Protective agents, kits containing same and uses thereof
Patent Information
- Application Number
- CN202611103001.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-07-23
- Publication Date
- 2026-08-21
AI Technical Summary
这就需要大量辅助干燥设备长时间运行,对于能源的消耗巨大
Smart Images

Figure CN122609759A_ABST
Abstract
Description
Technical Field
[0001] This application belongs to the field of biotechnology, and in particular relates to a protective agent, a reagent kit containing the same, and their applications. Background Technology
[0002] Common PCR reagent lyophilization techniques can meet the requirements for room temperature storage and transportation. However, the lyophilization process requires a specialized vacuum freeze dryer, and the lyophilization program needs to be repeatedly adjusted according to the temperature and humidity of the site. Furthermore, commonly used lyophilization programs need to run for over ten hours, during which the humidity of the entire site must be maintained at 20% or even lower. This necessitates the long-term operation of numerous auxiliary drying devices, resulting in significant energy consumption. Moreover, common lyophilized products are often lyophilized bulbs or powders; transferring them into microfluidic chips for on-site testing is another step with very high requirements for environmental conditions and operator skills. Traditional PCR reagents based on lyophilization technology include CN116875709A, CN116904446A, CN116904450A, CN116904617A, CN116904618A, CN116904619A, CN116904631A, CN116904651A, CN116904655A, CN116904658A, CN117305297A, CN117305479A, CN117305515A, and CN113049839A.
[0003] In view of the above, this application is hereby submitted. Summary of the Invention
[0004] Based on this, one or more embodiments of this application provide a protective agent, a reagent kit containing the same, and its application. The technical solutions include the following:
[0005] One or more embodiments of this application provide a protective agent comprising bovine serum albumin, trehalose, pullulan, defoamer SE-15, and DL-dithiothreitol in a mass ratio of (30mg-50mg): (11g-15g): (0.7g-1g): (0.03mL-0.045mL): (0.5mmol-2mmol).
[0006] In some embodiments of this application, the protective agent comprises bovine serum albumin, trehalose, pullulan, defoamer SE-15, and DL-dithiothreitol in a mass ratio of (35mg-45mg): (11g-13g): (0.75g-0.85g): (0.03mL-0.04mL): (0.8mmol-1.2mmol).
[0007] One or more embodiments of this application provide a kit, the kit comprising a protective agent and PCR amplification reagents;
[0008] Based on the total volume of the PCR reaction system containing the protective agent and the PCR amplification reagent, each 100 mL of the PCR reaction system includes 30 mg to 50 mg bovine serum albumin, 11 g to 15 g trehalose, 0.7 g to 1 g pullulan, 0.03 mL to 0.045 mL of defoamer SE-15, and 0.5 mmol to 2 mmol DL-dithiothreitol.
[0009] In some embodiments of this application, each 100 mL of the PCR reaction system includes 35 mg to 45 mg bovine serum albumin, 11 g to 13 g trehalose, 0.75 g to 0.85 g pullulan, 0.03 mL to 0.04 mL defoamer SE-15, and 0.8 mmol to 1.2 mmol DL-dithiothreitol.
[0010] In some embodiments of this application, the protective agent and the PCR amplification reagent are sealed in a microfluidic chip.
[0011] In some embodiments of this application, the PCR amplification reagent includes one or more of the following: PCR reaction buffer, DNA polymerase, dNTPs, upstream primer for target amplification, downstream primer for target amplification, and target detection probe.
[0012] In some embodiments of this application, the PCR reaction system includes 18% to 22% by volume of the PCR reaction buffer, 1 U / μL to 1.5 U / μL of the DNA polymerase, 0.7 mM to 0.9 mM of the dNTPs, 1.5 μM to 1.8 μM of the upstream primer for target amplification, 1.5 μM to 1.8 μM of the downstream primer for target amplification, and / or 0.3 μM to 0.5 μM of the target detection probe.
[0013] In some embodiments of this application, the kit is an African swine fever virus nucleic acid detection kit.
[0014] In some embodiments of this application, the sequence of the upstream primer for target amplification is shown in SEQ ID NO.1, the sequence of the downstream primer for target amplification is shown in SEQ ID NO.2, and the sequence of the target detection probe is shown in SEQ ID NO.3.
[0015] In some embodiments of this application, the water content of the protective agent and PCR amplification reagent encapsulated in the microfluidic chip does not exceed 10%.
[0016] In some embodiments of this application, the kit further includes a positive control; optionally, the positive control includes a plasmid containing the target.
[0017] One or more embodiments of this application provide a method for preparing the kit, the method comprising loading the protective agent and the PCR amplification reagent into the microfluidic chip, removing the solvent, and sealing.
[0018] In some embodiments of this application, the method for removing the solvent includes air drying.
