Site-specific chimeric aptamers and uses thereof

CN122623027APending Publication Date: 2026-08-21ITALIAN NAT RES COUNCIL +1
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202480074914.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2023-10-20
Filing Date
2024-10-18
Publication Date
2026-08-21

AI Technical Summary

Benefits of technology

[0012]In yet another embodiment, the present invention describes a site-specific chimeric ligand or a pharmaceutical composition comprising the chimeric ligand capable of inhibiting DNA methyltransferase 1 (DNMT1) at a specific target gene site, according to the present disclosure, for the treatment of cancers, neurological diseases, neurodegenerative diseases, and rare diseases characterized by abnormal or altered DNA methylation, including Fragile X syndrome (FXS), Alzheimer's disease and Alzheimer-like disorders, as well as rare diseases including Fragile X syndrome (FXS).

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The present invention relates to the field of chimeric aptamers suitable for RNA-based therapies with high target specificity. In particular, the present invention relates to the use of chimeric aptamers in the manufacture of a pharmaceutical composition for the treatment of a disease characterized by altered DNA methylation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of chimeric ligands with high gene-targeting specificity applicable to RNA-based therapies.

[0002] Specifically, the present invention relates to the use of chimeric ligands in the preparation of pharmaceutical compositions for treating diseases characterized by altered DNA methylation. Background Technology

[0003] DNA methylation is a key epigenetic modification that primarily occurs in CpG dinucleotides and is mediated by members of the DNA methyltransferase (DNMT) family (DNMT1, DNMT2, DNMT3A, DNMT3B, and DNMT3L). Numerous studies have established links between aberrant promoter DNA methylation and cancer. These aberrant epigenetic modifications occurring under pathological conditions are reversible, providing unique potential pathways for altering gene function reprogramming and malignant cell transformation. Based on this, specific and effective epigenetic targeting with inhibitors can lead to the development of clinically relevant strategies for treating cancer and other diseases characterized by altered methylation.

[0004] Aptamers are small (6-30 kD) synthetic nucleic acids that function as high-affinity ligands. They are obtained through a screening process called SELEX (Spiritual Evolution of Ligand Systems), which relies on the target protein's ability to select high-affinity ligands from a random library of nucleic acids. In addition to being cost-effective and relatively easy to manipulate, aptamers exhibit high affinity for their targets (in the low nanomolar range), specificity similar to monoclonal antibodies, and high tissue penetration comparable to small molecules. Furthermore, aptamers are neither immunogenic nor toxic. All these characteristics make them ideal candidate molecules for diagnostic and clinical applications.

[0005] WO 2021 / 086266 describes an RNA-based demethylating molecule called aptaDiR, which combines the low cytotoxicity characteristic of modified RNA. AptaDiRs exhibit a wide range of demethylating effects due to their ability to selectively bind to and inhibit the DNMT1 enzyme, and because they act on the ubiquitous DNMT1 enzyme, they lead to widespread and non-specific gene activation in cancer cells.

[0006] Due to the non-specific effects of currently available approaches, there is a need to provide aptamer-based alternatives for RNA-based therapies that have higher targeting specificity than existing available drugs, for the development of novel drugs to treat cancer and other conditions characterized by altered methylation. Summary of the Invention

[0007] The problem this invention aims to solve is to prepare a site-specific chimeric ligand: captaDiR (chimeric aptaDiR), which can reverse site-specific hypermethylation that leads to gene silencing, for use in the preparation of drugs intended to treat cancer, as well as neurological diseases, neurodegenerative diseases, and rare diseases.

[0008] This invention addresses this problem by using site-specific chimeric ligands capable of inhibiting DNA methyltransferases at specific genomic sites. Unlike aptaDiR, which cannot target specific DNA regions, captaDiR is designed to selectively bind to regulatory regions of target genes by forming triple helices or R-loops.

