NLRP3 protein-specific inactivation mutation model and application thereof
Patent Information
- Application Number
- CN202611114965.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-07-27
- Publication Date
- 2026-09-29
- Estimated Expiration
- 2046-07-27
AI Technical Summary
[0008](2)现有模型无法确证药物的具体结合位点
(1)为AI和结构生物学药物设计提供不可替代的生物学坐标
Smart Images

Figure CN122623637B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedical technology, and more specifically to an NLRP3 protein-specific inactivation mutation model and its application. Background Technology
[0002] The NLRP3 (NOD-like receptor protein 3) inflammasome is one of the most thoroughly studied intracellular multi-protein complexes in the innate immune system, composed of the sensor protein NLRP3, the adaptor protein ASC (apoptosis-associated speck-like protein containing a CARD), and the effector protein Caspase-1. Upon stimulation by various exogenous pathogen-associated molecular patterns (PAMPs) or endogenous damage-associated molecular patterns (DAMPs), NLRP3 oligomerizes and recruits ASC, thereby activating Caspase-1. This ultimately leads to the maturation and secretion of pro-inflammatory cytokines such as IL-1β and IL-18, as well as Gasdermin D-mediated pyroptosis. Aberrant activation of the NLRP3 inflammasome is closely associated with a variety of major diseases, including type 2 diabetes, atherosclerosis, gout, Alzheimer's disease, Parkinson's disease, non-alcoholic steatohepatitis (NASH), and various autoinflammatory diseases. Therefore, NLRP3 is widely recognized as an inflammatory target with extremely high drug potential, and several candidate compounds have entered clinical trials globally.
[0003] Among in vivo research tools related to NLRP3, the most widely used is the NLRP3 whole-body gene knockout (KO) mouse model. This model disrupts the coding sequence of the Nlrp3 gene through traditional gene targeting or CRISPR / Cas9 technology, causing all cells in the mouse body to not express NLRP3 protein. NLRP3 KO mice exhibit complete loss of IL-1β secretion under stimulation by various inflammasome activators (such as Nigericin, ATP, MSU crystals, etc.) and show significant improved survival in an LPS-induced endotoxemia model. This model has become the gold standard tool for NLRP3 functional research, and relevant strains can be obtained from public resource libraries such as Jackson Laboratory.
[0004] Regarding chemical inhibitors, several NLRP3-specific small molecule inhibitors have been reported, including MCC950 (also known as CRID3, CP-456773), OLT1177 (Dapansutrile), Tranilast, BAY 11-7082, and CY-09. Among these, MCC950 is the most extensively studied direct NLRP3 inhibitor. It inhibits NLRP3 oligomerization by binding to the Walker B motif of the NACHT domain of the NLRP3 protein, thereby blocking the ATPase activity of NLRP3. OLT1177 has entered clinical trials for the treatment of gouty arthritis and COVID-19-related inflammation. However, for a considerable period, effective in vivo validation tools have been lacking regarding the exact binding sites, binding modes, and the existence of off-target effects of these inhibitors.
[0005] In the area of pathogenic point mutation models, researchers have constructed various knock-in mouse models based on acquired functional mutations of NLRP3 found in human familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), and infancy-onset multisystem inflammatory diseases (NOMID / CINCA). Representative mutations include A350V (corresponding to human A352V) and L351P (corresponding to human L353P), which are located in the ATPase activity region of the NACHT domain of the NLRP3 protein, leading to overactivation of the NLRP3 inflammasome. These models are mainly used to simulate the pathological process of human autoinflammatory diseases for pathogenesis research and phenotypic validation.
[0006] While the aforementioned existing technologies have played an important role in NLRP3 functional studies and drug screening, they have systemic shortcomings in supporting modern structural biology-driven drug development, specifically as follows:
[0007] (1) The NLRP3 KO model cannot support structure-based drug development. The NLRP3 KO model achieves complete protein loss by disrupting the gene coding sequence, meaning that no NLRP3 protein molecules are present in the mice of this model. From a drug development perspective, this characteristic presents three fundamental limitations: First, it cannot be used for drug-target binding experiments (such as SPR, BLI, ITC, CETSA, etc.) because there is no target protein to bind to; second, it cannot serve as a substrate model for novel drug modalities such as PROTAC (Proteolysis Targeting Chimera), because the effectiveness of PROTACs requires the presence of a target protein; and third, it cannot be used for in vivo binding validation of candidate compounds in AI-driven structural drug design. Therefore, the NLRP3 KO model is essentially a loss-of-function model, a genetic tool for demonstrating "target necessity," rather than a drug development tool.
