature incubation. Its dehydration protection properties maintain the structural stability and bioactivity of the RNP complex and probe molecules in a dry, adherent state. When the droplets are mixed with the amplification buffer at the bottom of the tube, trehalose at a final concentration below 2% (v / v) has no significant inhibitory effect on the RT-RAA polymerization reaction and does not affect amplification efficiency.

[0025] Furthermore, the entire process, from sample addition to result reading, does not require opening the reaction tube cap. The cap is immediately tightened after the amplification buffer is added to the bottom of the tube, and all subsequent operations are performed with the cap closed. This design achieves complete aerosol isolation and control at the physical level, completely eliminating the risk of cross-contamination caused by the aerosolization of amplification products and ensuring the reliability of the test results.

[0026] The technical solution of the present invention has at least the following beneficial effects: This invention designs highly specific RT-RAA isothermal amplification primer pairs and matching CRISPR / Cas12a-specific crRNA molecules targeting specific mutation regions of type 1 (European) and type 2 (North American) PRRSV strains. Using a dual-tube or single-tube multi-channel fluorescence detection system, this invention utilizes RT-RAA to rapidly reverse transcribe and amplify target nucleic acids under mild isothermal conditions of 37°C to 42°C, cascading to activate the trans-cleavage activity of the LbCas12a protein, causing the single-stranded DNA (ssDNA) fluorescent reporter probe in the system to cleave and release a FAM fluorescent signal. This method can complete the entire detection process within 30 to 45 minutes, with a detection limit of 5 to 10 copies / reaction, and 100% specificity for identifying PRRSV type 1 and type 2 strains. This invention combines high sensitivity, high specificity, and extremely simple operation, with low dependence on precision temperature control equipment, making it highly suitable for rapid on-site screening in pig farms and precise epidemiological diagnosis in veterinary clinics. Attached Figure Description

[0027] The accompanying drawings are provided to further illustrate the invention and form part of the specification. They are used together with the following detailed description to explain the invention, but do not constitute a limitation thereof. In the drawings: Figure 1 This is a schematic diagram of the homologous sequence alignment results of the PRRSV-1 and PRRSV-2 genes in Example 1 of the present invention; Figure 2 This is a report on the nucleotide sequence homology analysis of PRRSV ORF6 (M protein) in Example 1 of this invention; Figure 3 This is a schematic diagram showing the positions of the primers and probes designed and screened in Example 2 of the present invention in the nucleic acid sequence; Figure 4 This is a comparison chart of positive and negative results for PRRSV-1 and PRRSV-2 detected by this invention, wherein... Figure 4 Figure A in the diagram corresponds to the PRRSV-1 determination chart. Figure 4 Figure B in the diagram corresponds to the PRRSV-2 determination chart; Figure 5 This is a sensitivity verification result diagram in the detection example of the present invention, wherein, Figure 5 Figure A in the middle corresponds to PRRSV-1. Figure 5 Figure B in the middle corresponds to PRRSV-2; Figure 6 This is a specificity verification result diagram in an application example of the present invention, wherein, Figure 6 Figure A in the middle corresponds to Well A group. Figure 6 The middle B diagram corresponds to Well Group B. Detailed Implementation

[0028] The following provides a detailed description of specific embodiments of the present invention. It should be understood that the specific embodiments described herein are for illustrative and explanatory purposes only and are not intended to limit the scope of the invention.

[0029] This invention studies and analyzes porcine reproductive and respiratory syndrome virus (PRRSV) strains 1 and 2, selects the ORF6 gene as the target gene, and further analyzes and verifies it through Example 1. Example 1: Fine multiple sequence alignment and target region determination of the ORF6 gene

[0030] The complete ORF6 gene sequences of representative strains of PRRSV1 and PRRSV2 were downloaded from the GenBank database. Five representative strains of PRRSV1 were selected, including the prototype strain Lelystad (accession number M96262), the European field isolate HBEU328 (accession number OR636058.2), AHEU2024 2671 (accession number PQ640355.1), PRRS FR 2023 (accession number PQ572682.1), and the Asian isolate GD2023 (accession number PP556438.1). Five representative strains were also selected for the PRRSV2 genotype, including the North American prototype strain VR 2332 (accession number AY150564.1), the recently prevalent Chinese field strains JSXN2024 (accession number PQ684273.1) and HBDW2024 (accession number PQ684271.1), the highly pathogenic variant W PRRSV (accession number PX358608.1), and CHah2022 (accession number PP053521.1). The geographical origin, isolation date, and genetic characteristics of these 10 strains cover the major known genetic diversity of the two genotypes.