[0009] Therefore, the present invention relates to a site-specific chimeric ligand (captaDiR) that can inhibit DNA methyltransferase 1 (DNMT1) at a specific target gene site, wherein the chimeric ligand comprises: - A first domain, which is an oligonucleotide (DNA, RNA, or modified RNA) whose sequence is derived from aptaDiR or an aptaDiR-like sequence, forming a stem-loop RNA structure capable of interacting with DNMT1; and - The second structural domain, which is: Gene-specific oligonucleotides (DNA, RNA, or modified RNA) whose sequences can form R-loops with the DNA sequence of the target gene site, thereby anchoring the aptamer to the DNA sequence of a specific target gene site. or Gene-specific oligonucleotides (DNA, RNA, or modified RNA) whose sequences can form a triple helix to a specific target gene site DNA sequence, thereby anchoring the aptamer to the DNA sequence of that specific target gene site. The second domain is fused to the 5' or 3' end of the stem-loop RNA; wherein the site-specific intercalation of the appropriate ligand protects the target gene site from DNMT1-mediated methylation, thereby achieving local activation of gene expression.

[0010] The present invention also relates to a pharmaceutical composition comprising one or more site-specific chimeric ligands according to the present disclosure and one or more pharmaceutically acceptable excipients.

[0011] In a further aspect, the present invention relates to a site-specific chimeric ligand or a pharmaceutical composition comprising the chimeric ligand capable of inhibiting DNA methyltransferase 1 (DNMT1) at a specific target gene site, as disclosed herein, for use as a medicament.

[0012] In yet another embodiment, the present invention describes a site-specific chimeric ligand or a pharmaceutical composition comprising the chimeric ligand capable of inhibiting DNA methyltransferase 1 (DNMT1) at a specific target gene site, according to the present disclosure, for the treatment of cancers, neurological diseases, neurodegenerative diseases, and rare diseases characterized by abnormal or altered DNA methylation, including Fragile X syndrome (FXS), Alzheimer's disease and Alzheimer-like disorders, as well as rare diseases including Fragile X syndrome (FXS). Attached Figure Description

[0013] The features and advantages of the present invention will be described in detail below, with reference to embodiments provided for illustrative purposes and not for limitation, and in the accompanying drawings. Figure 1-7 And it becomes obvious.

[0014] Figure 1 Model of captaDiR action. Demethylated captaDiR (red) is fused with the sequence corresponding to the target gene site (blue). DNMT1 is only locally suppressed, thereby restoring the expression of the target gene.

[0015] Figure 2: Triple helix structure. a) Schematic diagram of triple helix and R-loop structure. b) RNA can form RNA-DNA triple helix structure. Top: Schematic diagram showing the positions of DNA and RNA oligonucleotides. Bottom right: Examples of RNA:DNA hybrids, inverted Hoogsteen (RH triple helix), and R-loop. Bottom left: Annealing results of double-stranded (ds) DNA (probe) with single-stranded (ss) DNA and RNA; 32 The P-labeled double-stranded DNA probe (DT12) was annealed with the corresponding single-stranded oligonucleotide, and the mixture was separated on PAGE.

[0016] Figure 3 Oligonucleotide anchoring that forms a triple helix CEBPA The ability to [implement] CEBPA. Top image: Schematic diagram of the construct. The sequence is engineered under the T7 polymerase promoter to anchor CEBPA and guide the T7 polymerase to exert local activity. Bottom image: Increase in CEBPA transcript in the presence of T7-RNA polymerase.

[0017] Figure 4: CaptaDiR targeting CEBPA. a) CaptaDiR. Fusion of Ce-49 sh aptaDiR (right) with the CEBPA targeting sequence (left). XXXX represents the covalent spacer, a 4-carbon linker; b) Detection of CEBPA and GAD1 levels in K562 cells 72 hours after transfection with 100 nM control (Cont.) or CEBPA-targeting Ce-49 sh (Ce-49-CEBPA) by RT-qPCR.

[0018] Figure 5 Gene-specific conjugates. a) Using a cohesive complementary sequence, captaDiR targeting CEBPA was ligated to a vector aptamer. b) A549 cells (Axl-positive) were either untreated (NT), treated with 500 nM anti-Axl vector aptamer (GL21.T), or treated with GL21.T cells ligated to Ce-49-CEBPA captaDiR (chimera). CEBPA levels were analyzed by RT-qPCR.

[0019] Figure 6 Cell viability after captaDiR transfection. A549 cells were either untreated (NT) or transfected with 100 nM control sequence (Ctrl), Ce-49 sh, and CEBPA captaDiR. Cell viability was measured after 72 hours.