[0008] (2) Existing models cannot confirm the specific binding site of the drug. Modern drug development increasingly emphasizes site-specific mechanism validation, that is, clearly demonstrating which specific amino acid residue or functional pocket of the target protein a candidate compound binds to. However, neither the NLRP3 KO model nor the pathogenic point mutation model can provide this site-level validation capability. The NLRP3 KO model has no protein to bind to; the mutations introduced by pathogenic point mutation models (such as A350V and L351P) are located in the ATPase active region of the NACHT domain, mainly mimicking human disease phenotypes, and are not rationally designed for drug binding pockets, therefore they cannot be used to reverse-validate drug binding sites. Although chemical inhibitors can block NLRP3 activation at the functional level, their sites of action are often unclear, and there is a lack of corresponding site mutation-loss-of-function control models to confirm their binding sites. This leads to the current predicament in NLRP3 inhibitor development, where the efficacy is known but the underlying mechanism is not, severely restricting the efficiency of drug optimization and iteration.
[0009] (3) Lack of drug-likeness validation models targeting specific sites of C767 The Cys767 residue (C767) of the NLRP3 protein is located in a key functional region of the LRR domain. However, current research has not revealed the core function of this site in the NLRP3 activation process, there are no specific mutation models targeting C767, and its potential as a drug target has not been recognized. This means that: it is impossible to verify in vivo whether C767 is the core functional site for NLRP3 activation; it is impossible to verify whether candidate drugs physically bind to the C767 site; and it is impossible to provide a biological gold standard for AI virtual screening targeting this site. This gap keeps drug development targeting C767 at the theoretical speculation stage, preventing the formation of a closed loop of AI design-biological validation-feedback optimization.
[0010] Therefore, there is an urgent need in this field to construct a C767 point mutation model that preserves the expression of the full-length NLRP3 protein, in order to overcome the limitations of existing whole-genome knockout (KO) models and provide a precise genetic tool for elucidating the biological function of this site and for in situ confirmation of targeted drugs. Summary of the Invention
[0011] In view of this, the present invention provides an NLRP3 protein-specific inactivation mutation model and its application.
[0012] In view of the above-mentioned deficiencies in the existing technology, the present invention aims to solve the following three interrelated technical problems: (1) Confirmation that the C767 site is the core drug-forming site for NLRP3 drug development The first technical problem this invention aims to solve is, while preserving the full-length NLRP3 protein expression, to verify whether a single amino acid mutation at Cys767 to alanine (C767A) is sufficient to cause a specific loss of NLRP3 inflammasome function. If C767A mutant mice exhibit selective inactivation of the NLRP3 pathway (without affecting other inflammasome pathways such as AIM2, NLRC4, and the NF-κB pathway), and show significant protective effects in an endotoxemia model, then C767 is confirmed in vivo as the core functional site for NLRP3 activation, thus providing irrefutable biological evidence for drug development targeting this site.
[0013] (2) Provide basic tools for AI-driven drug screening and optimization The second technical problem this invention aims to solve is to provide a clear target coordinate and validation platform for AI-driven NLRP3 drug design. Current AI drug design relies on the precise definition of the target protein's three-dimensional structure and key functional sites. This invention, through the C767A point mutation model, elevates C767 from a theoretical drug-forming site to a validated drug-forming site in vivo, providing a biological gold standard validation system for computational methods such as AI virtual screening, molecular docking, and free energy calculation. Researchers can perform virtual screening of compound libraries based on the C767 site and compare and validate candidate compounds in WT mice, thus forming a complete closed loop of AI design – biological validation – feedback optimization.
[0014] (3) Solve the problem of in-situ verification of drug-target binding mechanism The third technical problem this invention aims to solve is overcoming the bottleneck of existing NLRP3 KO models being unable to validate drug-target binding. Since C767A mice retain the expression of the full-length NLRP3 protein (with only a single amino acid mutation), this model can serve as an in vitro substrate for validating drug binding mechanisms: by comparing the binding affinity differences between candidate drugs and WT NLRP3 protein and C767A mutant protein, it can be clearly determined whether the drug physically binds to the C767 site. Furthermore, proteins derived from C767A mice can also serve as substrate models for PROTAC drug development, used to evaluate the degradation efficiency and site selectivity of PROTAC molecules targeting NLRP3.
[0015] To solve the above-mentioned technical problems, the present invention adopts the following technical solution: A specific inactivation mutation model for the NLRP3 protein involves point mutation of cysteine at position 767 of the NLRP3 protein to alanine.
[0016] Furthermore, this can be achieved through a combination of CRISPR / Cas9 gene editing and donor targeting. The sgRNA target sequence is: 5'-AGTCTCTGAATGTTACAGCC-3', SEQ ID NO.1; The donor ssODN sequence is: 5'-acacacacacacacacacacacagacttaccacagtctctgaatgttaGCgcctgggtgctggagtgcctcacacagcaccctca-3', SEQ ID NO. 2.