[0019] In some embodiments of this application, the air-drying conditions include: 75°C to 85°C for 15 min to 25 min.
[0020] One or more embodiments of this application also provide a method for detecting nucleic acid samples, the method including the step of amplification using the kit described above.
[0021] In some embodiments of this application, the amplification procedure includes: 94.5℃~95.5℃ for 2.8min~3.2min; 94.5℃~95.5℃ for 8s~12s; 55℃~65℃ for 30s~60s; 35~45 cycles.
[0022] Details of one or more embodiments of this application are set forth in the following description, and other features, objects, and advantages of this application will become apparent from the specification and its claims. Attached Figure Description
[0023] To more clearly illustrate the technical solutions in the embodiments of this application and to more completely understand this application and its beneficial effects, the drawings used in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0024] Figure 1 This is a standard curve graph of the reagent kit in Example 1.
[0025] Figures 2 to 31 The image shows the test results of the experimental group and the control group in Example 1.
[0026] Figure 32 Refer to the corresponding test result chart for negative and positive results. Detailed Implementation
[0027] The present application will be further described in detail below with reference to the accompanying drawings, embodiments, and examples. It should be understood that these embodiments and examples are for illustrative purposes only and are not intended to limit the scope of the present application. The purpose of providing these embodiments and examples is to enable a more thorough and comprehensive understanding of the disclosure of the present application. It should also be understood that the present application can be implemented in many different forms and is not limited to the embodiments and examples described herein. Those skilled in the art can make various modifications or alterations without departing from the spirit of the present application, and the equivalent forms obtained also fall within the protection scope of the present application. Furthermore, numerous specific details are set forth in the following description to provide a fuller understanding of the present application. It should be understood that the present application can be implemented without one or more of these details.
[0028] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used herein in the specification of this application is for descriptive purposes only and is not intended to be limiting of the application.
[0029] Unless otherwise stated or in case of contradiction, the terms or phrases used herein shall have the following meanings:
[0030] The terms "and / or," "or / and," and "and / or" as used herein include any one of two or more of the related listed items, as well as any and all combinations of the related listed items. These arbitrary and all combinations include any two related listed items, any more related listed items, or a combination of all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or," "or / and," and "and / or," it should be understood that in this application, the technical solution undoubtedly includes technical solutions connected by "logical AND," and also undoubtedly includes technical solutions connected by "logical OR." For example, "A and / or B" includes three parallel solutions: A, B, and A+B. For example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (that is, a technical solution that is connected by "logical OR"), as well as any and all combinations of A, B, C, and D, that is, combinations of any two or three of A, B, C, and D, and also combinations of all four of A, B, C, and D (that is, a technical solution that is connected by "logical AND").
[0031] In this application, the terms "multiple", "various", "multiple times", "multi-dimensional", etc., unless otherwise specified, refer to a quantity greater than or equal to 2. For example, "one or more" means one or more than or equal to two.
[0032] The terms “combinations of,” “any combination of,” and “any combination of” used in this article include all suitable combinations of any two or more of the listed items.
[0033] In this document, the term "suitable" as used in phrases such as "suitable combination," "suitable method," and "any suitable method" refers to the ability to implement the technical solution of this application, solve the technical problem of this application, and achieve the expected technical effect of this application.
[0034] In this document, terms such as “preferred,” “better,” “more suitable,” and “ideal” are merely used to describe implementation methods or examples that achieve better results, and should be understood not to limit the scope of protection of this application.
[0035] In this application, terms such as "further," "even further," and "particularly" are used to describe purposes and indicate differences in content, but should not be construed as limiting the scope of protection of this application.
[0036] In this application, "optionally," "optionally," and "optional" mean that something is optional, that is, it means that it is selected from either "with" or "without." If there are multiple "optional" entries in a technical solution, unless otherwise specified, and there are no contradictions or mutual constraints, each "optional" entry shall be independent.
[0037] In this application, the terms "first aspect," "second aspect," "third aspect," "fourth aspect," etc., are used for descriptive purposes only and should not be construed as indicating or implying relative importance or quantity, nor should they be construed as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first," "second," "third," "fourth," etc., serve only as a non-exhaustive enumeration and should be understood not to constitute a closed limitation on quantity.
[0038] In this application, the technical features described in an open-ended manner include both closed technical solutions consisting of the listed features and open technical solutions that include the listed features.
[0039] In this application, numerical intervals (i.e., numerical ranges) are involved. Unless otherwise specified, the selected numerical distributions within the aforementioned numerical intervals are considered continuous and include the two endpoints (i.e., the minimum and maximum values) of the numerical range, as well as every value between these two endpoints. Unless otherwise specified, when a numerical interval refers only to integers within that interval, it includes the two endpoint integers of the numerical range, as well as every integer between the two endpoints. In this document, this is equivalent to directly listing every integer. For example, if t is an integer selected from 1 to 10, it means that t is any integer selected from the group of integers consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. Furthermore, when multiple ranges are provided to describe features or characteristics, these ranges can be merged. In other words, unless otherwise specified, the ranges disclosed herein should be understood to include any and all subranges to which they are included.
