Aipmt, aipmt, aipmt, aipmt, aipmt, aipmt, aipmt, aipmt, aipmt, aipmt, aip

Abstract

The application discloses a giant panda multi-pathogen digital PCR detection primer probe set, a kit and a method, and belongs to the technical field of pathogen detection. The giant panda multi-pathogen digital PCR detection primer probe set disclosed by the application contains a giant panda rotavirus primer probe set, a canine distemper virus primer probe set, a canine / feline parvovirus primer probe set, a Baylisascaris schokker primer probe set, a toxoplasma primer probe set, a Klebsiella pneumoniae primer probe set and an internal standard primer probe set. The application can simultaneously detect the giant panda rotavirus, the canine distemper virus, the canine / feline parvovirus, the Baylisascaris schokker, the toxoplasma, the Klebsiella pneumoniae and the internal standard, and has high sensitivity and strong specificity.

Description

Technical Field

[0001] This invention relates to the field of pathogen detection technology, and more specifically to primer and probe sets, kits, and detection methods for multiplex digital PCR detection of multiple pathogens in giant pandas. Background Technology

[0002] Giant panda ( Ailuropoda melanoleuca As a rare and vulnerable species unique to my country, the giant panda population's health has long been threatened by various pathogens. Among them, giant panda rotavirus, canine distemper virus, parvovirus, Toxoplasma gondii, Ascaris lumbricoides, and Klebsiella pneumoniae are common and serious pathogens in clinical practice, encompassing three major categories: viruses, parasites, and bacteria. Their routes of infection and pathogenic mechanisms differ, and mixed infections are frequent. Currently, detection methods for these pathogens mainly rely on traditional etiological methods (such as bacterial isolation and culture, egg flotation), immunological methods (such as ELISA), and molecular biological methods (such as conventional PCR and quantitative real-time PCR). Existing studies have established PCR detection protocols for individual pathogens, such as quantitative real-time RT-PCR for giant panda rotavirus, multiplex PCR for Klebsiella pneumoniae, and PCR identification of Ascaris lumbricoides. However, these methods mostly cover only one or a few targets, and the detection platforms and reaction systems used vary significantly, making it difficult to establish a unified parallel detection workflow.

[0003] Despite the increasingly widespread application of molecular biology techniques in pathogen detection, existing systems still have several significant shortcomings. First, current methods are primarily designed for single pathogens, making it impossible to detect all six important pathogens simultaneously in a single reaction. However, mixed infections are quite common in actual giant panda clinical samples, and single-target detection is not only inefficient but also prone to missing other co-existing pathogens, delaying diagnosis and intervention. Second, sensitivity still has room for improvement, especially in the early stages of infection or when pathogen loads are extremely low, where the detection capabilities of traditional PCR and some quantitative real-time PCR methods are not ideal. Digital PCR, as a third-generation PCR technology, divides the reaction system into numerous independent microreaction units for endpoint detection, achieving sensitivity at the single-molecule level with a detection limit as low as 0.001%. Its detection capability for low-copy targets is significantly superior to traditional methods. Furthermore, digital PCR does not rely on standard curves; it can directly calculate the absolute copy number of target molecules based on the Poisson distribution, avoiding the influence of standard preparation and batch variations on quantitative results. However, currently, there are no mature products that systematically integrate digital PCR technology into the joint detection of multiple pathogens in giant pandas. Third, giant panda feces, anal swabs, and nasal swabs have complex matrix compositions, often containing substances like humic acid and polysaccharides that inhibit PCR reactions. Traditional quantitative PCR is highly sensitive to inhibitors, easily affecting amplification efficiency; while digital PCR, by dividing the sample into tens of thousands of independent microreaction units, highly dilutes inhibitors, significantly reducing their impact on individual microreactions, thus exhibiting greater tolerance to complex samples. However, most existing methods lack endogenous internal control genes to monitor the entire nucleic acid extraction and amplification process, failing to effectively identify false negative results caused by inhibitor interference or extraction failure, which to some extent reduces the reliability of the test results.

[0004] In summary, there is currently a lack of a multiplex digital PCR detection kit that can simultaneously cover six key pathogens affecting giant pandas—rotavirus, canine distemper virus, parvovirus, Toxoplasma gondii, Ascaris lumbricoides, and Klebsiella pneumoniae—while possessing high sensitivity, absolute quantification capabilities, and endogenous quality control throughout the entire process. Given that giant pandas are a vulnerable species with limited sampling opportunities and small sample sizes, the requirements for the information content and reliability of a single test are extremely high. Developing a detection system that integrates multi-target parallel detection, absolute quantification, and internal standard monitoring is of urgent practical significance and has broad application prospects for improving the efficiency of early warning of giant panda diseases and guiding precise prevention and control measures.

[0005] Therefore, providing primer and probe sets, kits, and methods for digital PCR detection of multiple pathogens in giant pandas is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0006] In view of this, the present invention provides primer and probe sets, kits and methods for detecting multiple pathogens in giant pandas using digital PCR.