[0020] Figure 7 Reactivation of FMR1 in FXS fibroblasts transfected with aptaDiR. Left panel: FMR1 reactivation occurred one week after two or three treatments with aptaDiR; Right panel: No reactivation was observed after treatment with azacitidine. AptaDiR treatment: 100 nM transfection. Detailed Implementation

[0021] An RNA-based demethylation molecule known as aptaDiR combines two features: low cytotoxicity of modified RNA and the ability to selectively bind to and inhibit the DNMT1 enzyme (WO2021086266), thereby causing widespread demethylation and gene activation in cancer cells.

[0022] This invention relates to an innovative method for preparing chimeric RNA (site-specific chimeric aptamers), named captaDiR (chimeric aptaDiR). captaDiR is a modified aptaDiR that is elongated and includes a targeting sequence capable of guiding the aptamer to a specific gene site. Figure 1 ).

[0023] captaDir can: 1) anchor itself to a specific genomic location, and 2) inhibit DNMT1 enzyme activity, thereby protecting gene sites from DNMT1-mediated methylation and achieving local activation of gene expression.

[0024] CaptaDiR represents a novel RNA-based platform for controlling DNA methylation at predetermined gene sites, and has unexpectedly proven effective in treating diseases such as cancer and any disease associated with a lack of methylation-dependent key proteins.

[0025] Furthermore, compared to well-known aptamer-based chimeric drugs, captaDiR has unique advantages as an epigenetic regulator. In fact, captaDiR exhibits high targeting specificity for nuclear function. Figure 4 This is because the aptaDiR part (which can enter the cell nucleus fused with the anchoring part, thereby anchoring the construct to the genomic site and only locally exerting the aptamer-mediated enzyme inhibition function) is used.

[0026] Therefore, the captaDiR of the present invention holds promise for providing safe and effective targeted therapies for a variety of different diseases.

[0027] Therefore, the present invention relates to a site-specific chimeric aptamer (captaDiR) that can inhibit DNA methyltransferase 1 (DNMT1) at a specific target gene site, wherein the aptamer comprises: - A first domain, which is an oligonucleotide (DNA, RNA, or modified RNA) whose sequence is derived from aptaDiR or an aptaDiR-like sequence, and which interacts with DNMT1 by forming a stem-loop structure; and - The second structural domain, which is: Gene-specific oligonucleotides (DNA, RNA, or modified RNA) whose sequences can anchor aptamers to specific target gene site DNA sequences by forming an R-loop with the DNA sequence of the desired target gene site. or Gene-specific oligonucleotides (DNA, RNA, or modified RNA) whose sequences can form triple helical sequences with the DNA sequence of the desired target gene site, thereby anchoring the aptamer to the DNA sequence of the specific target gene site. The second domain is fused to the 5' or 3' end of the stem-loop RNA; wherein the site-specific intercalation of the appropriate ligand protects the target gene site from DNMT1-mediated methylation, thereby achieving local activation of gene expression.

[0028] A covalent spacer, preferably a 4-carbon joint, may exist between the first and second domains of captaDiR.

[0029] Definitions (as used in this article): - The term "aptamer" refers to a short oligonucleotide RNA that binds to a specific target molecule; - The term "aptaDiR" refers to an aptamer that binds to and inhibits the DNMT1 enzyme.

[0030] The sequence “aptaDiR” has at least 70% sequence identity with sequences selected from the following: SEQ ID NO:31 5' CUGAGCUCAUGGCGAGGCUUCU 3', SEQ ID NO:32 5' UGGGCUGAGCUCAUGGCGAGGCUUC 3', SEQ ID NO: 33 5' CUGAGGCCUAACGAAGGCUUCU 3', SEQ ID NO:34 5' CUGAGGUAAUGGCGAGGCUUCU 3', SEQ ID NO:35 5' AGGUAAUGGCGAGGCUUCUUAUCUG 3', SEQ ID NO:36 5' UUACUGGGCUGAGGUAAUGGCGAGG 3', and SEQ ID NO:37 5'CTGAGGTAATGGCGAGGCTTCT 3'.

[0031] The sequences SEQ ID NO: 31 - SEQ ID NO: 37 are RNA sequences. Uracil "U" can be replaced by thymine "T" and vice versa.

[0032] Preferably, aptaDiR (first domain) has a sequence as shown in SEQ ID NO: 33 5'CUGAGGCCUAACGAAGGCUUCU 3'.