[0040] Unless otherwise specified, the temperature parameters in this application are permitted to be either constant-temperature treatment or variations within a certain temperature range. It should be understood that the constant-temperature treatment allows temperature fluctuations within the precision range of the instrument control, such as ±5℃, ±4℃, ±3℃, ±2℃, or ±1℃.
[0041] In this application, %(w / w) and wt% both represent weight percentage, %(v / v) refers to volume percentage, and %(w / v) refers to mass-volume percentage.
[0042] All references to this application are incorporated herein by reference as if each document were individually incorporated herein by reference. Unless they conflict with the purpose and / or technical solution of this application, all cited references are incorporated herein by reference in their entirety and for all purposes. When references are cited in this application, the definitions of relevant technical features, terms, nouns, phrases, etc., are also incorporated herein by reference. Examples and preferred embodiments of the cited technical features may also be incorporated herein by reference, but only to the extent that they enable the implementation of this application. It should be understood that when the cited content conflicts with the description in this application, this application shall prevail or modifications shall be made adaptably to the description in this application.
[0043] African swine fever (ASF) is an acute, hemorrhagic, and highly contagious disease of domestic and wild pigs caused by the African swine fever virus. All breeds and ages of pigs can be infected. The disease has a short course, with a pre-acute and acute mortality rate as high as 100%. Once an ASF outbreak occurs, all pigs within a 5-kilometer radius of the outbreak site must be culled and then disposed of in a safe manner. Farms must undergo multiple rounds of disinfection and testing before resuming operations. Therefore, it is evident that ASF outbreaks can cause devastating economic losses to pig farmers.
[0044] Currently, there are no effective drugs for treating African swine fever (ASF), nor are there effective inactivated or attenuated vaccines or immunoprotective agents. Therefore, detection technology is the most effective method for monitoring and controlling ASF outbreaks. Although the PCR method, considered the "gold standard" for pathogen detection, has been widely used in ASF virus detection, the traditional method of collecting samples and conducting batch testing in specialized laboratories cannot meet the multi-dimensional monitoring needs of ASF prevention and control, which includes monitoring the farm environment, feed, and transportation.
[0045] Therefore, this application aims to develop a method for directly air-drying PCR reagents inside a microfluidic chip, replacing the complex freeze-drying process with air-drying. By optimizing the PCR reaction system and adding a special drying protectant, the reagent curing process can be completed within 2 hours. Directly curing the reagents inside the reaction chamber of the microfluidic chip reduces the possibility of moisture absorption by the reagents during subsequent operations.
[0046] Using air-drying to dry PCR reagents avoids various complexities associated with freeze-drying while maintaining reagent performance. For example, it eliminates the need for liquid nitrogen molding, reducing energy waste and saving time; it avoids the use of expensive and complex vacuum freeze dryers, lowering costs; and it eliminates the need for a lengthy freeze-drying process, saving time and reducing energy consumption. Reagents can be directly solidified into the chip, reducing the need for secondary transfer after freeze-drying, saving time, and minimizing the possibility of reagent moisture absorption. Microfluidic chips fabricated using air-drying can be stored and transported at room temperature with a shelf life of over 6 months. This allows for on-site nucleic acid testing for African swine fever virus, significantly improving testing efficiency and greatly reducing economic losses caused by African swine fever virus infection.
[0047] A first aspect of this application provides a protective agent comprising bovine serum albumin, trehalose, pullulan, defoamer SE-15, and DL-dithiothreitol in a mass ratio of (30mg-50mg):(11g-15g):(0.7g-1g):(0.03mL-0.045mL):(0.5mmol-2mmol).
[0048] The protective agent provided in this application embodiment has components in the same proportions used during operation. This protective agent can be a ready-to-use reagent or a pre-mixed formulation that can be added directly. For ready-to-use protective agents, each component can be individually packaged, or partially individually packaged, and can be mixed according to the specified proportions during use.
[0049] In some embodiments, the protective agent comprises bovine serum albumin, trehalose, pullulan, defoamer SE-15, and DL-dithiothreitol in a mass ratio of (35 mg to 45 mg): (11 g to 13 g): (0.75 g to 0.85 g): (0.03 mL to 0.04 mL): (0.8 mmol to 1.2 mmol).