[0031] The downloaded ORF6 gene sequence was imported into the MegAlign module of the DNASTAR Lasergene software package, and global multiple sequence alignment was performed using the ClustalW algorithm. The gap opening penalty was set to 10, and the gap extension penalty was set to 0.2. The alignment results were further imported into MEGA 11 software for confirmatory alignment and genetic distance calculation using the p-distance model, with 1000 bootstrap repetitions. The results of independent alignments using the two software programs were cross-validated to ensure the reliability of the sequence alignment.

[0032] The homologous sequence alignment results of PRRSV-1 and PRRSV-2 genes are as follows: Figure 1 As shown in the report, the nucleotide sequence homology analysis of PRRSV ORF6 (M protein) is as follows: Figure 2 As shown in the figure. The comparison results showed that the nucleotide homology of the ORF6 gene among the five representative strains within the PRRSV1 genotype ranged from 95.8% to 98.4%, with an average homology of 97.1%; while the nucleotide homology of the ORF6 gene among the five representative strains within the PRRSV2 genotype ranged from 96.2% to 99.1%, with an average homology of 97.8%. The nucleotide homology of the ORF6 gene between the two genotypes was significantly reduced, at only 69.2%, a value far lower than the intra-genotype homology, indicating that the ORF6 gene has sufficient genetic resolution as a differential diagnostic target between genotypes.

[0033] A site-by-site variation pattern of the full-length 525 nucleotides of the ORF6 gene was visualized and analyzed, revealing that the inter-type differential sites were unevenly distributed in the gene sequence. The inter-type differential sites in the first half of the gene (nucleotides 1 to 159) were relatively sparse and had some overlapping variations; while in the middle and later parts of the gene (nucleotides 160 to 340), a large number of stable and distinguishable inter-type differential fingerprints were accumulated. The nucleotide identity between the two types in this region was further reduced to 64.7%, while the conservation within each type was maintained at over 96%. Based on the above analysis, the region from nucleotides 160 to 340 of the ORF6 gene was determined to be the optimal target region. This target region has the following three characteristics: (1) large inter-type genetic distance, which is sufficient to support high-fidelity primer and probe design; (2) high intra-type conservation, which can ensure broad-spectrum detection capability for different prevalent strains; (3) the region contains a PAM motif (TTTV, where V is A, C, or G) that can be recognized by LbCas12a, which meets the sequence prerequisite for CRISPR detection. The determination of this target region directly guided the design direction of the RT-RAA primer pair and crRNA spacer sequence in Example 2.

[0034] The phylogenetic analysis based on representative PRRSV strains worldwide showed that the ORF6 gene exhibited 95.8% to 98.4% nucleotide homology within type 1 PRRSV and 96.2% to 99.1% within type 2 PRRSV, demonstrating extremely high intratype conservation. However, the nucleotide homology of ORF6 between type 1 and type 2 was only 69.2%, indicating sufficient intertype genetic differences. Specifically, the full-length ORF6 of type 1 PRRSV is 522 nucleotides, encoding 173 amino acids; the full-length ORF6 of type 2 PRRSV is 525 nucleotides, encoding 174 amino acids. The differences between the two types of ORF6 genes stably accumulate in the later regions of the gene (nucleotides 160 to 340), which can serve as an ideal diagnostic target segment for distinguishing between type 1 and type 2, providing a reliable sequence basis for designing type-specific primers and crRNAs. Example 2: RT-RAA primer and crRNA design and screening

[0035] Based on the target region sequence determined in Example 1, primers were initially screened using Primer Premier 6.0 software. In the software parameter settings, the primer length was set to 28 to 35 nucleotides, the amplified product length to 140 to 200 base pairs, the annealing temperature to 50°C to 60°C, and the GC content to 35% to 65%. Given the degree of sequence diversity within each PRRSV1 and PRRSV2 type, a suitable amount of degenerate bases was introduced during primer design to achieve broad coverage of different prevalent strains. The use of degenerate bases followed the following principles: (1) degenerate sites were introduced only in regions other than the 3' end of the primer; (2) the degeneracy of a single primer did not exceed 16fold; and (3) the polymorphism corresponding to the degenerate site needed to be confirmed by the sequence alignment data in Example 1. Ten pairs of candidate RT-RAA primer combinations were obtained through computer screening.