[0033] - The term "stem-loop structure" refers to a base pairing pattern that may occur in single-stranded RNA, also known as a hairpin or hairpin loop; this stem-loop structure is produced when two regions of the same strand (usually complementary nucleotide sequences when read in reverse) pair up to form a double helix and form an unpaired loop at the end.

[0034] - The term "triple helix" refers to a triple-stranded nucleic acid structure consisting of a DNA:RNA or DNA:DNA double helix and an associated non-template single-stranded DNA (see Figure 2a).

[0035] - The term R-loop refers to a triple-stranded nucleic acid structure consisting of an RNA:DNA hybrid and a replaced single-stranded DNA (see Figure 2a); and - The term "Hoogsteen base pairing" refers to a variant of the base pairing pattern in nucleic acids (such as AT pairs). In this pattern, one nucleobase from each of the two strands can bond to each other via hydrogen bonds in the major groove. In some cases, known as "reverse Hoogsteen base pairing," one base is rotated 180° relative to the other (see Figure 2).

[0036] In a preferred aspect, the site-specific aptamer according to the invention is capable of reducing the function of DNMT1 by at least about 10%, preferably at least about 20%, more preferably at least about 30%, and / or the aptamer is capable of increasing the expression level of the target gene.

[0037] In the site-specific chimeric ligands of the present invention, the following preferred aspects may exist: - The first domain of the suitable ligand includes a stem-loop structure comprising two or more pairs of nucleotides; - The first domain of the embedded ligand preferably has a sequence as shown in SEQ ID NO: 33; - The second domain is formed by four or more nucleotides; - The length of the site-specific intercalating ligand is in the range of 15-55 nucleotides, preferably in the range of 30-55 nucleotides, and more preferably in the range of 52 nucleotides. - The site-specific ligand has a covalent spacer between the first and second domains, preferably a 4-carbon linker; - The site-specific chimeric ligand has any chemical and / or structural modifications, including chimeric ligands consisting of multiple copies of an aptamer domain fused with one or more target domains.

[0038] The site-specific ligand sequence according to the present invention depends on the target gene, and preferably, the gene-specific sequence (second domain) of captaDiR is in the range of 16-35 nucleotides in length. When it contains a triple helix forming sequence, the second domain sequence of captaDiR is preferably a poly(Pu) sequence or a poly(Py) sequence complementary to the target gene sequence.

[0039] In a preferred embodiment, captaDiR is specific to target genes selected from the following: CEBPA (CCAAT enhancer-binding protein α), SOCS3 (cytokine signal transduction inhibitor 3), and FMR1 (fragile X messenger ribonucleoprotein 1).

[0040] In a preferred embodiment, captaDiR has the following target sequence: For CEBPA target genes:

[0041]

[0042]

[0043] Where XXXX represents the spacer region, which corresponds to the covalent spacer (4-carbon connector).

[0044] The present invention also relates to a pharmaceutical composition comprising one or more site-specific chimeric ligands according to the present disclosure and one or more pharmaceutically acceptable excipients.

[0045] Currently, two FDA-approved compounds (5-azacytidine and 5-aza-2'-deoxycytidine) inhibit DNMT and reduce overall DNA methylation levels. However, they lack selectivity and exhibit high toxicity and chemical instability (Doi:10.1126 / science.aaj2239). Therefore, there is a need to develop smart and safe epigenetic drugs that can regulate the expression of specific genes. The CaptaDiR of this invention addresses these unfortunate problems and can reverse aberrant DNA methylation in a gene-specific manner, thereby reversing gene-specific silencing. Unexpectedly, this specific regulation of gene expression has been found to be effective in treating pathological conditions associated with aberrant DNA methylation, namely: cancer, neurological diseases, neurodegenerative diseases, and rare genetic disorders.

[0046] In a further aspect, the present invention relates to a site-specific chimeric ligand or a pharmaceutical composition comprising the chimeric ligand capable of inhibiting DNA methyltransferase 1 (DNMT1) at a specific target gene site, as disclosed herein, for use as a medicament.

[0047] In yet another embodiment, the present invention describes a site-specific chimeric ligand or a pharmaceutical composition comprising the chimeric ligand capable of locally inhibiting DNA methyltransferase 1 (DNMT1) at a target gene site, for the treatment of cancers, neurological diseases, neurodegenerative diseases and rare diseases characterized by abnormal or altered methylation.