[0050] A second aspect of this application provides a kit, the kit comprising a protective agent and PCR amplification reagents;
[0051] Based on the total volume of the PCR reaction system containing the protective agent and the PCR amplification reagent, each 100 mL of the PCR reaction system includes 30 mg to 50 mg bovine serum albumin, 11 g to 15 g trehalose, 0.7 g to 1 g pullulan, 0.03 mL to 0.045 mL defoamer SE-15, and 0.5 mmol to 2 mmol DL-dithiothreitol.
[0052] The kits provided in this application can be ready-to-use kits, where the protective agent and PCR amplification reagent are packaged separately and added according to the concentration during use; or they can be ready-to-use kits, where the protective agent and PCR amplification reagent are pre-mixed and can be used directly.
[0053] In the kit provided in this application embodiment, the bovine serum albumin content per 100 mL of the PCR reaction system is, for example, 30 mg, 32 mg, 34 mg, 36 mg, 38 mg, 40 mg, 42 mg, 44 mg, 46 mg, 48 mg, or 50 mg; the trehalose content is, for example, 11 g, 11.5 g, 12 g, 12.5 g, 13 g, 13.5 g, 14 g, 14.5 g, or 15 g; and the pullulan content is, for example, 0.7 g, 0 g. 0.75g, 0.8g, 0.85g, 0.9g, 0.95g, 1g; defoamer SE-15, for example, 0.03mL, 0.031mL, 0.033mL, 0.035mL, 0.037mL, 0.039mL, 0.041mL, 0.043mL, 0.045mL; DL-dithiothreitol, for example, 0.5mmol, 0.6mmol, 0.7mmol, 0.8mmol, 0.9mmol, 1mmol, 1.1mmol, 1.2mmol, 1.3mmol, 1.4mmol, 1.5mmol, 1.6mmol, 1.7mmol, 1.8mmol, 1.9mmol, 2mmol.
[0054] In some embodiments, each 100 mL of the PCR reaction system includes 35 mg to 45 mg bovine serum albumin, 11 g to 13 g trehalose, 0.75 g to 0.85 g pullulan, 0.03 mL to 0.04 mL of defoamer SE-15, and 0.8 mmol to 1.2 mmol DL-dithiothreitol.
[0055] In some embodiments, the protective agent and the PCR amplification reagent are sealed within a microfluidic chip. This application does not specifically limit the microfluidic chip, including but not limited to those from Beijing Zhongke Shengyi Technology Co., Ltd. Different chips require slightly different drying conditions due to their different structures. After drying, the water loss rate is measured by weighing; a water loss rate greater than 90% is acceptable. The microfluidic chip in this application can be prefabricated.
[0056] In some embodiments, the PCR amplification reagent includes one or more of the following: PCR reaction buffer, DNA polymerase, dNTPs, upstream primer for target amplification, downstream primer for target amplification, and target detection probe. Optionally, the PCR amplification reagent includes all the components required for PCR amplification. In some embodiments, the PCR reaction system includes 18%–22% by volume of the PCR reaction buffer, 1 U / μL–1.5 U / μL of the DNA polymerase, 0.7 mM–0.9 mM of the dNTPs, 1.5 μM–1.8 μM of the upstream primer for target amplification, 1.5 μM–1.8 μM of the downstream primer for target amplification, and / or 0.3 μM–0.5 μM of the target detection probe. In this embodiment of the application, the PCR reaction system contains, for example, PCR reaction buffers of 18%, 18.5%, 19%, 19.5%, 20%, 20.5%, 21%, 21.5%, and 22%; DNA polymerase of 1, 1.1, 1.2, 1.3, 1.4, and 1.5 U / μL; dNTPs of 0.7, 0.75, 0.8, 0.85, and 0.9 mM; and target... For example, the upstream primers for amplification are 1.5, 1.55, 1.6, 1.65, 1.7, 1.75, and 1.8 μM; the downstream primers for target amplification are 1.5, 1.55, 1.6, 1.65, 1.7, 1.75, and 1.8 μM; and the target detection probes are 0.3, 0.32, 0.34, 0.36, 0.38, 0.4, 0.42, 0.44, 0.46, 0.48, and 0.5 μM.
[0057] In some implementations, the kit is an African swine fever virus nucleic acid detection kit.
[0058] In some embodiments, the sequence of the upstream primer for target amplification is shown in SEQ ID NO.1, the sequence of the downstream primer for target amplification is shown in SEQ ID NO.2, and the sequence of the target detection probe is shown in SEQ ID NO.3.
[0059] In some embodiments, the water content of the protective agent and PCR amplification reagent encapsulated in the microfluidic chip does not exceed 10%, for example, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%.
[0060] In some embodiments, the kit further includes a positive control; optionally, the positive control includes a plasmid containing the target.
[0061] In some implementations, the kit also includes negative controls, including but not limited to water or TE buffer.
[0062] A third aspect of this application provides a method for preparing the kit, the method comprising loading the protective agent and the PCR amplification reagent into the microfluidic chip, removing the solvent, and sealing.