[0017] The method for constructing the above model includes the following steps: (1) Synthesis of sgRNA target sequence and donor ssODN sequence; (2) Microinjection of fertilized eggs: Cas9 mRNA, sgRNA and donor ssODN were co-injected into the pronucleus of mouse fertilized eggs; (3) C767A homozygous mutant mice were finally obtained through embryo transfer, backcrossing and crosscrossing.
[0018] Furthermore, the concentration ratio of sgRNA, donor ssODN, and Cas9 mRNA was 5:2:10.
[0019] The above method is applied in the preparation of non-human mammalian models with endotoxemia resistance phenotype.
[0020] The application of bone marrow macrophages derived from the model constructed by the above method in the preparation of a cell assessment model for inhibited NLRP3 inflammasome activation.
[0021] The application of the model constructed by the above method in the preparation of a platform for the confirmation and validation of drug targets for anti-endotoxemia.
[0022] The above-described model is applied in the preparation of a model for evaluating the targeting specificity and off-target effects of anti-inflammatory candidate drugs.
[0023] The model constructed by the above method serves as a specific control tool for evaluating the in vivo target occupancy and binding specificity of NLRP3 covalent inhibitors.
[0024] Under the same concept, the following alternative solutions can also achieve the purpose of this invention: (1) Alternative gene editing methods: In addition to CRISPR / Cas9-mediated homologous recombination (HDR), a leader editor can be used as a preferred alternative. In addition, CRISPR / Cas12a (Cpf1) can also be used as an alternative nuclease tool for constructing vectors.
[0025] (2) Alternative mouse strains: In addition to the C57BL / 6N strain, the C767A point mutation can be introduced into BALB / c, C57BL / 6J, 129 / Sv or other inbred mouse strains to meet the needs of different immunological research backgrounds.
[0026] (3) Alternative mutation types: In addition to C767A (Cys→Ala), C767 can be mutated to serine (C767S, retaining the hydroxyl group but removing the thiol group) or mutated to a larger amino acid (such as C767W) to block drug binding in a steric manner, achieving a similar site verification purpose.
[0027] (4) Alternative application scenarios: In addition to mouse models, C767A point mutations can be introduced into rats, hamsters or other model animals, or stable cell lines expressing C767A mutant NLRP3 can be constructed for high-throughput drug screening in vitro.
[0028] The C767A point mutation mouse model of this invention occupies a core position in the NLRP3 targeted drug development pipeline for target and mechanism validation, and can be embedded in multiple key stages of the pipeline: (1) Target validation stage: In the early stage of drug development, C767A mice are used to verify the druggability of the C767 site, providing a biological basis for project initiation. If the C767A mutation leads to loss of NLRP3 function and improved mouse phenotype, then C767 is confirmed as a high-value druggable site, supporting the advancement of the project.
[0029] (2) Lead compound discovery stage: After obtaining candidate compounds based on the C767 site coordinates through AI virtual screening, in vivo efficacy screening was first conducted in WT mice to evaluate the anti-inflammatory effects of the compounds. At this time, C767A mice were used as the biological benchmark for "perfect inhibition" to measure the upper limit of the efficacy of the candidate drugs: if the therapeutic effect of the candidate drugs in WT mice could approach the baseline level in C767A mice, it indicated that the drug had achieved deep inhibition of the target. In addition, in vitro screening using primary cells derived from WT and C767A mice could help eliminate off-target effects.
[0030] (3) Lead compound optimization stage: Recombinant expression vectors were constructed using gene sequences provided by C767A mice to prepare purified WT and C767A mutant NLRP3 proteins (or key domain fragments). Through biophysical experiments such as SPR, BLI, and ITC, the differences in binding affinity between the compounds and the two proteins were quantitatively compared to guide chemists in making precise modifications and optimizations to the C767 site to improve binding affinity and selectivity.
[0031] (4) Novel drug model development stage: In the development of PROTAC drugs, primary cells derived from C767A mice are used as protein substrate models. By comparing the degradation efficiency of PROTAC molecules on NLRP3 in WT cells (normal protein expression) and C767A cells (mutated binding site), it is verified whether the degradation effect depends on the specific binding to the C767 site, filling the gap that the NLRP3 KO model cannot be used for this type of mechanism research.