[0048] As used herein, conditions / diseases characterized by altered or aberrant DNA methylation can include, but are not limited to, aging (including Alzheimer's disease and Alzheimer's-like diseases); abnormal proliferative disorders (such as cancer); autoimmune diseases; genetic diseases; metabolic diseases; mental illnesses; imprinted disorders associated with genetic syndromes such as Beckwith-Wiedeman syndrome (BWS), Prader-Willi syndrome (PWS), Angelman syndrome (AS), Albright hereditary osteodystrophy (AHO), pseudohypoparathyroidism type 1A (PHP-IA), pseudohypoparathyroidism type 1B (PHP-IB); loss of imprint (LOI), which is considered the most common and earliest epigenetic alteration in cancer, such as the LOI of IGF2 / H19 in Wilms' tumor; and duplication instability disorders in which the amplification of trinucleotide (TNR) repeat sequences leads to silencing of related genes, as observed in Fragile X syndrome and myotonic dystrophy.

[0049] The efficacy and gene specificity of captaDiR will be tested to correct aberrantly acquired DNA methylation at specific gene loci and / or restore the expression of normally imprinted parental alleles in the case of mutations, deletions, or uniparental disomy (UPD) at specific gene loci.

[0050] The term "cancer" encompasses diseases involving both precancerous and malignant cancer cells. In some instances, cancer refers to the localized overgrowth of cells that has not yet spread to other parts of the subject—a benign tumor. In other instances, cancer can refer to a malignant tumor that has invaded and destroyed adjacent body structures and spread to distant sites. In some instances, diseases characterized by abnormal DNA methylation may include, but are not limited to, acute lymphoblastic leukemia, acute myeloid leukemia, adrenocortical carcinoma, AIDS-related cancers, AIDS-related lymphomas, anal cancer, appendiceal cancer, astrocytoma (cerebellum or cerebrum in children), basal cell carcinoma, bile duct cancer, bladder cancer, bone cancer, brainstem glioma, and brain tumors (cerebellar astrocytoma, cerebral astrocytoma / malignant glioma, ependymoma, medulloblastoma, supratentorial primitive neuroectodermal tumor). Tumors, visual pathway and hypothalamic gliomas), breast cancer, bronchial adenoma / carcinoid tumors, Burkitt lymphoma, carcinoid tumors (children, gastrointestinal), cancers of unknown primary origin, central nervous system lymphoma (primary), cerebellar astrocytoma, cerebral astrocytoma / malignant glioma, cervical cancer, childhood cancers, chronic lymphocytic leukemia, chronic myeloid leukemia, chronic myeloproliferative disorders, colon cancer, cutaneous T-cell lymphoma, desmoplastic small round cell tumors. Tumors, endometrial cancer, ependymoma, esophageal cancer, Ewing sarcoma (a member of the Ewing sarcoma family), extracranial germ cell tumors (children), gonadal extragerminal tumors, extrahepatic bile duct cancer, ocular cancer (intraocular melanoma, retinoblastoma), gallbladder cancer, gastric (stomach) cancer, gastrointestinal carcinoid tumors, gastrointestinal stromal tumors, germ cell tumors (children's extracranial, gonadal, ovarian), gestational trophoblastic tumors, gliomas (adults, children's brainstem, children's cerebral astrocytoma, children's visual pathway and hypothalamus), gastric carcinoid tumors, hairy cell leukemia, head and neck cancer, hepatocellular carcinoma, Hodgkin's lymphoma, hypopharyngeal cancer, hypothalamic and visual pathway gliomas (children), intraocular melanoma, islet cell carcinoma, Kaposi's sarcoma, renal cell carcinoma, laryngeal cancer, leukemia (acute lymphoblastic, acute... Myeloid, chronic lymphocytic, chronic myeloid, hair cell), lip and oral cancer, liver cancer (primary), lung cancer (non-small cell, small cell), lymphoma (AIDS-related, Burkitt, cutaneous T-cell, Hodgkin's, non-Hodgkin's, primary central nervous system), macroglobulinemia (Waldenstrom), malignant fibrous histiocytoma / osteosarcoma of bone, medulloblastoma (children), melanoma, intraocular melanoma, Merkel cell carcinoma, mesothelioma (adult malignancy, children), metastatic squamous cell carcinoma of the neck with unknown primary site, oral cancer, multiple endocrine adenoma syndrome (children), multiple myeloma / plasma cell tumor, mycosis fungoides, myelodysplastic syndrome (MDS), myelodysplastic / myeloproliferative disordersMyeloid leukemia (chronic / chronic myeloid leukemia (CML)), myeloid leukemia (adult acute, childhood acute), multiple myeloma, myeloproliferative disorders (chronic), nasal cavity and sinus carcinoma, nasopharyngeal carcinoma, neuroblastoma, non-Hodgkin lymphoma, non-small cell lung cancer, oral cancer, oropharyngeal carcinoma, osteosarcoma / malignant fibrous histiocytoma of bone, ovarian cancer, ovarian epithelial carcinoma (surface epithelial-stromal tumor), ovarian germ cell tumor, low-potency ovarian tumor, pancreatic cancer, pancreatic cancer (islet cells), sinus and nasal cavity carcinoma, parathyroid carcinoma, penile cancer, pharyngeal cancer, pheochromocytoma, pineal astrocytoma, pineal germ cell tumor, pineal blastoma and supratentorial primitive neuroectodermal tumor (children), pituitary adenoma, plasma cell tumor, pleural pulmonary blastoma, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell carcinoma (renal cancer), transitional cell carcinoma of the renal pelvis and ureter, retina. Leukoblastoma, rhabdomyosarcoma (children), salivary gland cancer, sarcoma (Ewing family tumors, Kaposi's, soft tissue, uterus), Sezary syndrome, skin cancer (non-melanoma, melanoma), skin cancer (Melker cell), small cell lung cancer, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, squamous cell carcinoma of the neck of unknown primary origin (metastatic), gastric cancer, supratentorial primitive neuroectodermal tumor (children), T-cell lymphoma (skin), testicular cancer, pharyngeal cancer, thymoma (children), thymoma and thymic carcinoma, thyroid cancer, thyroid cancer (children), transitional cell carcinoma of the renal pelvis and ureter, trophoblastic tumor (pregnancy), cancer of unknown primary origin (adults, children), transitional cell carcinoma of the ureter and renal pelvis, urethral cancer, uterine cancer (endometrium), uterine sarcoma, vaginal cancer, visual pathway and hypothalamic glioma (children), vulvar cancer, Waldenström macroglobulinemia, and nephroblastoma (children).