[0007] This invention develops a highly sensitive and specific multiplex digital PCR kit for the simultaneous detection of Giant Panda Rotavirus, Canine Distemper Virus, Parvovirus, and Toxoplasma gondii. Toxoplasma Gondii ), Ascaris lumbricoides ( Baylisascaris schroederi ) and Klebsiella pneumoniae ( Klebsiella pneumoniae This kit detects pathogens such as [pathogens name missing] and includes an endogenous internal standard gene from giant pandas. It achieves precise detection of pathogens through absolute quantification technology, while utilizing the endogenous internal standard from giant pandas to monitor the integrity of the entire detection process (from sample extraction to amplification). By systematically evaluating the kit's key performance indicators such as sensitivity, specificity, repeatability, and linearity, a complete pathogen detection technology system is established, providing a reliable and accurate molecular diagnostic tool for giant panda health monitoring, disease prevention and control, and conservation efforts, thus contributing to early warning and precise control of giant panda diseases.

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] A primer and probe set for digital PCR detection of multiple pathogens in giant pandas, wherein the pathogens are giant panda rotavirus, canine distemper virus, canine / feline parvovirus, Ascaris lumbricoides, Toxoplasma gondii, and Klebsiella pneumoniae. The primer and probe set contains primer and probe sets for giant panda rotavirus, canine distemper virus, canine / feline parvovirus, Ascaris lumbricoides, Toxoplasma gondii, Klebsiella pneumoniae, and an internal standard primer and probe set. The primer and probe sequences of the giant panda rotavirus primer and probe set are as follows: RV-F2: 5'-GGTCAGCAAGTAACTTTATCGGTG-3'; RV-R2: 5'-TGTAGAGAACAATGGTCCGTGCT-3'; RV-P2: 5'-CTTCCTGTTGGCGTAGTTGTAC-3'; The 5' end of RV-P2 is marked FAM, and the 3' end is marked MGB; The primer and probe sequences of the canine distemper virus primer-probe set are as follows: CDV-F3: 5'-ACATCCCGCCTCACAGGG-3'; CDV-R3: 5'-CCGCCTCTTGAACCAGGAA-3'; CDV-P3: 5'-CCACGAGGGTATCATCCATCACACACC-3'; The 5' end of CDV-P3 is marked FAM, and the 3' end is marked BHQ1; The primer and probe sequences of the canine / feline parvovirus primer-probe set are as follows: PV-F3: 5'-CGGAAACATGGCTTTAGATGATAC-3'; PV-R3: 5'-TTAACAATTAGTTGCCAATCTCCTG-3'; PV-P3: 5'-CTCCCCAAGCATTTGCATCAACCA-3'; The 5' end of PV-P3 is marked with HEX, and the 3' end is marked with BHQ1; The primer and probe sequences of the *Begonia scimitarium* primer-probe set are as follows: Bas-F3: 5'-GGGTCTTGGGAGGTTTTACCTG-3'; Bas-R3: 5'-CCTCAACACTCCAAACACGTCC-3'; Bas-P3: 5'-ATTTGAATACTAGACGAAACCCG-3'; The 5' end of Bas-P3 is marked ROX, and the 3' end is marked MGB; The primer and probe sequences of the Toxoplasma gondii primer-probe set are as follows: Tox-F2: 5'-CCCTCTGCTGGCGAAAAGTG-3'; Tox-R2: 5'-CTTTCACGATCTCTTCTCCTGTTC-3'; Tox-P1: 5'-CAGGCGACCAATCTGCGAATACACC-3'; The 5' end of Tox-P1 is marked ROX, and the 3' end is marked BHQ2; The primer and probe sequences of the Klebsiella pneumoniae primer-probe set are as follows: Kp-F2: 5'-GCCACAATCAAGGACTATCTCG-3'; Kp-R2: 5'-ACTCCAGATCGGGTTCATTGC-3'; Kp-P1: 5'-CCAATAGTCGGTCGCGCAGCCTG-3'; The 5' end of Kp-P1 is marked CY5, and the 3' end is marked BHQ2; The primer and probe sequences of the internal standard primer-probe set are as follows: Internal standard-F3: 5'-AAAGGTAGCATAATCATTTGTTCTC-3'; Internal standard-R3: 5'-TAGGGTCTTCTCGTCTTATTGTCTT-3'; Internal standard -P1: 5'-ACTGTCTCTTACTTCCAATCAGTGA-3'; the 5' end of internal standard -P1 is marked with HEX, and the 3' end is marked with MGB.

[0010] Furthermore, the giant panda multipathogen digital PCR detection kit includes the aforementioned giant panda multipathogen multiplex digital PCR detection primer and probe set.

[0011] Furthermore, a digital PCR detection method for multiple pathogens in giant pandas, not intended for disease diagnosis, includes the following steps: (1) Extract nucleic acid from the sample to be tested and perform digital PCR amplification reaction using the primer and probe set described above; (2) Digital PCR fluorescence signal acquisition was performed, and fluorescence signals from four channels, FAM, HEX, ROX and CY5, were acquired; The FAM channel is used to detect the giant panda rotavirus VP4 gene and canine distemper virus F gene; the HEX channel is used to detect the canine / feline parvovirus VP1 gene and the internal standard giant panda mitochondrial 16S gene; the ROX channel is used to detect the AT enrichment region of Bezoar sieboldii and the Toxoplasma gondii B1 gene; and the CY5 channel is used to detect the Klebsiella pneumoniae MERR gene.