[0063] In some embodiments, the solvent removal method includes air drying. Optionally, the air drying conditions include: 75°C to 85°C (e.g., 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85°C) for 15 min to 25 min (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 min).
[0064] A fourth aspect of this application provides a method for detecting nucleic acid samples, the method comprising the step of amplification using the aforementioned kit.
[0065] In some embodiments of this application, the amplification procedure includes: 94.5℃~95.5℃ (e.g., 94.5, 94.6, 94.7, 94.8, 94.9, 95, 95.1, 95.2, 95.3, 95.4, 95.5℃) for 2.8 min~3.2 min (e.g., 2.8, 2.9, 3, 3.1, 3.2 min); 94.5℃~95.5℃ (e.g., 94.5, 94.6, 94.7, 94.8, 94.9, 95, 95.1, 95.2, 95.3, 95.4, 95.5℃). Cycle for 8s to 12s (e.g., 8, 8.5, 9, 9.5, 10, 10.5, 11, 11.5, 12s), 55℃ to 65℃ (e.g., 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65℃), 30s to 60s (e.g., 30, 35, 40, 45, 50, 55, 60s), 35 to 45 cycles (e.g., 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45 cycles).
[0066] The embodiments of this application will be described in detail below with reference to examples. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of this application. For experimental methods in the following embodiments where specific conditions are not specified, please refer to the guidelines given in this application, or follow experimental manuals or conventional conditions in the art, or follow the conditions recommended by the manufacturer, or refer to experimental methods known in the art.
[0067] In the specific embodiments described below, the measurement parameters involving raw material components may have slight deviations within the weighing accuracy range unless otherwise specified. Temperature and time parameters are subject to acceptable deviations due to instrument testing accuracy or operational precision.
[0068] Example 1
[0069] 1. Reagent kit
[0070] This application provides an African swine fever virus nucleic acid detection kit. The kit includes a protective agent and PCR amplification reagents, which together form a PCR amplification system.
[0071] Specifically, the PCR amplification reagents include: upstream and downstream primers for specific detection of African swine fever virus, fluorescent probes, DNA polymerase, dNTPs (deoxyribonucleoside triphosphates), PCR reaction buffer, drying protectant, and water; among which...
[0072] The sequence of upstream primer F is SEQ ID NO.1: 5'-CYTCGGCGAGCGCTTTATCAC-3';
[0073] The sequence of the downstream primer R is SEQ ID NO.2: 5'-GGAAAYTCATTCACCAAATCCTT-3';
[0074] The sequence of the fluorescent probe P is SEQ ID NO.3: 5'-CGATGCAAGCTTTAT-3';
[0075] In the upstream and downstream primers, Y represents the degenerate base C or T, the 5' end of the fluorescent probe is FAM, and the 3' end is the non-autofluorescent quencher NFQ;
[0076] The main components of the PCR reaction buffer were 0.4M Tris-HCl (tris(hydroxymethyl)aminomethane) hydrochloride, 55mM MgCl2, 1M KCl, 1% Tween-20 (polyoxyethylene sorbitan monolaurate), and water, with a pH of 9.06-9.1.
[0077] The protective agents are BSA (bovine serum albumin), trehalose, pullulan, defoamer SE-15, and DTT (DL-dithiothreitol).
[0078] The components and amounts of the PCR amplification system containing PCR amplification reagents and protective agents are shown in the table below.
[0079] Table 1
[0080]
[0081] The PCR amplification system configured as shown in the table above is a 4× system. Aliquot the prepared system into microfluidic chips, with each chip containing one-quarter of the reaction chamber volume. The PCR reaction chamber used in this application has a volume of 50 μL; therefore, each chip should contain 12.5 μL of the above system.
[0082] The chips containing the PCR amplification system were dried using a forced-air drying oven. The drying conditions used in this embodiment were: 80°C for 20 minutes.
[0083] After air drying, the water loss rate is tested by weighing. The water loss rate is required to be greater than 90%. After air drying, the microfluidic chip is sealed and combined with the reagent chamber containing purification reagents for later use.
[0084] 2. Sensitivity testing of the reagent kit
[0085] The African swine fever virus positive control sample (containing the pUC57 plasmid of the target fragment shown in SEQ ID NO.4) was serially diluted, with each gradient differing by a factor of 10, resulting in a final concentration of 10. 6 copies / μL, 10 5copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10copies / μL, 1copies / μL.