[0032] As can be seen from the above technical solution, compared with the prior art, the present invention has the following beneficial effects: (1) Provides an irreplaceable biological coordinate system for AI and structural biology drug design The NLRP3 KO model achieves complete protein deletion by disrupting the gene coding sequence, providing no information about the function of specific amino acid sites. In contrast, the C767A model of this invention, through precise mutation of a single amino acid, specifically verifies the core functional contribution of the C767 site to NLRP3 activation while preserving all other amino acids in the full-length protein. This result elevates C767 from a theoretical drug-forming site to a validated drug-forming site in vivo, providing a clear target coordinate and a biological gold standard for AI virtual screening, molecular docking, and free energy calculation. The AI drug design platform can screen compound libraries based on the three-dimensional coordinates of the C767 site, validate in vivo efficacy in WT mice, and simultaneously use C767A mice as the 'gold standard' (i.e., maximum inhibition level) for comparison, thus forming a complete closed loop of design-validation-benchmark evaluation—something the NLRP3 KO model, lacking a target protein, simply cannot achieve.
[0033] (2) Retaining the full-length protein supports drug validation at the physicochemical level. NLRP3 KO mice completely lack the NLRP3 protein and its encoding gene, thus failing to provide crucial biological materials for drug mechanism research: they cannot be used to perform cellular-level binding verification such as CETSA (cell thermal displacement assay) using primary cells or tissue lysates from them, nor can their gene sequence be used as a template for the expression and purification of recombinant proteins, thereby failing to support biophysical analysis such as SPR, BLI, and ITC, as well as cryo-electron microscopy / crystal structure determination.
[0034] The C767A mice of this invention retain the expression of the full-length NLRP3 protein, with only Cys767 replaced by Ala, and the overall protein expression level is essentially the same as that of the wild type. This allows researchers to extract NLRP3 protein from C767A mice or construct a purified C767A point mutation protein using the Nlrp3 gene sequence of these mice, and compare it in parallel with the WT protein, directly verifying whether candidate drugs physically bind to the C767 site using biophysical methods. This physicochemical drug validation capability is something that the NLRP3 KO model simply cannot provide, and is one of the core advantages of this invention compared to existing technologies.
[0035] (3) Expanding the application scenarios of novel drug models (PROTAC) PROTAC technology, as a novel drug model, relies on the presence of a target protein for its efficacy. The NLRP3 KO model, lacking expression of the target protein, is completely unsuitable for in vivo efficacy evaluation of PROTAC drugs. The C767A mouse of this invention retains the full-length NLRP3 protein and can serve as a protein substrate model for PROTAC drugs, used to evaluate the degradation efficiency, site selectivity, and in vivo efficacy of PROTAC molecules targeting NLRP3. Furthermore, by comparing the degradation differences of PROTAC in WT and C767A mice, it is possible to verify whether PROTAC exerts its degradation effect by binding to the C767 site, providing crucial information for the rational design of PROTAC drugs. This expanded application scenario gives this invention irreplaceable value in the development of novel drug models.
[0036] (4) It has more precise industrial application value. From an industrial application perspective, the NLRP3 KO model is primarily suitable for basic research and phenotypic validation of NLRP3 function, with its industrial value concentrated in academic research. In contrast, the C767A model of this invention has a clear focus—it is not only an inflammation model but also a target validation tool and a drug development tool. This model can be embedded in multiple key stages of the drug development pipeline: the target validation stage (validating the druggability of C767), the lead compound discovery stage (validation through AI virtual screening), the lead compound optimization stage (validation of binding mechanisms), and the novel drug model development stage (PROTAC substrate model). This multi-stage, multi-scenario industrial application value gives this invention significant technical advantages and commercial value compared to the NLRP3 KO model. Attached Figure Description
[0037] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.
[0038] Figure 1 This is a schematic diagram of the strategy for constructing NLRP3 C767A point mutant mice based on CRISPR / Cas9 technology in Example 1 of the present invention.
[0039] Figure 2 The results of genotypic molecular identification of C767A point mutant mice in Example 1 of this invention are shown. A is an agarose gel electrophoresis image of the PCR amplification product of the target region of F2 generation mice, which shows the electrophoresis results of tail genomic DNA of 7 representative F2 generation mice after amplification with specific primers; B is a Sanger sequencing peak diagram of F2 generation mutant mice.
[0040] Figure 3 This represents the NLRP3 protein expression level in Example 1 of the present invention.
[0041] Figure 4 This figure illustrates the effect of the C767A point mutation on the activity of inflammasomes in primary macrophages in Example 2 of this invention. A represents the secretion level of TNF-α; B represents the secretion level of IL-1β; and C represents the release level of LDH. Quantitative data in the figure are expressed as mean ± standard deviation (Mean ± SD). Each treatment group contained three independent biological replicates (n = 3). Statistical differences among multiple groups were compared using two-way ANOVA, where ns represents no significant difference between groups (P > 0.05). This represents P < 0.001. This means P < 0.0001.