[0012] Furthermore, the digital PCR amplification reaction system is as follows: 5 μL of 4× digital PCR premix, 1.26 μL of primer mix, 2.55 μL of probe mix, 2 μL of sample DNA, and ddH2O added to 20 μL.

[0013] Furthermore, the digital PCR amplification reaction program is as follows: pre-denaturation at 95℃ for 10 min; Denaturation at 94℃ for 30 seconds, annealing and extension at 60℃ for 1 minute, cycled 40 times; Inactivate at 98℃ for 10 min; Cool at 20℃ for 2 minutes; At the end of each cycle, fluorescence signals from four channels—FAM, HEX, ROX, and CY5—were collected.

[0014] (I) Breakthrough in the Product Dimension of this Reagent Kit (1) The first seven-fold digital PCR joint detection system exclusively for giant pandas was established. Currently, there are no seven-fold high-throughput digital PCR kits on the market specifically for the giant panda, a rare species. Existing research mostly focuses on single pathogen detection or simple combinations based on low-throughput PCR. This product is the first to integrate six core lethal / common pathogens of giant pandas—rotavirus, canine distemper virus, parvovirus, Toxoplasma gondii, Ascaris lumbricoides, and Klebsiella pneumoniae—into a single detection system, filling a gap in this field.

[0015] (2) For the first time, the internal standard of "full-process monitoring of samples" was introduced into the detection of pathogens in giant pandas. This kit innovatively incorporates endogenous internal control genes from giant pandas. This design, for the first time, addresses the quality control blind spot in giant panda pathogen detection, clarifying whether a sample lacks pathogens or whether sample extraction / amplification has failed. By monitoring fluctuations in the internal control copy number, the effectiveness of the entire process from fecal / swab sample extraction to digital PCR amplification can be monitored in real time, ensuring the reliability of every negative result.

[0016] (3) For the first time, absolute quantitative detection of pathogens such as Ascaris lumbricoides in giant pandas was achieved. Ascaris lumbricoides is a deadly parasite endemic to giant pandas. Traditional detection methods rely on microscopic examination, which has a high rate of false negatives. This kit is the first to utilize digital PCR technology to achieve precise quantification of the DNA in the eggs of this parasite. Combined with Toxoplasma gondii detection, it provides a new molecular diagnostic standard for assessing the parasite load in giant panda parasitic diseases.

[0017] (ii) "Innovation" in the application of reagent kits (1) High-throughput sample processing model of "one tube and seven inspections" The innovation lies in the simplified operational process. Previously, detecting the six pathogens in giant pandas required separate batch extraction of nucleic acids based on their target groups, which included RNA viruses (rotavirus, canine distemper virus), DNA viruses (parvovirus), bacteria (Klebsiella pneumoniae), and parasites (Toxoplasma gondii, Ascaris lumbricoides). Subsequent amplification required independent qPCR reactions for each target. This kit, through optimized total nucleic acid extraction and multiplex amplification systems, enables the simultaneous detection of pathogens with both DNA and RNA genetic material in a single reaction well, significantly reducing precious sample consumption and improving detection efficiency by more than six times.

[0018] (2) Early warning model based on protective medicine The innovation lies in shifting molecular diagnostics from "confirmation" to "early warning." Utilizing the high sensitivity of digital PCR, regular screening of giant panda feces and environmental samples can be conducted. By monitoring changes in the viral load of Klebsiella pneumoniae, the risk of sepsis can be predicted in advance; by monitoring trace copy numbers of canine distemper virus, valuable window periods can be gained for emergency isolation and treatment. This "active surveillance" model replaces the traditional "passive treatment" model, representing a significant upgrade to the precision prevention and control system for giant panda diseases.

[0019] (3) Specificity guarantee under multiple cross-validation The innovation lies in solving the problem of interference from the giant panda's gut microbiota. The giant panda's gut microbiota is complex, and ordinary detection kits are prone to non-specific amplification. This kit underwent specificity validation against the high-abundance background microbiota of giant pandas during the design phase, ensuring accurate identification of low-abundance pathogens such as Klebsiella pneumoniae even in complex microbiota environments, guaranteeing high specificity.

[0020] (III) Summary of Innovation and Advancement: Advanced features: Relying on the digital PCR platform, it achieves absolute quantification and single-copy-level sensitivity, breaking through the limitations of traditional qPCR semi-quantitative methods.

[0021] Originality: The seven-fold detection kit for giant pandas is the first to introduce endogenous internal standards to achieve full-process quality control, and the first to cover the molecular quantification of Ascaris lumbricoides, a parasite unique to giant pandas.

[0022] Innovation: It pioneered the "one tube, seven tests" DNA / RNA co-testing model, which innovated the early warning mechanism for diseases of rare wild animals and provided a core tool for the transformation of giant panda health management from "experience-based judgment" to "precise digital diagnosis".