[0086] SEQ ID NO.4:
[0087] ATCAGCGAAAAGCGAACGCGTTTTACAAAAAGGTTGTGTATTTCAGGGGTTACAAACAGGTTATTGATGTAAAGTTCATTATTCGTGAGCGAGATTTCATTAATGACTCCTGGGATAAACCATGGTTTTAAAGCGTATATTGCGTCTACTGGGGCGTCCAGCTATAAAACGTGACTGGCGTACAAAAAGTCCAGGAAATTCATTCACCAAATCCTTTTTGCGATGCAAGCTTTATGGTGATAAAGCG CTCGCCGAAGGGAATGGATACTGAGGGAATAGCAAGGTTTCACGTTCTCATTAAACCAAAAGCGCAACTTAATCCAGAGCGCAAGAGGGGGCTGATAGTATTTAGGGGTTTGAGGTCCATTACAGCTGTAATGAACATTACGTCTTATGTCCAGATACGTTGCGTCCGTGATAGGAGTAATATCTTGTTTACCTGCTGTTTGGATATTGTGAGAGTTCTCGGGAAAATGCTGTGAAAGAAATTTCG.
[0088] The negative control sample is water.
[0089] For the kit provided in section 1, add 50 μL of each diluted quality control sample to the PCR reaction chamber of the microfluidic chip to prepare the PCR reaction system. Repeat each concentration three times. The PCR reaction temperature control program is shown in the table below.
[0090] Table 2. Temperature Control Program
[0091]
[0092] The results are as follows Figure 1 As shown: Calculated using the standard curve, the R² of this kit is 99.87%, and the amplification efficiency is 102.21%. The detection sensitivity of this kit is 500 copies.
[0093] 3. Shelf-life stability test of the reagent kit
[0094] The kits prepared under section 1 were stored at 18°C–22°C for 1 month and 3 months, and then tested at designated points throughout the study period. Additionally, this application designed an accelerated aging experiment, using the Arrhenius equation provided by the DNA polymerase raw material manufacturer, to evaluate the performance of the kits under normal storage conditions for 6 months by placing them at 37°C for 28 days.
[0095] 3.1 Accuracy and Precision
[0096] The precision and accuracy of the kit were evaluated. Using the aforementioned positive control sample from the manufacturer, the solution was diluted to 1000 copies / μL, and 50 μL was added to the sample compartment. The compartment cap was tightened, and the kit was placed in the instrument for fully automated detection. The detection was repeated 5 times at each time point. The results were observed on the instrument display, and the positive / negative results and Ct values for each target were recorded.
[0097] The results are as follows: the positive rate of the test results at the three time points was 100%, and the coefficient of variation was <3%.
[0098] Table 3
[0099]
[0100] 3.2 Minimum Detection Limit
[0101] The detection sensitivity of the kit was evaluated. The kit was diluted to the critical concentration (10 copies / μL) using the manufacturer's African swine fever virus positive control sample, and 50 μL was added to the sample compartment. The compartment cap was tightened, and the kit was placed in the instrument for fully automated detection. The detection was repeated 5 times at each time point. The results were observed on the instrument display, and the positive / negative results and Ct values for each target were recorded.
[0102] The results are as follows: the detection rate of the critical concentration at the three time points was 100%, and the coefficient of variation was <3%.
[0103] Table 4
[0104]
[0105] 4. Verification and Comparison
[0106] For real samples, the kits from this embodiment and commercial kits were used for testing, and the test results were compared.
[0107] Fifteen African swine fever (ASF) positive swine blood samples were selected. Each sample was divided into two aliquots. One aliquot (30 μL) was added to a microfluidic chip for fully automated nucleic acid purification and qPCR reaction, serving as the experimental group. The other aliquot (200 μL) was used for nucleic acid extraction using the Tiangen Magnetic Bead Blood Genomic DNA Extraction Kit (catalog number: DP329). 5 μL of the nucleic acid eluent was added to the Zhengzhou Zhongdao African Swine Fever Virus Fluorescent PCR Nucleic Acid Detection Kit for qPCR reaction, serving as the control group.
[0108] The procedure for using the Tiangen nucleic acid purification kit in the control group is as follows:
[0109] (1) Take 200 μL of blood sample into a 1.5 ml centrifuge tube.
[0110] (2) Add 20 μL of Proteinase K solution.
[0111] (3) Add 300 μL of lysis buffer GHL and shake to mix.
[0112] (4) Place the centrifuge tube at 65°C and incubate for 15 min, inverting and mixing 3 times during the incubation period, 3 to 5 times each time.
[0113] (5) Leave at room temperature for 5 minutes.
[0114] (6) Add 350 μl of isopropanol and shake to mix for 10 s.
[0115] (7) Add 20 μl of magnetic bead suspension G, shake to mix for 1 min, let stand for a total of 9 min, shake to mix for 1 min every 3 min.
[0116] (8) Place the centrifuge tube on the magnetic rack and let it stand for 30 seconds. After the magnetic beads are completely attracted, carefully remove the liquid.