[0036] Meanwhile, six candidate crRNA spacer sequences (a total of 12) were designed for each of the two target regions. The design principles included: (1) the spacer length was set to 20 to 24 nucleotides; (2) the spacer target sequence was located inside the RT-RAA amplification product; (3) the target sequence was adjacent to the PAM motif (TTTC or TTTG), and the PAM could be located on either the sense or antisense strand of the amplification product; (4) the spacer sequence was completely complementary to the corresponding type target sequence and had at least four mismatches with the other type sequence. Each candidate crRNA contained the same DR region backbone sequence UAUUUCUACUAAGUGUAGAU (SEQ ID NO.4) and a different spacer sequence.

[0037] Primer and crRNA screening was conducted in two rounds. The first round of screening evaluated the amplification efficiency of RT-RAA primers. Standard plasmids containing PRRSV1 or PRRSV2 ORF6 target sequences were used as templates, with the plasmid concentration precisely quantified to 100 copies / μL using a micro-volume UV spectrophotometer. Each candidate primer pair was isothermally amplified in a 20 μL RT-RAA reaction system at 39°C for 20 minutes. The amplification products were separated by 2% agarose gel electrophoresis at 120V for 25 minutes, and the band brightness was recorded using a gel imaging system. Only 5 primer pairs produced clearly identifiable specific amplification bands at the low template concentration of 100 copies / μL; the remaining 5 primer pairs were eliminated due to insufficient amplification efficiency or primer dimer interference.

[0038] The second round of screening evaluated the cleavage activity and type specificity of crRNA. The amplification products of the first round of selected primers were diluted 10-fold, and 2 μL of each product was incubated in Buffer C at 37°C for 15 minutes with 500 nM LbCas12a protein, 1000 nM candidate crRNA, and 200 nM ssDNA fluorescent reporter probe (5-end FAM-TTTTTT-BHQ1 3-end). The fluorescence intensity was read using the FAM channel (excitation wavelength 495 nm, emission wavelength 520 nm) of a real-time PCR instrument. Fluorescence values ​​more than 3 times higher than those of the negative control (no template amplification product) were considered positive. The screening results were evaluated for two indicators: (1) the cleavage efficiency of the corresponding type amplification product (expressed as relative fluorescence units RFU), and (2) the cross-cleavage activity for non-corresponding type amplification products.

[0039] After two rounds of screening, the following two sets of optimal primer-crRNA combinations were finally determined.

[0040] The PRRSV1 detection group uses the following primers: Forward primer ORF6 P1 F (SEQ ID No:1), sequence YRSAKWKTGTKTKYSYHKRSSSSSGMGWAYAY, 32 nucleotides in length, containing degenerate bases R, S, A, K, W, Y, H, M, and G; Reverse primer ORF6 P1 R (SEQ ID No:2), sequence ASMKCTYKTKYSSCSCMMMRCRMGRSGCTCCG, 32 nucleotides in length, containing degenerate bases S, M, K, C, T, Y, R, and G. The amplification product from this primer pair is 160 base pairs in length, covering nucleotides 168 to 327 of the PRRSV1 ORF6 gene. The accompanying crRNA is crRNA PRRSV1 (SEQ ID No:3), which is 45 nucleotides in length and has the sequence UAUUUCUACUAAGUGUAGAUCGUCGUAAAGUGCUGCAGGUCUCCA. The DR region is UAUUUCUACUAAGUGUAGAU (SEQ ID No:4), the spacer sequence is CGUCGUAAAGUGCUGCAGGUCUCCA (SEQ ID No:5), and the corresponding PAM sequence is TTTC.