[0023] As can be seen from the above technical solutions, compared with the prior art, the present invention discloses a primer and probe set, kit, and method for detecting multiple pathogens in giant pandas using digital PCR, which has the following beneficial effects: (1) High-precision detection technology for absolute quantification: Unlike traditional quantitative PCR (qPCR) which relies on a standard curve for relative quantification, this kit is based on a digital PCR platform and achieves true absolute quantification through a "divide and conquer" microdroplet process. This technological advantage lies in: ① Accurate load assessment: It can directly output the pathogen copy number concentration (copies / µL) without relying on external standards. This is of key significance for determining whether giant pandas have latent, subclinical, or severe infections, and provides accurate evidence for clinical medication. ② Strong anti-interference ability: Digital PCR has a higher tolerance to inhibitors, making it particularly suitable for samples with complex composition, such as giant panda feces and nasal swabs, which are prone to carrying PCR inhibitors, and significantly reducing the false negative rate.

[0024] (2) Detection of low-frequency mutations and attenuated toxicity with ultra-high sensitivity: Compared to traditional qPCR, this kit improves detection sensitivity to the single-copy level. Targeting the "silent killers" in giant panda disease control (such as canine distemper virus in the incubation period and low-load Toxoplasma gondii), this kit can provide early warning when the pathogen load is extremely low, truly achieving "early detection, early isolation, and early treatment," overcoming the bottleneck of traditional methods' difficulty in detecting the incubation period.

[0025] (3) Efficient synergy of multiple targets: This invention enables the simultaneous amplification of seven targets (six pathogens + one internal standard) in a single reaction system. Through precise primer and probe design, the problem of balancing amplification efficiency among multiple targets is solved, avoiding the risk of cross-contamination caused by repeated opening of the lid in traditional single-target detection. This significantly improves the detection throughput while ensuring data stability and repeatability. Attached Figure Description

[0026] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0027] Figure 1 The standard curves for single-fluorescent PCR of each target and internal standard are shown.

[0028] Figure 2 This is a 1D droplet diagram of a multiplex digital PCR reaction system.

[0029] Figure 3 This is a 2D droplet diagram of a multiplex digital PCR reaction system.

[0030] Figure 4 1D droplet plot for linear testing of multiplex digital PCR system.

[0031] Figure 5 Statistical analysis of linearity test results for multiplex digital PCR systems.

[0032] Figure 6 Statistical analysis of repeatability test results for multiplex digital PCR systems.

[0033] Figure 7 1D droplet plots were used to compare singleton and multiplex digital PCR systems.

[0034] Figure 8 Statistical analysis of the comparative test results of singleton and multiplex digital PCR systems. Detailed Implementation

[0035] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0036] Example 1 1) Construction of target and internal standard plasmids The construction methods for the target and internal control positive plasmids RV, CDV, PV, Bas, Tox, and Kp are as follows: The nucleotide sequences of the synthesized target genes (as shown in SEQ ID NO. 1~7) are cloned into the multiple cloning sites of the pUC57 vector. The restriction enzyme sites for RV, Tox, Bas, Kp, and the internal control plasmids are BamHI and EcoRI, the restriction enzyme sites for CDV plasmid are EcoRI and HindIII, and the restriction enzyme sites for PV plasmid are BamHI and HindIII. After construction, the ligation products are transformed into *E. coli*, positive clones are screened, and the plasmids are extracted and sequenced for verification. Confirmation is made that the target gene sequence is completely consistent with the designed sequence, thus obtaining the positive plasmid pUC57-target gene.

[0037] The gene fragment synthesized for the giant panda rotavirus RV target is shown in SEQ ID NO.1.

[0038] ACAAGCTATTGGGTACTACTTGCGCCAACTGTAGAGGGCGTAATTATTCAAGGAACAAACAATACCGATAGATGGTTGGCCACTATACTAATTGAACCAAACGTACAAACGACTAACAGAATATACAATCTTTTTGGTCAGCAAGTAACTTTATCGGTGGAGAATACGTCACAGACACAATGGAAGTTCATTGATGTGAGTACAACTACGCCAACAGGAAGTTATACGCAGCACGGACCATTGTTCTCTACACCAAAATTATACGCTGTAATGAAATTCAGTGGTAGAATATATACATATAATGGAACCACACCAAACGCAACAACAGGATACTATTCAACTACTAATTATGACACAGTAAATATGACATCATTTTGTGATTTTTATATTATACCAAGAAATCAAGAAGAAAAATGTACTGAGTATATCAATCATGGATTACCTCCTATACAAAATACAAGGAATGTTGTGCCAGTACCT; SEQ ID NO.1.

[0039] The synthetic gene fragment of the canine distemper virus CDV target is shown in SEQ ID NO.2.