[0042] Figure 5 This figure illustrates the effect of the C767A point mutation on serum cytokine levels in LPS-induced endotoxemia mice, as shown in Example 3 of this invention. A represents TNF-α levels, and B represents IL-1β levels. In in vivo animal experiments, wild-type (WT) and C767A homozygous mutant mice were strictly isolated into male and female cohorts for parallel validation. Quantitative data in the figure are expressed as mean ± standard deviation (Mean ± SD). Each independent experimental group contained 6 to 9 mice (n = 6–9). Statistical differences among multiple groups were compared using two-way ANOVA, where ns represents no significant difference between groups (P > 0.05). This means P < 0.05. This means P < 0.001. This means P < 0.0001.
[0043] Figure 6 This invention illustrates the effect of the C767A point mutation on the survival rate of LPS-induced endotoxemia mice in Example 3. In Example 3, A represents the Kaplan-Meier survival curve of male mice after the modeling challenge, and B represents the Kaplan-Meier survival curve of female mice after the modeling challenge. In the in vivo survival assessment experiment, wild-type (WT) and C767A homozygous mutant mice were strictly validated in male-female independent cohorts. Each independent experimental group contained 15 to 17 mice (n = 15-17). Statistical differences in survival rates between groups were assessed using the Log-rank (Mantel-Cox) test. This means P < 0.001. This means P < 0.0001. Detailed Implementation
[0044] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0045] The experimental materials used in the following examples are as follows: C57BL / 6N mice (SPF grade, 6-8 weeks old, half male and half female) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. All mice were housed in an SPF-grade animal facility with a 12-hour light-dark cycle, and were given free access to standard rodent feed and sterile water. All animal experiments were approved by the institution's animal ethics committee and followed relevant laboratory animal welfare guidelines.
[0046] Cas9 mRNA: Purchased from Nanjing Genscript, catalog number: RP-A00047-0.1.
[0047] sgRNA: chemically synthesized by Nanjing GenScript, with the target sequence 5'-AGTCTCTGAATGTTACAGCC-3', SEQ ID NO.1, corresponding to the exon region where the 767th cysteine codon (TGT) of the mouse Nlrp3 gene is located.
[0048] donor ssODN: a single-stranded oligodeoxynucleotide chemically synthesized by Shanghai Sangon Biotech Co., Ltd., with the sequence: 5'-acacacacacacacacacacacagacttaccacagtctctgaatgttaGCgcctgggtgctggagtgcctcacacagcaccctca-3', SEQ ID NO.2.
[0049] Sanger sequencing primers: used for genotyping, covering a 586 bp region upstream and downstream of the C767 site (as shown in SEQ ID NO. 3).
[0050] 5'-3': SEQ ID NO.3.
[0051] DMEM medium (purchased from Xavier, catalog number: G4511).
[0052] Opti-MEM serum-depleted medium (purchased from Gibco, catalog number: 31985070).
[0053] Fetal bovine serum (purchased from Hyclone, catalog number: H330396.03).
[0054] Penicillin-streptomycin-amphotericidal B solution (purchased from Solarbio, catalog number: P7630).
[0055] LPS (purchased from InvivoGen, catalog number: tlrl-b5lps), for cell experiments.
[0056] LPS (Escherichia coli O55:B5, purchased from Sigma-Aldrich, catalog number: L2880), for in vivo experiments.
[0057] Nigericin (purchased from InvivoGen, product number: tlrl-nig).
[0058] ATP (purchased from Sigma-Aldrich, product number: A6419).
[0059] Imiquimod (purchased from InvivoGen, item number: tlrl-imqs-1).
[0060] CL097 (purchased from MedChemExpress, item number: HY-128799).
[0061] poly(dA:dT) (purchased from InvivoGen, item number: tlrl-patn).
[0062] Flagellin FLA-ST (purchased from InvivoGen, product number: tlrl-stfla).
[0063] DOTAP (purchased from Sigma-Aldrich, item number: 11202375001).
[0064] Mouse IL-1β ELISA kit (purchased from ABclonal, catalog number: RK00006).
[0065] Mouse TNF-α ELISA kit (purchased from ABclonal, catalog number: RK00027).
[0066] LDH cytotoxicity assay kit (purchased from Invitrogen, catalog number: C20300).
[0067] Lipofectamine 3000 (purchased from InvitroGen, catalog number: L3000001) was used for transfection of poly(dA:dT).
[0068] DOTAP (purchased from Sigma-Aldrich, catalog number: D6182) is used for transfection of flagellin and in vivo experiments.