[0041] The PRRSV2 detection group uses the following primers: Forward primer ORF6 P2 F (SEQ ID No: 6), sequence TGCTTYTGGCGTTTTCYATYACYTACACGCCR, 32 nucleotides in length, containing degenerate bases Y and R; Reverse primer ORF6 P2 R (SEQ ID No: 7), sequence CCCATRGTRAGYGCRACYYTRTTTGTGCACTC, 32 nucleotides in length, containing degenerate bases R, Y, S, and C. The amplification product from this primer pair is 175 base pairs in length, covering nucleotides 155 to 329 of the PRRSV2 ORF6 gene. The matching crRNA is crRNA PRRSV2 (SEQ ID No:8), which is 44 nucleotides in length and has the sequence UAUUUCUACUAAGUGUAGAUCGACUGCUGGGGCUUUUGCACCUC. The DR region is UAUUUCUACUAAGUGUAGAU (SEQ ID No:4), the spacer sequence is CGACUGCUGGGGCUUUUGCACCUC (SEQ ID No:9), and the corresponding PAM sequence is TTTG.

[0042] A schematic diagram showing the positions of the primers and probes designed for screening in the nucleic acid sequence is shown below. Figure 3 As shown, the two primer pairs selected had a sequence mismatch of more than 35% in the base arrangement of the full-length primers (over 30 nt). This mismatch level is much higher than the critical threshold for cross-annealing amplification of RT-RAA primers, thus blocking the possibility of type 1 primers amplifying type 2 templates and reverse cross-reaction from the amplification source, forming the first layer of protection for identification specificity. Example 3: Optimization of the RT-RAA-CRISPR / Cas12a two-step system

[0043] In the first step of RT-RAA optimization, the final primer concentration was fixed at 0.4 μM and the template concentration was 10 μM. 4 The reverse transcription amplification efficiency of M-MLV, AMV, SuperScript IV, and Bst 3.0 at 39℃ was tested in parallel at copies / μL. The results showed that M-MLV amplified the brightest band and had the best microRNA capture efficiency, making it the preferred reverse transcriptase. Isothermal screening was performed in a gradient from 35℃ to 45℃. The results showed that the target band had the highest grayness and the least non-specific product when reacted at 39℃ for 20 minutes. In the second step optimization of CRISPR / Cas12a, the amplification product was diluted 10-fold as substrate, and the three 10× buffer formulations were compared, confirming the presence of high salt (1M NaCl) and Mg... 2+Buffer C containing 100mM MgCl2 and BSA (0.1mg / mL) can maximize the binding of RNP to the target and induce the release of highly saturated fluorescence from the active site of RuvC, while effectively preventing the physical adsorption loss of Cas12a on the tube wall. It has been determined to be the standard buffer for the kit.

[0044] The comparison chart for determining positive and negative results is shown below. Figure 4 As shown, when the corresponding target (PRRSV-1 or PRRSV-2) is present in the sample to be tested, a corresponding fluorescence reaction will be generated; otherwise, no fluorescence reaction will occur. Example 4: Construction of a Single-Pot Integrated System

[0045] A 200 μL thin-walled PCR tube was used as the reaction vessel, and physical isolation was achieved by utilizing the spatial separation between the droplets adhering to the tube cap and the main reaction solution at the bottom of the tube. The specific construction process is as follows: In a clean PCR workbench, add 20 μL of RT-RAA premix to the bottom of a 200 μL thin-walled PCR tube. This premix contains 1×RT-RAA basal buffer, 0.4 μM forward primer (ORF6 P1 F or ORF6 P2 F), 0.4 μM reverse primer (ORF6 P1 R or ORF6 P2 R), 200 U M-MLV reverse transcriptase, 320 ng SSB, 120 ng UvsX, and 60 ng UvsY. Add 2.5 μL of the test template to the premix at the bottom of the tube and gently pipette three times to mix, avoiding the formation of air bubbles.

[0046] Add a 5 μL droplet of detection solution to the inner wall of the PCR tube cap. The detection droplet is prepared by pre-incubating 500 nM LbCas12a protein with 1000 nM of the corresponding crRNA (crRNA PRRSV1 or crRNA PRRSV2) at room temperature for 10 minutes to form a ribonucleoprotein complex (RNP). Then, add 200 nM ssDNA fluorescent reporter probe (FAM-TTTTTT-BHQ1), 1×Buffer C, and 10% (w / v) trehalose. Trehalose acts as a vitrifying agent and viscosity modifier, maintaining the droplet's shape and preventing premature dripping while it is attached to the tube cap. Carefully add the 5 μL droplet to the center of the inner wall of the PCR tube cap, avoiding contact between the droplet and the tube wall or bottom.