[0051] In some instances, diseases characterized by abnormal DNA methylation can be cancer. In some instances, cancer can be chronic myeloid leukemia (CML), myelodysplastic syndromes (MDS), and / or non-small cell lung cancer (NSCLC), including adenocarcinoma (e.g., human alveolar basal epithelial adenocarcinoma), squamous cell carcinoma, and / or combinations thereof.

[0052] Cancers involved in cancer treatment include those associated with C / EBP α expression, such as myelodysplastic syndromes (e.g., acute myeloid leukemia or myeloproliferative neoplasms), head and neck cancer, liver cancer (e.g., hepatocellular carcinoma and hepatocellular carcinoma), lung cancer (e.g., adenocarcinoma and non-small cell lung cancer), prostate cancer (e.g., adenocarcinoma), and skin cancer (e.g., squamous cell carcinoma).

[0053] Aberrant methylation of specific genes is associated with cancer progression and / or dominant phenotypes in cancers such as: RB in retinoblastoma; CDKN2A (INK 4A and ARF transcripts) in lung and colon cancer; CDH1 in breast, gastric, thyroid, leukemia, and liver cancer; CDH13 in lung, ovarian, and pancreatic cancer; TIMP3 in brain and kidney cancer; VLH in renal cell carcinoma; MLH in colon, endometrial, and gastric cancer; MGMT in brain, colon, lung, and breast cancer; BRCA1 in breast and ovarian cancer; GSTP1 in prostate, liver, colon, breast, and kidney cancer; SMARCA3 in colon and gastric cancer; RASSF1 in lung, liver, and brain cancer; SOCS1 in liver, colon, and multiple myeloma; ESR1 in colon cancer, estrogen receptor-negative breast cancer, lung cancer, and leukemia; and DAPK1 in lymphoma.

[0054] Advantageously, the site-specific chimeric ligands of the present invention exhibit several advantages in treating pathologies associated with specific alterations in DNA methylation.