[0117] (9) Remove the centrifuge tube from the magnetic rack, add 700 μL of buffer GDA, and vortex to mix for 5 min.
[0118] (10) Place the centrifuge tube on the magnetic rack and let it stand for 30 seconds. After the magnetic beads are completely attracted, carefully remove the liquid.
[0119] (11) Remove the centrifuge tube from the magnetic rack, add 700 μL of PWD rinse solution, and shake to mix for 2 min.
[0120] (12) Place the centrifuge tube on the magnetic rack and let it stand for 30 seconds. After the magnetic beads are completely attracted, carefully remove the liquid.
[0121] (13) Repeat steps (11) and (12) once.
[0122] (14) Place the centrifuge tubes on a magnetic rack and air dry at room temperature for 10-15 minutes. Note: Ethanol residue will inhibit subsequent enzyme reactions, so ensure that the ethanol evaporates completely during air drying. However, do not dry for too long, otherwise it will be difficult to wash out the DNA.
[0123] (15) Remove the centrifuge tube from the magnetic rack, add 100 μL of elution buffer TB, vortex to mix, place at 56°C and incubate for 10 min, inverting to mix 3 times during the incubation period, 3 to 5 times each time.
[0124] (16) Place the centrifuge tube on the magnetic rack and let it stand for 2 minutes. After the magnetic beads are completely adsorbed, carefully transfer the DNA solution to a new centrifuge tube for later use.
[0125] The procedure for using the Zhongdao African swine fever nucleic acid detection kit in the control group is as follows:
[0126] Remove the fluorescent PCR reaction solution and enzyme mixture from the kit, thaw at room temperature, and centrifuge at 2000 rpm for 5 seconds. Assuming the total amount of the test samples (repeated twice), positive control, and negative control is 15 × 2 + 1 + 1 = 32, the reaction system is prepared as follows:
[0127] Table 5
[0128]
[0129] Add the above reagents to a new 1.5 mL RNase / DNase-fee centrifuge tube, mix thoroughly, and centrifuge briefly. Aliquot the reagents into 20 μL tubes for the fluorescent PCR reaction.
[0130] Add 5 μl each of negative control and positive control, and 5 μl each of the processed nucleic acid to be tested to the prepared fluorescent PCR reaction tubes, to a final volume of 25 mL. Cap the fluorescent PCR reaction tubes, mix well, centrifuge briefly, and transfer to the fluorescent PCR instrument.
[0131] Place the PCR reaction tubes in the sample holder of the fluorescence PCR instrument, and run the following program on the fluorescence PCR instrument:
[0132] Table 6
[0133]
[0134] Select FAM as the fluorescence channel and collect fluorescence signals at 55°C during each cycle of PCR amplification. Set the amplification volume to 25 μL. Also, select the "passive reference" and "quencher" modes as "none".
[0135] The results are summarized in the table below:
[0136] Table 7
[0137]
[0138] Because the reaction program of the intermediate kit includes 5 pre-amplification cycles, and its reaction conditions are consistent with those of the actual PCR amplification, the Ct value should be calculated by adding 5 to the detection data to obtain the true Ct value. Furthermore, although the same blood samples were used in this comparison, the amounts differed due to different operating methods. Simply comparing Ct values is meaningless; the comparison should focus on whether the detection rates are consistent. The results in the table above show that the positive detection concordance rate of both the kit from this application and the control kit is 100%.
[0139] The experimental results are shown in the figure below. Figures 2 to 32 .
[0140] Example 2 and Example 3
[0141] Example 2 and Example 3 each provide a kit, the only difference from Example 1 being the amount of each component in the protectant in the kit, as shown in the table below.
[0142] Table 8
[0143]
[0144] The tests for Examples 2 and 3 were performed according to section 3.1 of Example 1, and the results are shown in the table below:
[0145] Table 9 (Example 2)
[0146]
[0147] Table 10 (Example 3)
[0148]
[0149] Comparative Examples 1 to 5
[0150] Comparative Examples 1 to 5 are all comparative examples of the kit in Example 1. The only difference between them and Example 1 is the concentration of the protective agent in the PCR reaction system, as shown in the table below. All other aspects are the same as in Example 1.