[0047] Add an additional 1.25 μL of 280 mM magnesium acetate solution to the edge of the PCR tube cap. This magnesium acetate solution serves as a supplementary cofactor source for the RT-RAA reaction. It does not directly participate in the amplification at the bottom of the tube during the initial stage of the reaction, but is released synchronously with the detection droplets after the centrifugation step.

[0048] After adding the samples as described above, immediately tighten the tube cap and place the PCR tube in a constant temperature incubator. Set the incubation temperature to 39°C and let the reaction stand for 20 minutes. During this stage, the RT-RAA reaction at the bottom of the tube will produce endogenous magnesium in the primers, template, recombinase, reverse transcriptase, and basal buffer. 2+ Driven by the process, isothermal amplification proceeded smoothly, and the detection droplets adhering to the tube cap did not come into contact with the amplification products due to physical isolation.

[0049] After RT-RAA amplification, remove the PCR tube from the incubator and immediately centrifuge at 3000 rpm for 8 to 10 seconds. The centrifugal force causes the 5 μL droplet of detection solution and 1.25 μL of magnesium acetate solution adhering to the tube cap to fall to the bottom of the tube, mixing thoroughly with 20 μL of RT-RAA reaction product. At this point, the total volume of the mixture is 26.25 μL. The high-salt environment (1M NaCl) of Buffer C effectively inhibits the activity of residual enzymes from the RT-RAA reaction while activating the accessory cleavage function of Cas12a. Transfer the PCR tube to a 37°C incubator and continue incubation for 15 minutes to complete the release of the CRISPR Cas12a fluorescence signal.

[0050] The optimal addition amount of trehalose was determined by gradient optimization of the concentration. Seven concentration gradients were set: 0%, 2.5%, 5%, 7.5%, 10%, 12.5%, and 15%, with six replicates for each concentration. The evaluation indicators included (1) the droplet drop rate of the cap-mounted droplet within 20 minutes of incubation at 39°C, (2) the uniformity of mixing between the droplet and the reaction liquid at the bottom of the tube after centrifugation, and (3) the final fluorescence signal-to-noise ratio. The results showed that when the trehalose concentration was below 5%, 15% to 20% of the cap-mounted droplets dropped prematurely during incubation, resulting in false negatives or reduced signal. When the trehalose concentration was above 12.5%, the droplet viscosity was too high, making it difficult to mix thoroughly with the liquid at the bottom of the tube after centrifugation, thus increasing the signal variation coefficient. The 10% trehalose concentration showed the best overall performance, with a drop rate of 0% within 20 minutes and a signal-to-noise ratio comparable to the two-step method (CV below 5%) after centrifugation and mixing.

[0051] The final composition parameters of the one-pot, single-tube integrated system are as follows: 20 μL of RT-RAA complete components including template at the bottom of the tube; 5 μL of detection droplet (containing RNP, ssDNA probe, Buffer C, and 10% trehalose) attached to the tube cap; and 1.25 μL of 280 mM magnesium acetate at the edge of the tube cap. The operating procedure is as follows: incubate at 39°C for 20 minutes, centrifuge for 8 to 10 seconds, and then incubate at 37°C for 15 minutes.

[0052] Compared with the two-step method in Example 3, this one-pot method maintains the same detection sensitivity but reduces the number of operation steps by 40% and completely eliminates the risk of aerosol contamination from opening the lid and adding samples after amplification. Detection examples and sensitivity verification

[0053] Plasmids pT PRRSV1 M containing the PRRSV1 type ORF6 target sequence and pT PRRSV2 M containing the PRRSV2 type ORF6 target sequence were used as standards. The correctness of the inserted sequences in both plasmids was verified by Sanger sequencing, and their concentrations were determined using a micro-ultraviolet spectrophotometer. Based on the plasmid molecular weight and Avogadro's constant, the plasmid concentrations were converted to copy number concentrations. The two plasmid standards were serially diluted 10-fold using TE buffer (10 mM Tris HCl, 1 mM EDTA, pH 8.0) to obtain seven concentration gradients: 10⁶ copies / μL, 10⁵ copies / μL, 10⁴ copies / μL, 10³ copies / μL, 10² copies / μL, 10¹ copies / μL, and 10⁰ copies / μL. The plasmid solutions at each concentration point were aliquoted and stored at −80°C to avoid repeated freeze-thaw cycles.