[0055] The CaptaDiR method has broad applicability and can be used for a variety of pathological conditions, including neurological disorders, neurodegenerative diseases, and rare diseases such as Fragile X syndrome (FXS) associated with site-specific DNA methylation abnormalities. FXS is caused by the amplification (>200 units) of the CGG fragment in exon 1 of the FMR1 gene (FM: full mutation) followed by cytosine methylation (MFM: methylated FM), which leads to transcriptional silencing of the gene and loss of protein products.

[0056] The high binding capacity of chimeric ligands makes them highly attractive molecules for clinical applications. In fact, chimeric ligands exhibit cost-effectiveness and high stability, and are easily modified for their in vivo use, thus providing highly selective, chemically stable, and molecularly adaptable demethylation tools for the reactivation of specific genes.

[0057] Despite the therapeutic potential of DNA methylation targeting, no new hypomethylation therapies have been approved in the past few decades. The results described in this article provide the first instance of RNA-guided specific epigenetic therapy, offering great hope for personalized and low-toxicity targeted treatments.

[0058] Compared to existing hypomethylation-based approaches, chimeric ligands offer a novel and effective tool with several significant advantages: 1) reduced toxicity; 2) absence of undesirable off-target effects; and 3) high target gene specificity. The ability to control the expression of individual genes holds the promise of enabling a fundamental shift towards personalized therapy.

[0059] The various embodiments and aspects of the present invention as defined above and in the claims below are experimentally supported in the following examples using commercial cell lines.

[0060] Furthermore, when this invention relates to the use of primary cells derived from patients affected by FXS, these primary cells are provided by the Catholic University of the Sacred Heart and obtained with the patient's informed consent and approval from the relevant ethics committee.

[0061] Example The following embodiments, together with the foregoing description, illustrate some implementations of the present invention.

[0062] Example 1 The inventors of this application have previously isolated a group of DNMT1-specific RNA aptamers with high stability that can inhibit DNMT1 activity (WO 2021 / 086266).

[0063] This application relates to a novel and more efficient RNA-based platform for controlling DNA methylation at predetermined gene sites, namely the CaptaDiR method.

[0064] As a proof-of-concept study, the CEBPA gene (CCAAT enhancer-binding protein α) was used. CEBPA encodes a transcription factor containing a basic leucine zipper (bZIP) domain and can recognize the CCAAT motif in the promoter of target genes.

[0065] As shown in Figure 2b, using CEBPA As a proof-of-principle target, a region in the extra coding region (ecCEBPA) of the gene that can form a triple helix structure was identified.

[0066] To prove these areas are anchored CEBPA The ability to genetically engineer sequences under the T7 polymerase promoter was discovered. It was found that in the presence of T7 polymerase, CEBPA Increased transcripts indicate that the identified region can bind to the gene site and guide the T7 polymerase to exert local activity. Figure 3 ).

[0067] Most importantly, a chimeric RNA was designed by fusing the 5' end of an aptaDiR (Ce-49 sh) with a identified CEBPA targeting sequence (Ce-49-CEBPA). Figure 4 a). After transfection into K562 cells, this construct retained its ability to upregulate CEBPA, similar to Ce-49 sh aptaDiR. Figure 4 b).

[0068] Most importantly, it does not upregulate the GAD1 gene, while Ce-49 sh does. Figure 4 b).

[0069] Furthermore, we demonstrated that Ce-49 sh-CEBPA captaDiR can be coupled to the vector aptamer using a sticky-terminal-based strategy. Figure 5 a). As a proof-of-concept, an anti-nuclease RNA aptamer called GL21.T was used, which binds to and inhibits the Axl receptor overexpressed in a variety of tumor types, including non-small cell lung cancer (NSCLC). This aptamer, constructed and characterized by our group, has been widely used for the selective delivery of therapeutic RNA.

[0070] It has been demonstrated that GL21.T can effectively deliver Ce-49-CEBPA into Axl-positive A549 NSCLC cells. Figure 5 b), after treatment, CEBPA was induced to be upregulated.

[0071] It was also found that transfection with the CEBPA-specific construct led to a significant decrease in cell viability, which is consistent with the expected result as a CEBPA upregulated molecule. Figure 6 ).