[0040] CGAAAGCTCAAGGACAATTAGGTTGGTTAGAAAATAAGGATATTGTGGACATAGAAGTTGATGATGCTGAGCAATTCAATATATTGCTAGCTTCCATCTTGGCTCAAATTTGGATCCTGCTCGCTAAAGCAGTGACTGCTCCTGACACTGCAGCCGACTCGGAAATGAGGAGATGGATCAAGTATACCCAACAGAGACGTGTGGTCGGGGCCCATGCACAACAAAATCCCCAAAAAATCCAAACCCCTGCCACACACCCGACAAGATCCCCTCCAACAACACAGCACCAGATCCGCCGAGACCAAGACCTCCCAAGGACGACATAGCATAACATCGGCTCAGCGATCCACGCACCCATAATGAACAGGACCAGGTCTTGCAAGCAAACTAGCCACAGATCGGATAACATCCCGCCTCACAGGGACCACGAGGGTATCATCCATCACACACCAGAAAGTGTTACCCAAGGAGCGAGTTCCTGGTTCAAGAGGCGGCAATCCAATGCAACCAACGCAGGCTCTCAATAATCATATGTAAGATCACTCTGAAGCACTCTGGTCACAAGTCTTGCCTGATTGTCAGGCTTGAAATCCATAAGTCTCGCCTAATTTCCTTCTAAAGCTATCAAACTGCAACAAATAGTGGCGAGGACTGACTCCAATTATTATAATTAAAGAAAACTTAGGGCTCA; SEQ ID NO.2.

[0041] The canine / feline parvovirus PV target synthetic gene fragment is as shown in SEQ ID NO.3.

[0042] AGACAAATTGTCAGCACACTTTACACTGAACAAATGAAACCAGAAACCGTTGAAACCACAGTGACGACAGCACAGGAAACAAAGCGCGGGAGAATTCAAACTAAAAAGGAAGTGTCAATCAAATGTACTTTGCGGGACTTGGTTAGTAAAAGAGTAACATCACCTGAAGACTGGATGATACAATCAAACCAACCTGGCGTTACTCACAAAGACGTGCAAGCGAGTCCAACGTGGTCCGAAATAGAGGCAGACCTGAGAGCCATCTTTACTTCTGAACAATTGGAAGAAGATTTTCGAGACGACTTGGATTAAGGTACGATGGCACCTCCGGCAAAGAGAGCCAGATAAAACTGCAGTTAACGGAAACATGGCTTTAGATGATACTCATGCACAAATTGTAACACCTTGGTCATTGGTTGATGCAAATGCTTGGGGAGTTTGGTTTAATCCAGGAGATTGGCAACTAATTGTTAATACTATGAGTGAGTTGCATTTAGT; SEQ ID NO.3。

[0043] The synthetic gene fragment of the Baylisascaris schroederi Bas target is shown in SEQ ID NO.4.

[0044] TTGGTTGGATTTTATAAGTATCAGGGTGGATTGTCTACATGGTTGGAGAGGTCAAATCATAAGGATATTGGCACCTTGTATTTTTTGTTTGGTTTGTGGTCTGGTATGGTTGGTACCGGGTTGTCTTTGGTGATTCGTTTGGAATTGGCTAAGCCTGGTCTTTTTTTGGGTAGGGGGCTAAGTTAAAATATGCACTTTGCAAGTGCACGATTTGGGCTCTAAGTGGGTCAGTAGGTAGTTTATGGTTAAAATGTAGTATTTGGGTTACTATGAATTTATTACTGAGAACTTTTAGTTTAATTTAGAATTTCCCATTTACAATGGGGAGGTAGGAAGGTTTTTTGTTAGGAGGTTTCTTATTTTTGATATCAGGGGTCTTGGGAGGTTTTACCTGTTTTAAAGTTAAATAGGTATTTTGGTTTTTGATGTAGAATGAATTTTTGGTGTGTGATATTATTCACACGGGTTTCGTCTAGTATTCAAATTTTATAGCAGGACGTGTTTGGAGTGTTGAGGGGGAGGTGAGCGTTGTTTATGGTTTACTATGTTTCGGGCCGGGTTTTTCTGTAGTGTATATGTAGTATAAGAGAATATGATAGGTTTAGGATCTATGGATAAGGTGTATACTATGTTTCATAATTTTCATATTTTGAGTCTTTCTAGGTATCCTGTCCTGATTTTTTGTGG; SEQ ID NO.4。

[0045] The synthetic gene fragment of the Tox target of Toxoplasma gondii is shown in SEQ ID NO.5.

[0046] GCAAATGAAAAGGATTCATTTTCGCAGTACACCAGGAGTTGGATTTTGTAGAGCGTCTCTCTTCAAGCAGCGTATTGTCGAGTAGATCAGAAAGGAACTGCATCCGTTCATGAGTATAAGAAAAAAATGTGGGAATGAAAGAGACGCTAATGTATTTGCATAGGTTGCAGTCACTGACGAGCTCCCCTCTGCTGGCGAAAAGTGAAATTCATGAGTATCTGTGCAACTTTGGTGTATTCGCAGATTGGTCGCCTGCAATCGATAGTTGACCACGAACGCTTTAAAGAACAGGAGAAGAAGATCGTGAAAGAATACGAGAAGAGGTACACAGAGATAGAAGTCGCTGCGGAGACAGCGAAGACTGCGGATGACTTCACTCCCGTCGCACCAGCAGCAGAGGAGTGCCGGGCAAGAAAATGAGATGCCTAGAGGAGACACAGCGTGTTATGAACAAATCTATTGAGGTTTCGCGAAGAGGAG; SEQ ID NO.5.