[0054] Take 2.5 μL of plasmid standards at each concentration gradient as templates and add them to PRRSV1 one-pot detection tubes (containing ORF6 P1 F / R primer pair and crRNA PRRSV1) and PRRSV2 one-pot detection tubes (containing ORF6 P2 F / R primer pair and crRNA PRRSV2), respectively. Perform 20 replicates for each concentration point. For the negative control, use 2.5 μL of nuclease solution instead of template, also with 20 replicates.

[0055] The detection tube consisted of 20 μL of the complete RT-RAA composition at the bottom (containing the corresponding primer pair, MLV reverse transcriptase, recombinase, and accessory proteins), 5 μL of detection droplet attached to the cap (containing the corresponding LbCas12a RNP, 200 nM ssDNA fluorescent reporter probe, Buffer C, and 10% trehalose), and 1.25 μL of 280 mM magnesium acetate at the edge of the cap. The reaction procedure was as follows: RT-RAA amplification was performed by incubation at 39°C for 20 minutes, followed by centrifugation at 3000 rpm for 8-10 seconds to allow the detection droplet to settle and mix, and then incubation at 37°C for 15 minutes for CRISPR fluorescence detection.

[0056] Fluorescence detection was performed using the FAM green channel (excitation wavelength 495 nm, emission wavelength 520 nm) of a quantitative real-time PCR instrument for endpoint readings. A positive result was defined as a sample fluorescence value (RFU) higher than the negative control mean plus three times the standard deviation (i.e., RFU_sample > Mean_NC + 3 × SD_NC). Probit analysis was performed on 20 repeated tests to determine the target concentration corresponding to a 95% detection rate, which was considered the limit of detection.

[0057] The test results are as follows Figure 5 As shown.

[0058] Results from the PRRSV1 detection tube (channel A) showed that all 20 replicates at six concentration gradients (10⁶ to 10¹⁰ copies / reaction) were positive, with a positivity rate of 100%. Of the 20 replicates at 10⁰ copies / reaction (i.e., 1 copy / reaction), 3 were positive, with a positivity rate of 15%. All 20 replicates in the negative control were negative, with a positivity rate of 0%. Probit analysis showed that the 95% detection limit for the PRRSV1 detection was 10 copies / reaction.

[0059] Results from the PRRSV2 detection tube (channel B) showed that all 20 replicates at six concentration gradients (10⁶ to 10¹ copies / reaction) were positive, with a positivity rate of 100%. Of the 20 replicates at 10⁰ copies / reaction, 2 were positive, with a positivity rate of 10%. All 20 replicates in the negative control were negative, with a positivity rate of 0%. Probit analysis showed that the 95% limit of detection for the PRRSV2 detection was also 10 copies / reaction.

[0060] Both types have a minimum stable detection limit (LOD) of 10 copies / reaction, meaning that when 10 or more copies of target DNA or cDNA are present in the reaction system, this kit can produce a positive detection result with a probability of no less than 95%. This sensitivity level is comparable to that of conventional quantitative PCR methods and significantly higher than that of ordinary isothermal amplification methods. Application examples

[0061] Nucleic acids of six common porcine pathogens were detected, including PRRSV type 1, PRRSV type 2, classical swine fever virus (CSFV), porcine pseudorabies virus (PRV), porcine circovirus type 2 (PCV2), and porcine epidemic diarrhea virus (PEDV). Nucleic acid content (≥10) was measured in each sample. 5 Well A and Well B (copies / μL) were added in parallel (i.e., Well A is the detection unit corresponding to PRRSV-1, with the first primer pair and amplification premix at the bottom and LbCas12a + first crRNA + FAM reporter probe at the top; Well B is the detection unit for PRRSV-2, with the second primer pair and amplification premix at the bottom and LbCas12a + second crRNA + FAM reporter probe at the top). Each sample nucleic acid was added to Well A and Well B respectively, and the identification of PRRSV-1, PRRSV-2, and mixed infections was achieved by combining the fluorescence results from the two wells). The procedure was followed as described in Example 4, and the endpoint fluorescence was detected after 35 minutes.