[0069] Example 1 Construction of C767A point mutant mice C767A point mutant mice were constructed using a CRISPR / Cas9+ donor targeting method. The specific steps are as follows: (1) gRNA and donor design and construction: Based on the mouse Nlrp3 gene sequence (reference genome version: GRCm39; Gene ID: 216799; transcript NCBIRefSeq number: NM_145827.4 (where the complete CDS region is located at bases 227 to 3328); encoding amino acid NCBI RefSeq number: NP_665826.1), it was confirmed that the 767th amino acid residue (cysteine, Cys) is located in exon 4, and the corresponding sequence of this exon is 5'-actggtgaactgctgcctcacttctagcttctgccgtggtctcttctcaagtctaagcaccaaccggagcctcactgaactggacctcagtgacaatactctgggagacccgggcatgagggtgctgtgtgaggcactccagcacccaggctgtaacattcagagactgtg-3', SEQ ID NO.4. To target this site, an sgRNA target site was designed with the sequence: 5'-AGTCTCTGAATGTTACAGCC-3', SEQ ID NO.1.
[0070] To introduce the C767A mutation, a single-stranded oligonucleotide (ssODN) was designed as a homologous recombination repair template (Donor). This donor ssODN sequence contains upstream and downstream homologous arms flanking the target site, and in the central core region, the codon encoding Cys767 is mutated to the codon encoding Ala (TGT mutated to GCT). The sequence is: 5'-acacacacacacacacacacacagacttaccacagtctctgaatgttaGCgcctgggtgctggagtgcctcacacagcaccctca-3', SEQ ID NO.2.
[0071] Figure 1 This diagram illustrates the targeting strategy for constructing Nlrp3 C767A site-directed mutant mice based on CRISPR / Cas9 technology according to the present invention. Figure 1 As shown, this invention designs a specific sgRNA targeting the mouse Nlrp3 gene, which can guide the Cas9 nuclease to specifically generate double-strand breaks in the target region. Simultaneously, Figure 1 The image shows a partial length of the Donor repair template for homology-directed repair (HDR). In designing the Donor template, the TGT codon corresponding to cysteine (Cys) at position 767 of the wild-type Nlrp3 protein was strictly replaced with the GCT codon encoding alanine (Ala).
[0072] (2) Intrauterine injection of fertilized eggs and embryo transfer: A mixture of 50 ng / µL (approximately 80-100 pL / ovum, or 4-5 pg / ovum) sgRNA, 20 ng / µL donor ssODN (approximately 1.6-2 pg / ovum), and 100 ng / µL (approximately 80-100 pL / ovum, or 8-10 pg / ovum) Cas9 mRNA was microinjected into fertilized oocytes of C57BL / 6N mice (80-100 pL per oocyte). Homologous directed repair (HDR) was used to induce base substitution mutations at the target sites. After injection, morphologically normal, viable fertilized oocytes were surgically transferred into the oviducts of pseudopregnant mice, awaiting pregnancy and litter birth to obtain F0 generation mice.
[0073] (3) Identification and breeding of F0 generation mice: Ten to fourteen days after birth, tail tissue (0.2–0.5 cm) was harvested from F0 generation mice. Tissue lysis buffer and proteinase K were added, and the mixture was incubated overnight at 55°C. The following day, the mixture was incubated at 100°C for 5 minutes to inactivate proteinase K, followed by centrifugation at 12000 r / min at 4°C for 2 minutes. The supernatant was collected as crude genomic DNA. PCR amplification of the target region was performed using specific primers, with an expected PCR product size of 586 bp.
[0074] PCR reaction system: template 0.5 µL, 10 µM forward primer F 1 µL, 10 µM reverse primer R 1 µL, 2 × Rapid Taq Master Mix 10 µL, and ddH2O to make up to 20 µL.
[0075] PCR reaction conditions: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 56℃ annealing for 15 s, 72℃ extension for 15 s, 35 cycles; final extension at 72℃ for 5 min.
[0076] The specific primer sequences are as follows: Forward primer F: 5'-AGCTCCAGTTTGTGTTTCCT-3', SEQ ID NO.5; Reverse primer R: 5'-AGTGCCGTTGGACTGGTA-3', SEQ ID NO.6.
[0077] PCR products were verified by agarose gel electrophoresis. After confirming a single band, the samples were directly sent for Sanger sequencing. By comparing the sequencing peaks, positive F0 generation mice (first-generation mice) with successful C767A mutation at the target site were screened.
[0078] F0 generation mice were crossed with wild-type C57BL / 6N mice to obtain F1 generation mice. DNA was extracted from the tails of the F1 generation mice again, and PCR and Sanger sequencing were performed to confirm that the mutation site was stably inherited in the germline.
[0079] Finally, F1 generation heterozygous male and female mice containing the target C767A point mutation were crossbred to produce F2 generation mice. PCR and Sanger sequencing were used to select individuals whose sequencing peaks showed a single mutation peak at the mutation site (without a wild-type heterozygous peak). These were the successfully constructed Nlrp3-C767A homozygous point mutant mice, used for subsequent inflammasome activation and model evaluation experiments.