[0047] The Klebsiella pneumoniae Kp target synthesis gene fragment is as shown in SEQ ID NO.6.

[0048] CATTATGAACAGACGGGGCTGTTAACGCCTTCGGCCAGAAGCGAGGCGGGCTATCGGCTCTATAACCTGTCCGCGGTTCAGCGCCTGCATATGATAAAGGCGCTGGCGCAGGCCGGGCTAACGCTCGCCACAATCAAGGACTATCTCGATCGGCAAACGCTGTCGCTGCCCGAGCTGCTGACGCAGCAGATAGATATGCTCAACGCCCAGCTACGCGATGTTGGCAGGCTGCGCGACCGACTATTGGTGCTGCGCGAGGCGCTGGCGAGCGGCAATGAACCCGATCTGGAGTCCTGGCTACAGACGCTGGAGTTAATGAAAATGTACGATCGTTGGTTTAGTCAACAGGAGTTAGCCGCGCTGCCGTTTGCGGCACAGGATGAACAGCGGGCGCAGGCGTGGCGCGAGCTAACGGAGGAGGTGCAGACGCTGATGGCGAGCGGCTGCCCGACGGACAGTCCGCAGGCGATGCGTCTGGCGACGCGCTGGA; SEQ ID NO.6。

[0049] The internal standard synthetic gene fragment is shown in SEQ ID NO.7.

[0050] CCCAATGATAAAACACCTATTAAATCAATTGTTAGTCCAACACAGGCATGCAATCAGGGAAAGATTAAAAGAAGTGAAAGGAACTCGGCAAACACAAACCCCGCCTGTTTACCAAAAACATCACCTCCAGCATTTCCAGTATTGGAGGCACTGCCTGCCCGGTGACATCAGTTAAACGGCCGCGGTATTCTGACCGTGCAAAGGTAGCATAATCATTTGTTCTCTAAATAAGGACTTGTATGAA CGGCCACACGAGGGTTTAACTGTCTCTTACTTCCAATCAGTGAAATTGACCTCCCCGTGAAGAGGCGGGGATAAGACAATAAGACGAGAAGACCCTATGGAGCTTTAATTAACTAATTCAAAAAGAAACTACTAACGACCCAACAGGAATAATATCTCTTTTATGAATTAGCAATTTAGGTTGGGGCGACCTCGGAGGACAAAATAGCCTCCGAGTGATTATAAAATCTAGACTTACCAG; SEQ ID NO.7.

[0051] 2) Screening and optimization of target and internal standard primers and probes The primers and probes for the detection of canine distemper virus, canine / feline parvovirus, giant panda rotavirus, Klebsiella pneumoniae, Toxoplasma gondii, Ascaris lumbricoides, and internal standards are shown in Tables 1-2.

[0052] Table 1 Summary of primers and probes for the Giant Panda Multipathogen Multiplex Digital PCR Detection Kit (1)

[0053] Table 2 Summary of primers and probes for the Giant Panda Multipathogen Multiplex Digital PCR Detection Kit (2)

[0054] Primer-probe combinations were screened to select primer sets with similar amplification efficiencies, thus avoiding mutual interference between primers. After screening and optimization, the final target and internal control primer-probe sequences were obtained. The fluorescent reporter group for giant panda rotavirus and canine distemper virus was FAM; the fluorescent reporter group for canine / feline parvovirus and internal control was HEX; the fluorescent reporter group for Ascaris lumbricoides and Toxoplasma gondii was ROX; and the fluorescent reporter group for Klebsiella pneumoniae was CY5 (see Table 3).

[0055] Table 3 Primer and probe sequences determined by the Giant Panda Multipathogen Multiplex Digital PCR Detection Kit

[0056] 3) Validation of each target primer and probe and specificity test using a singlet fluorescent PCR reaction system. (1) To verify whether the selected target primers and probes have good amplification efficiency for subsequent construction of multiplex digital PCR systems, the target primers and probes selected in Table 3 were used to perform amplification efficiency E and related dilution R according to primer combinations. 2 The fluorescence PCR reaction system was as follows: CoverAll Probe qPCR Mix II (5×) 5 μL, primer F (10 μM) 0.5 μL, primer R (10 μM) 0.5 μL, probe P (10 μM) 0.25 μL, sample DNA 2 μL, and ddH2O to 25 μL. The reaction procedure was as follows: Step 1, pre-denaturation at 95 ℃ for 30 s; Step 2, denaturation at 95 ℃ for 15 s; Step 3, annealing and extension at 60 ℃ for 30 s and acquisition of fluorescence signals from four channels: FAM, HEX, ROX, and CY5; Step 4: Repeat steps 2-3 40 times. The equipment used was a JLM QX600 from Jeremy Laboratories.

[0057] Concentration-Ct standard curves were plotted using positive plasmids targeting RV, CDV, PV, Bas, Tox, and Kp, as well as internal standard plasmids. Figure 1 ).from Figure 1 It can be seen that in the singlet system, the PCR amplification efficiency E value of the standard curve is between 90-105%, and the correlation coefficient R is... 2 All values ​​were greater than 0.99, and the curve slopes were all within the normal range, indicating good amplification efficiency, which can be used for the subsequent establishment of multiplex digital PCR systems.