[0062] The test results are as follows Figure 6As shown in the figure. The results showed that Well A exhibited a 100% pure target response to PRRSV type 1, and fluorescence for all PRRSV type 2 and other pathogens was within the 900-1300 RFU background noise range, with no positive fluorescence. Well B showed strong positive fluorescence only for all PRRSV type 2 strains, and was absolutely negative for type 1 and other pathogens. Based on the dual-layered defense formed by the primer amplification barrier and the crRNA spacer recognition barrier, this method has a 100% specificity and zero cross-reactivity.

[0063] As can be seen from the above embodiments, the present invention has at least the following beneficial effects: (1) The ORF6 (M) gene was identified for the first time as the core target for dual recognition by RT-RAA and Cas12a. The M protein encoded by the ORF6 gene is the most conserved structural protein in PRRSV viral particles, with intratype homology of over 95% (95.8% to 98.4% for PRRSV1 and 96.2% to 99.1% for PRRSV2), while the intertype homology is only 69.2%, showing significant intertype differences. This target selection strategy fundamentally eliminates the risk of missing novel variants caused by target gene mutations, enabling the kit to reliably detect emerging recombinant subpopulations such as NADC30 and NADC34.

[0064] (2) The primer pair's greater than 35% sequence mismatch and multiple mismatches between crRNA spacer regions work synergistically to achieve 100% specificity. Type-specific amplification at the RT-RAA primer level constitutes the first specificity barrier, while type-specific recognition of the Cas12acrRNA seed sequence region constitutes the second specificity barrier. This dual protection mechanism ensures accurate differentiation between PRRSV types 1 and 2. Systematic verification showed that this kit had 0% cross-reactivity with more than ten common porcine pathogens, including Classical Swine Fever Virus (CSFV), Pseudorabies Virus (PRV), Porcine Circovirus Type 2 / 3 (PCV2 / 3), and Porcine Epidemic Diarrhea Virus (PEDV), with no false positives detected.

[0065] (3) The entire detection process is completed under constant temperature conditions of 37℃ to 42℃, and the total reaction time does not exceed 45 minutes (RT-RAA amplification 20 minutes, Cas12a cutting 10 to 15 minutes, centrifugation mixing 8 to 10 seconds). Compared with the RT qPCR method, the detection time is shortened by more than 60%, and it completely eliminates the dependence on thermal cyclers. Only a conventional water bath or portable constant temperature metal bath is needed to complete the detection, which greatly reduces the equipment threshold and detection cost.

[0066] (4) The single-pot, single-tube design eliminates aerosol contamination. The amplification and detection reactions are completed in stages within the same tube, eliminating the need to open the lid throughout the process and physically removing the risk of false positives caused by the aerosolization of amplification products. This design is particularly suitable for rapid on-site screening scenarios in grassroots veterinary stations and farms, effectively ensuring the biosafety of the testing environment.

[0067] (5) The detection sensitivity reaches 10 copies / reaction. The exponential amplification efficiency of RT-RAA technology combined with the signal cascade amplification effect of Cas12a makes the detection limit of this kit as low as 10 copies / reaction. The sensitivity is comparable to or even better than that of some commercial kits for RT qPCR, meeting the detection requirements of low viral load in clinical samples.

[0068] (6) The kit of the present invention is easy to operate and the interpretation is intuitive. After the reaction is completed, the fluorescence signal can be read by a portable fluorescence detector, or the fluorescence can be observed with the naked eye in a dark room with the help of an ultraviolet flashlight. The detection results are interpreted by fluorescence value or the presence or absence of visible fluorescence, without the need for complicated curve analysis or threshold setting, and the professional requirements of the operator are low.

[0069] (7) This invention has important application value in the fields of PRRSV epidemiological investigation and entry-exit quarantine. The portability, speed and high specificity of the kit make it particularly suitable for large-scale sample screening, on-site diagnosis in epidemic areas and port quarantine, and can provide reliable technical support for the precise prevention and control and purification of PRRSV.