[0151] Table 11
[0152]
[0153] The comparative examples were tested according to section 3.1 of Example 1, and the results are shown in the table below:
[0154] Table 12 (Comparative Example 1)
[0155]
[0156] Table 13 (Comparative Example 2)
[0157]
[0158] Table 14 (Comparative Example 3)
[0159]
[0160] Table 15 (Comparative Example 4)
[0161]
[0162] Table 16 (Comparative Example 5)
[0163]
[0164] The technical features of the above-described embodiments and examples can be combined in any suitable manner. For the sake of brevity, not all possible combinations of the technical features in the above-described embodiments and examples are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0165] The embodiments described above are merely illustrative of several implementation methods of this application, intended to facilitate a detailed understanding of the technical solutions of this application, but should not be construed as limiting the scope of protection of the patent application. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of this application, and these all fall within the scope of protection of this application. Furthermore, it should be understood that after reading the above teachings of this application, those skilled in the art can make various alterations or modifications to this application, and the equivalent forms obtained also fall within the scope of protection of this application. It should also be understood that technical solutions obtained by those skilled in the art based on the technical solutions provided in this application through logical analysis, reasoning, or limited experimentation are all within the scope of protection of the appended claims. Therefore, the scope of protection of this patent application should be determined by the content of the appended claims, and the specification and drawings can be used to interpret the content of the claims.
Claims
1. A protective agent, characterized in that, The protective agent comprises bovine serum albumin, trehalose, pullulan, defoamer SE-15, and DL-dithiothreitol in a mass ratio of (30mg-50mg): (11g-15g): (0.7g-1g): (0.03mL-0.045mL): (0.5mmol-2mmol); Optionally, the protective agent comprises bovine serum albumin, trehalose, pullulan, defoamer SE-15, and DL-dithiothreitol in a mass ratio of (35mg-45mg):(11g-13g):(0.75g-0.85g):(0.03mL-0.04mL):(0.8mmol-1.2mmol).
2. A reagent kit, characterized in that, The kit includes a protective agent and PCR amplification reagents; Based on the total volume of the PCR reaction system containing the protective agent and the PCR amplification reagent, each 100 mL of the PCR reaction system includes 30 mg–50 mg bovine serum albumin, 11 g–15 g trehalose, 0.7 g–1 g pullulan, 0.03 mL–0.045 mL of defoamer SE-15, and 0.5 mmol–2 mmol DL-dithiothreitol; Optionally, each 100 mL of the PCR reaction system includes 35 mg–45 mg bovine serum albumin, 11 g–13 g trehalose, 0.75 g–0.85 g pullulan, 0.03 mL–0.04 mL of defoamer SE-15, and 0.8 mmol–1.2 mmol DL-dithiothreitol; Optionally, the protective agent and the PCR amplification reagent are sealed in a microfluidic chip.
3. The reagent kit according to claim 2, characterized in that, The PCR amplification reagents include one or more of the following: PCR reaction buffer, DNA polymerase, dNTPs, upstream primer for target amplification, downstream primer for target amplification, and target detection probe; Optionally, the PCR reaction system includes 18%–22% by volume the PCR reaction buffer, 1 U / μL–1.5 U / μL the DNA polymerase, 0.7 mM–0.9 mM of the dNTPs, 1.5 μM–1.8 μM of the upstream primer for target amplification, 1.5 μM–1.8 μM of the downstream primer for target amplification, and / or 0.3 μM–0.5 μM of the target detection probe.
4. The reagent kit according to claim 3, characterized in that, The kit is an African swine fever virus nucleic acid detection kit; Optionally, the sequence of the upstream primer for target amplification is shown in SEQ ID NO.1, the sequence of the downstream primer for target amplification is shown in SEQ ID NO.2, and the sequence of the target detection probe is shown in SEQ ID NO.
3.
5. The kit according to any one of claims 2 to 4, characterized in that, The water content of the protective agent and PCR amplification reagent encapsulated in the microfluidic chip does not exceed 10%.
6. The kit according to any one of claims 2 to 4, characterized in that, The kit also includes a positive control; optionally, the positive control includes a plasmid containing the target.
7. The method for preparing the kit according to any one of claims 2 to 6, characterized in that, The preparation method includes loading the protective agent and the PCR amplification reagent into the microfluidic chip, removing the solvent, and sealing.
8. The method for preparing the reagent kit according to claim 7, characterized in that, Methods for removing solvents include air drying; Optionally, the air-drying conditions include: 75℃~85℃, for 15min~25min.
9. A method for detecting nucleic acid samples, characterized in that, The detection method includes the step of amplification using the kit described in any one of claims 2 to 6.
10. The detection method according to claim 9, characterized in that, The amplification program included: 94.5℃~95.5℃ for 2.8min~3.2min; 94.5℃~95.5℃ for 8s~12s, 55℃~65℃ for 30s~60s, 35~45 cycles.
Citation Information
Patent Citations
Stable liver function type composite quality control product
CN113049839A
Bacillus anthracis detection primer probe composition and integrated micro-fluidic chip kit
CN116875709A
Neisseria meningitidis detection primer probe composition and integrated micro-fluidic chip kit
CN116904446A
Enterohemorrhagic Escherichia coli nucleic acid detection primer probe composition and integrated micro-fluidic chip kit
CN116904450A
Primer probe composition for detecting typhus fever nucleic acid and integrated micro-fluidic chip kit
CN116904617A