[0058] (2) Specificity test The relevant plasmids of each target (RV, CDV, PV, Bas, Tox, Kp) and internal standard involved in the kit were selected for mutual specificity testing within the kit. Single fluorescent PCR was performed using the primers and probes of each target and internal standard obtained from the screening in Table 3 to verify the specificity of primers and probes between targets within the kit.

[0059] To verify whether the various targets of the kit would exhibit nonspecific amplification through mutual detection, singlet systems of the targets involved in the kit were used to detect 10... 6The specificity of other target template plasmids with a coefficient / μL was tested within the kit. Table 4 shows that each target and internal standard could only detect its own template, while other targets and internal standards were not detected. There were no false positives between them, demonstrating that the primers and probes for each target in this kit have good specificity.

[0060] Table 4. Specificity testing of each target and internal standard single-weight system in the kit.

[0061] 4) Plasmid linearization and enzyme digestion The theoretical value for each target and internal standard, including RV, CDV, PV, Bas, Tox, and Kp, is 10. 8 Seven positive plasmids with copies / μL were taken in equal volumes and mixed together. The plasmids were then linearized using three restriction enzymes: QuickCut BamH Ⅰ, QuickCut EcoR Ⅰ, and QuickCut Hind III. The digestion system was as follows: 10X QuickCut Buffer 5 μL, QuickCut BamH Ⅰ 1.5 μL, QuickCut EcoR Ⅰ 1.5 μL, QuickCut Hind III 1.5 μL, and plasmid DNA (10... 8 40.5 μL (copies / μL). Incubate at 37℃ for 30 min to complete enzyme digestion.

[0062] 5) Establishment of a digital PCR multiplex reaction system The primer and probe stock solutions were diluted and thoroughly mixed to prepare primer mixtures (primer mix) and probe mixtures (probe mix). The final concentrations of primers and probes are shown in Table 3. The digital PCR reaction system was as follows: 5 μL of 4× digital PCR premix (probe method), 1.26 μL of primer mix, 2.55 μL of probe mix, 2 μL of sample DNA, and ddH2O to a final volume of 20 μL. The digital PCR reaction was performed according to the procedure shown in Table 5. The equipment used was a JLM Digital Matrix-5000 digital PCR system from Jeremy Laboratories. Sample concentration (Copies / μL) = (Copies / μL) × 20 (total reaction volume) ÷ 2 (sample loading volume).

[0063] Table 5 Digital PCR Reaction Parameter Settings

[0064] The 1D droplet plot of the multiplex digital PCR system test results is shown below. Figure 2 2D droplet diagrams are shown below. Figure 3From the 1D droplet plot, the bands between the targets in each channel are clearly layered and do not interfere with each other in detection; from the 2D droplet plot, the targets are clearly distinguished and the bands are clearly divided. The 1D droplet plot and 2D droplet plot show good results, and the experimental results prove that the multiplex digital PCR reaction system has been successfully established.

[0065] 6) Establishment of standard curves and determination of the limit of detection for digital PCR multiplex reaction systems Using the digested mixture of 7 plasmids, a multiplex digital PCR reaction was performed according to the reaction conditions in step 4), with a concentration of 10... 5 Copies / μL plasmid were diluted 4-fold in 7 gradients for digital PCR reactions, with ddH2O as a negative control, to evaluate the linearity and limit of detection of the method.

[0066] Select a mixed plasmid concentration of 10. 5 Copies / μL were sequentially diluted 4-fold to obtain seven different concentrations of standards, which were then used as templates for sensitivity detection. The results showed that the droplet count was greater than 10,000, meeting the experimental analytical requirements. In the multiplex digital PCR system, the linear correlation coefficient R0 for each target (RV, CDV, PV, Bas, Tox, Kp) and the internal standard was [value missing]. 2 All values ​​were greater than 0.99. In the multiplex digital PCR system, the limits of detection for each target and internal standard were all below 10 Copies / μL. (See results below.) Figure 4 , Figure 5 Table 6.

[0067] Table 6. Statistics of the lowest detection limit test results for multiplex digital PCR systems

[0068] 7) Repeatability test of digital PCR multiple reaction system Multiplex digital PCR reactions were performed using single copy number concentrations of seven positive mixed plasmids, repeated eight times. The results were statistically analyzed, and the coefficient of variation was calculated to evaluate the reproducibility of the method.

[0069] Select 10 after enzyme digestion 4 Using a mixed plasmid of copies / μL as a positive template, intragroup replication experiments were performed. The results showed that the number of droplets was greater than 10,000, meeting the experimental analysis requirements. The intragroup coefficient of variation was between 0.611% and 1.114%, all less than 1.5%, indicating that the method has good reproducibility. The results are shown in [Figure number missing]. Figure 6 Table 7.

[0070] Table 7. Statistical analysis of repeatability test results for each target in the multiplex digital PCR system.

[0071] 8) Comparison of singleton and multiplex digital PCR reaction systems Single- and multiple-system digital PCR reactions were performed for each target using seven different positive mixed plasmid single copy number concentrations. The set concentrations corresponding to the same template concentration were compared, and the coefficient of variation of the set concentration results for single- and multiple-system were calculated to compare the consistency between single- and multiple-system digital PCR.