[0080] To verify the accuracy of the model genotype, genomic DNA was extracted from the tail tip tissue of F2 generation mice obtained through breeding. PCR amplification was performed using specific primers. The results showed that the amplified bands were single and clear, with no non-specific amplification, and the molecular weight was consistent with the expectation (expected size 586 bp). Figure 2 A), and then Sanger sequencing.
[0081] This invention has performed complete sequence alignment of the Nlrp3 target region amplification fragment from mutant mice, and some sequencing peak results (such as...) Figure 2 As shown in Figure B, compared to the known standard gene sequence (codon TGT) at this site in wild-type (WT) mice, the sequencing peak diagram of the F2 generation mutant mice constructed in this invention shows a clean single peak GCT at the target site after precise substitution, and no heterozygous peaks overlapping with the wild-type sequence were observed, confirming that the mouse is C767A homozygous. Simultaneously, the sequencing results confirmed that the homologous sequences upstream and downstream of the mutation site were completely correct, with no base deletions, insertions, or other unexpected frameshift mutations, demonstrating the high fidelity of the targeted sequence.
[0082] The above molecular identification results clearly demonstrate that the C767A (TGT→GCT) point mutation has been precisely introduced into the mouse Nlrp3 genome, achieving stable germline inheritance in offspring, and the target sequence is highly faithful. This proves that the Nlrp3-C767A homozygous point mutation mouse model of this invention has been successfully constructed.
[0083] The expression levels of NLRP3 protein in wild-type and Nlrp3-C767A homozygous point mutant mouse models were measured, and the results are as follows: Figure 3 As shown, the results indicate that the overall protein expression level is basically consistent with that of the wild type.
[0084] Example 2 In vitro inflammasome activation assay (BMDM) Extraction and culture of BMDM (bone marrow-derived macrophages) The specific isolation and culture steps for wild-type (WT) and mutant (C767A) mouse bone marrow-derived macrophages (BMDM) are as follows: (1) Preparation of experimental animals and aseptic sampling: Select 6-8 week old, SPF-grade, healthy wild-type (WT) and C767A homozygous mutant mice (male or female). The mice were euthanized by cervical dislocation, and then the entire mouse was immersed in 75% ethanol solution for disinfection for 3-5 minutes.
[0085] Under sterile conditions in a clean bench / biosafety cabinet, sterile ophthalmic scissors and forceps were used to cut open the skin of the mouse hind limbs and separate the complete femur and tibia.
[0086] Thoroughly remove the muscles, fascia, and other connective tissues attached to the bone using sterile gauze or sterile forceps. Place the cleaned femur and tibia in pre-cooled sterile PBS for later use.
[0087] (2) Bone marrow cavity irrigation and cell collection: In a petri dish, use sterile scissors to cut away the epiphyses at both ends of the femur and tibia until the red medullary cavity is exposed.
[0088] Using a 1 mL sterile syringe with a 23G needle, draw up pre-chilled DMEM culture medium and insert it into one end of the bone cavity. Rinse the bone marrow cavity repeatedly until the rinsing fluid becomes clear and the bone appears white and transparent. Collect all rinsing fluid into a pre-chilled 50 mL sterile centrifuge tube.
[0089] (3) Preparation of single-cell suspension and erythrocyte lysis: Gently pipette the collected flushing fluid to disperse the aggregated cell clumps. Filter the cell suspension through a sterile cytometer with a 70µm pore size to remove bone debris and tissue fragments.
[0090] The filtrate was centrifuged at 4℃ and 300 ×g for 5 minutes, and the supernatant was discarded.
[0091] Add an appropriate amount (usually 1-2 mL / mouse) of erythrocyte lysis buffer (ACK Lysis Buffer) to the cell pellet and allow it to stand at room temperature for 2-3 minutes to lyse.
[0092] Immediately afterwards, add 3-5 times the volume of DMEM medium containing 10% FBS to terminate the lysis reaction. Centrifuge again at 4°C, 300 ×g for 5 minutes, discard the supernatant, and obtain bone marrow cell pellet with complete removal of red blood cells.
[0093] (4) Induction of differentiation culture of BMDM: The cell pellet was resuspended using BMDM complete differentiation medium. The formulation of the BMDM complete differentiation medium was: DMEM medium containing 10% fetal bovine serum (FBS), 1% penicillin-streptomycin-amphoteric B mixture, and 30% L929 cell culture supernatant (as a source of macrophage colony-stimulating factor M-CSF).
[0094] After counting using a cell counter, the cells were divided at a rate of 0.2 × 10⁻⁶. 6 Up to 0.4×10 6 Cells were seeded at a density of 10 cells / mL in 10 cm non-tissue culture-treated dishes. The dishes were then incubated in a constant temperature incubator at 37°C with 5% CO2 and saturated humidity.