[0072] CaptaDiR according to the present invention is effective in treating rare diseases associated with site-specific DNA methylation abnormalities, such as Fragile X syndrome (FXS). It has been demonstrated that CaptaDiR can restore FMR1 expression after transfection of FXS fibroblasts. Figure 7 Based on these encouraging data, the captaDiR method holds promise as a platform for achieving selective demethylation of FMR1 for the safe treatment of FXS.

[0073] Based on the above description and embodiments, the advantages of the product described and obtained according to the present invention are obvious.

Claims

1. A site-specific chimeric aptamer (captaDiR) capable of inhibiting DNA methyltransferase 1 (DNMT1) at a specific target gene site, wherein the aptamer comprises: - A first domain, which is an oligonucleotide whose sequence is derived from aptaDiR, interacts with DNMT1 by forming a stem-loop RNA structure; and - The second structural domain, which is: Gene-specific oligonucleotides have sequences that can form R-loops with the DNA sequence of the target gene site, thereby anchoring the aptamer to the DNA sequence of a specific target gene site. or Gene-specific oligonucleotides have sequences that can form triple helical sequences with the DNA sequence of a specific target gene site, thereby anchoring the aptamer to the DNA sequence of that specific target gene site. The second domain is fused to the 5' or 3' end of the stem-loop RNA, and the site-specific intercalation of the appropriate ligand protects the target gene site from DNMT1-mediated methylation, thereby achieving local activation of gene expression.

2. The site-specific chimeric ligand according to claim 1, wherein, The aptamer can reduce the function of DNMT1 by at least about 10%, and / or the aptamer can increase the expression level of the target gene.

3. The site-specific chimeric ligand according to claim 1 or 2, wherein, The first domain of the embedded suitable ligand has a sequence as shown in SEQ ID NO:

33.

4. The site-specific chimeric ligand according to any one of claims 1-3, wherein, When the second domain forms a triple helix sequence, it forms an RNA-DNA triple helix structure by pairing with the DNA sequence of a specific target gene site through reverse Husstan base pairing.

5. The site-specific chimeric ligand according to any one of claims 1-4, wherein the length of the site-specific chimeric ligand is in the range of 15-55 nucleotides, preferably in the range of 30-55 nucleotides, and more preferably in the range of 52 nucleotides.

6. The site-specific chimeric ligand according to any one of claims 1-5, wherein the site-specific chimeric ligand has a target gene selected from the group consisting of: CEBPA (CCAAT enhancer-binding protein α), SOCS3 (cytokine signal transduction inhibitor 3), and FMR1 (fragile X messenger ribonucleoprotein 1).

7. The site-specific chimeric ligand according to any one of claims 1-6, wherein the site-specific chimeric ligand has any chemical and / or structural modifications, including chimeric ligands consisting of multiple copies of an aptamer domain fused with one or more target domains.

8. The site-specific chimeric ligand according to any one of claims 1-7, wherein the site-specific chimeric ligand has the sequence shown in SEQ ID NO:

46.

9. A pharmaceutical composition comprising one or more site-specific chimeric ligands according to any one of claims 1-8 and one or more pharmaceutically acceptable excipients.

10. The site-specific chimeric ligand capable of inhibiting DNA methyltransferase 1 (DNMT1) at a specific target gene site according to any one of claims 1-8, or the pharmaceutical composition according to claim 9, used as a medicament.

11. The site-specific chimeric ligand capable of inhibiting DNA methyltransferase 1 (DNMT1) at a specific target gene site according to any one of claims 1-8, or the pharmaceutical composition according to claim 9, for the treatment of cancer, neurological diseases, neurodegenerative diseases, and rare diseases characterized by abnormal or altered DNA methylation, said neurodegenerative diseases including Alzheimer's disease and Alzheimer's-like diseases.

12. The site-specific chimeric ligand or pharmaceutical composition used according to claim 11, wherein, The cancer mentioned was selected from: Optionally, diseases characterized by abnormal DNA methylation are chronic myeloid leukemia (CML), myelodysplastic syndrome (MDS), and / or non-small cell lung cancer (NSCLC), including adenocarcinoma (e.g., human alveolar basal epithelial adenocarcinoma) and squamous cell carcinoma.

Citation Information

Patent Citations

  • DNMT1 -specific aptamers and production and uses thereof

    WO2021086266A1