[0070] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

[0071] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not describe the various possible combinations separately.

[0072] Furthermore, various different embodiments of the present invention can be combined in any way, as long as they do not violate the spirit of the present invention, they should also be regarded as the content disclosed by the present invention.

Claims

1. A diagnostic reagent for different genotypes of PRRSV based on RT-RAA combined with CRISPR / Cas12a, characterized in that, The identification and detection reagents include an RT-RAA amplification system, a CRISPR / Cas12a detection system, and an ssDNA reporter system; wherein... The RT-RAA amplification system includes at least a first primer pair as shown in SEQ ID No:1 and SEQ ID No:2, and a second primer pair as shown in SEQ ID No:6 and SEQ ID No:7; The CRISPR / Cas12a detection system includes at least a first crRNA, as shown in SEQ ID No:3, corresponding to the first primer pair, and a second crRNA, as shown in SEQ ID No:8, corresponding to the second primer pair; The ssDNA reporter system is a fluorescent reporter probe.

2. The identification and detection reagent according to claim 1, characterized in that, In the RT-RAA amplification system, the concentration of each primer is 0.3-0.5 μM.

3. The identification and detection reagent according to claim 1 or 2, characterized in that, The LbCas12a protein in the CRISPR / Cas12a detection system is derived from strain ND2006 of the Trichophyceae family. Preferably, in the CRISPR / Cas12a detection system, the content of the LbCas12a protein is 30 nM to 100 nM; And / or, the molar ratio of the LbCas12a protein to crRNA is 1:1-2.

4. The identification and detection reagent according to claim 1 or 2, characterized in that, The ssDNA reporter system is an ssDNA fluorescent reporter probe, and the nucleotide sequence of the ssDNA fluorescent reporter probe is 5'-TTTTTT-3'.

5. The identification and detection reagent according to claim 4, characterized in that, The ssDNA fluorescent reporter probe is modified with a FAM group at its 5' end and a BHQ1 group at its 3' end. Preferably, in the identification and detection reagent, the content of the ssDNA fluorescent reporter probe is 100nM-400nM.

6. The identification and detection reagent according to claim 1 or 2, characterized in that, The RT-RAA amplification system further includes an amplification premix, and the CRISPR / Cas12a detection system further includes a detection buffer; wherein... The amplification premix includes Tris HCl, magnesium acetate, dNTPs, ATP, creatine phosphate, creatine kinase, recombinase UvsX, accessory protein UvsY, single-strand binding protein GP32, reverse transcriptase, and a large fragment of Bsu DNA polymerase. The detection buffer solution includes Tris HCl, NaCl, MgCl2, DTT, and BSA.

7. The application of the identification reagent as described in any one of claims 1-6 in the preparation of diagnostic products for different genotypes of PRRSV.

8. A method for differentiating and detecting different genotypes of PRRSV for non-disease diagnostic purposes, characterized in that, The identification and detection method uses the identification and detection reagent as described in any one of claims 1-6.

9. The identification and detection method according to claim 8, characterized in that, The identification and detection method includes: S100. Using the nucleic acid of the sample to be tested as a template, amplification is performed using the RT-RAA amplification system to obtain the amplification product; S200. The obtained amplification product is mixed with the CRISPR / Cas12a detection system and the ssDNA reporter system and then incubated to activate the non-specific trans-cleavage activity of LbCas12a protein. S300, the activated LbCas12a protein nonspecific cleavage system contains ssDNA fluorescent reporter probes, which release FAM fluorescent groups, and determine the presence of PRRSV-1 or PRRSV-2 target nucleic acids in the sample by real-time fluorescence detection or endpoint fluorescence interpretation.

10. The identification and detection method according to claim 9, characterized in that, Between steps S100 and S200, magnesium acetate initiator solution is added; Preferably, the RT-RAA amplification system and the CRISPR / Cas12a detection system are placed in the same reaction vessel, with the RT-RAA amplification system placed at the bottom of the reaction vessel, the CRISPR / Cas12a detection system attached to the inner wall of the reaction vessel, and the magnesium acetate initiator solution pre-placed in the reaction vessel. More preferably, the CRISPR / Cas12a detection system also contains trehalose.

Images