[0072] Seven positive mixed plasmids were used to perform single- and multiplex digital PCR reactions for each target at different single-copy and multiplex concentrations. The setpoint concentrations corresponding to the same template concentration were compared. The results showed that the droplet numbers were all greater than 10,000, meeting the experimental requirements. The coefficients of variation of the true copy number at both single- and multiplex setpoint concentrations were less than 2%, indicating that the single- and multiplex digital PCR reaction systems showed little difference in setpoint results for the same sample, meeting the experimental requirements. The experimental results are as follows: Figure 7 , Figure 8 As shown in Table 8.

[0073] Table 8. Statistical analysis of the comparative test results of singleton and multiplex digital PCR systems.

[0074] After testing the amplification efficiency, linearity, and specificity of primers and probes for seven plasmids targeting RV, CDV, PV, Bas, Tox, and Kp, as well as the internal standard, a primer-probe combination suitable for constructing a digital PCR multiplex system was selected. A seven-fold digital PCR reaction system including the internal standard was then established. Performance tests were conducted on digital PCR indicators such as linearity, limit of detection, repeatability, and comparison between multiplex and singlex digital PCR. The developed seven-fold digital PCR system targeting RV, CDV, PV, Bas, Tox, and Kp, as well as the internal standard, fully meets the analytical performance requirements.

[0075] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A primer and probe set for digital PCR detection of multiple pathogens in giant pandas, wherein the pathogens are giant panda rotavirus, canine distemper virus, canine / feline parvovirus, *Ascaris lumbricoides*, *Toxoplasma gondii*, and *Klebsiella pneumoniae*, characterized in that... The primer and probe set includes primer and probe sets for giant panda rotavirus, canine distemper virus, canine / feline parvovirus, Ascaris lumbricoides, Toxoplasma gondii, Klebsiella pneumoniae, and internal standard primer and probe sets. The primer and probe sequences of the giant panda rotavirus primer and probe set are as follows: RV-F2: 5'-GGTCAGCAAGTAACTTTATCGGTG-3'; RV-R2: 5'-TGTAGAGAACAATGGTCCGTGCT-3'; RV-P2: 5'-CTTCCTGTTGGCGTAGTTGTAC-3'; The 5' end of RV-P2 is marked FAM, and the 3' end is marked MGB; The primer and probe sequences of the canine distemper virus primer-probe set are as follows: CDV-F3: 5'-ACATCCCGCCTCACAGGG-3'; CDV-R3: 5'-CCGCCTCTTGAACCAGGAA-3'; CDV-P3: 5'-CCACGAGGGTATCATCCATCACACACC-3'; The 5' end of CDV-P3 is marked FAM, and the 3' end is marked BHQ1; The primer and probe sequences of the canine / feline parvovirus primer-probe set are as follows: PV-F3: 5'-CGGAAACATGGCTTTAGATGATAC-3'; PV-R3: 5'-TTAACAATTAGTTGCCAATCTCCTG-3'; PV-P3: 5'-CTCCCCAAGCATTTGCATCAACCA-3'; The 5' end of PV-P3 is marked with HEX, and the 3' end is marked with BHQ1; The primer and probe sequences of the *Begonia scimitarium* primer-probe set are as follows: Bas-F3: 5'-GGGTCTTGGGAGGTTTTACCTG-3'; Bas-R3: 5'-CCTCAACACTCCAAACACGTCC-3'; Bas-P3: 5'-ATTTGAATACTAGACGAAACCCG-3'; The 5' end of Bas-P3 is marked ROX, and the 3' end is marked MGB; The primer and probe sequences of the Toxoplasma gondii primer-probe set are as follows: Tox-F2: 5'-CCCTCTGCTGGCGAAAAGTG-3'; Tox-R2: 5'-CTTTCACGATCTCTTCTCCTGTTC-3'; Tox-P1: 5'-CAGGCGACCAATCTGCGAATACACC-3'; The 5' end of Tox-P1 is marked ROX, and the 3' end is marked BHQ2; The primer and probe sequences of the Klebsiella pneumoniae primer-probe set are as follows: Kp-F2: 5'-GCCACAATCAAGGACTATCTCG-3'; Kp-R2: 5'-ACTCCAGATCGGGTTCATTGC-3'; Kp-P1: 5'-CCAATAGTCGGTCGCGCAGCCTG-3'; The 5' end of Kp-P1 is marked CY5, and the 3' end is marked BHQ2; The primer and probe sequences of the internal standard primer-probe set are as follows: Internal standard-F3: 5'-AAAGGTAGCATAATCATTTGTTCTC-3'; Internal standard-R3: 5'-TAGGGTCTTCTCGTCTTATTGTCTT-3'; Internal standard -P1: 5'-ACTGTCTCTTACTTCCAATCAGTGA-3'; the 5' end of internal standard -P1 is marked with HEX, and the 3' end is marked with MGB.

2. A digital PCR detection kit for multiple pathogens in giant pandas, characterized in that, Includes the digital PCR primer and probe set for detecting multiple pathogens in giant pandas as described in claim 1.

Images