[0095] (5) Cell differentiation and collection for plating: On day 3 of induced differentiation, half of the original culture medium was discarded, and an equal amount of fresh BMDM complete differentiation medium was added to supplement M-CSF and nutrients. On days 5-7, the cells completely adhered to the culture vessel and extended pseudopodia, thus obtaining mature BMDM cells.
[0096] When collecting cells, remove the original culture medium, wash once with pre-cooled sterile PBS, then add pre-cooled 2.5mM EDTA-PBS and incubate at 4°C for 5-10 minutes. Gently scrape adherent cells with a sterile cell scraper.
[0097] The collected cell suspension was centrifuged at 300 × g for 5 minutes, resuspended, and counted. The cells were then seeded into 12-well plates (7 × 10⁻⁶ wells). 5 (each well contains one inflammasome) and incubated overnight in an incubator for adhesion, to be used in subsequent experiments to activate inflammasomes and verify related functions.
[0098] In vitro inflammasome activation experiment (1) Cell seeding and pre-activation (signal 1): BMDM cells that had been induced to differentiate and mature were suspended in DMEM medium containing 10% FBS at a concentration of 7 × 10⁻⁶. 5 Seeds were placed at a density of 10 cells / well in 12-well cell culture plates. The plates were gently shaken in a crosswise direction and incubated overnight at 37°C with 5% CO2 to allow the cells to fully extend and adhere to the plates.
[0099] The following day, the original serum-containing culture medium was aspirated, and the cells were gently washed once with sterile PBS. Opti-MEM containing 50 ng / mL LPS was added, and the cells were placed in an incubator for pre-activation (Priming) for 4 hours.
[0100] (2) Differential induction stimulation (signal 2): Without discarding or washing the original culture medium, the following inflammasome activators with different physicochemical mechanisms were directly added to the original Opti-MEM medium for the second stage of stimulation. The specific dosing procedures and final concentration settings for different experimental groups in the well plates are as follows: 1) Negative control group (Vehicle, Veh group): After LPS preactivation, no activator was added. Instead, an equal volume of the corresponding solvent (such as deionized water or DMSO) was added to the wells as a background release control.
[0101] 2) NLRP3 inflammasome activation group: Add nigericin to a final concentration of 15 µM and stimulate for 30 minutes. Add adenosine triphosphate (ATP) to a final concentration of 5 mM and stimulate for 30 minutes. Add imiquimod to a final concentration of 40 µg / mL and stimulate for 30 minutes. Add CL097 to a final concentration of 40 µg / mL and stimulate for 30 minutes. Nano-SiO2 was added to a final concentration of 250 µg / mL, and the mixture was stimulated for 6 hours.
[0102] 3) AIM2 inflammasome activation group: Taking the single-well transfection system as an example: Prepare solutions A and B separately. Solution A consists of 50 µL of Opti-MEM serum-depleted medium mixed with 1 µL of Lipofectamine 3000 transfection reagent; Solution B consists of 50 µL of Opti-MEM serum-depleted medium mixed with 1 µg of 1 mg / mL poly(dA:dT) stock solution and 1 µL of P3000 enhancer.
[0103] Add solution B to solution A, gently mix by blowing, and incubate at room temperature for 15 minutes to form liposome-DNA complex.
[0104] After LPS preactivation, add the prepared liposome-DNA complex solution directly to the corresponding culture wells and incubate for another 6 hours in an incubator.
[0105] 4) NLRC4 inflammasome activation group: Take 50 µL of HEPES buffered saline solution (HBS: 20 mM HEPES, 150 mM NaCl, pH = 7.4), add 1 µL of flagellin (stock concentration 1 mg / mL) and mix well. Then add 6 µL of DOTAP cationic liposome transfection reagent. Gently pipette to mix, and incubate at room temperature for 15 minutes to form liposome-protein complexes.
[0106] After LPS pre-activation, the prepared liposome-protein complex solution was directly aspirated and added to the cell culture wells to ensure that flagellin was efficiently delivered into the cytoplasm. The cells were then placed in an incubator and incubated for another 6 hours.
[0107] (3) Collection of cell supernatant and detection of indicators: After the stimulation time set for each group is reached, the cell culture supernatant from each well is immediately collected into a 1.5 mL EP tube.
[0108] The collected supernatant was centrifuged at 1000 ×g for 5 minutes at 4°C to thoroughly precipitate and remove suspended cell debris and detached dead cells, thus avoiding interference from intracellular background proteins on the release amount.
[0109] The clarified supernatant after centrifugation was used for quantitative detection of the following indicators: TNF-α and IL-1β secretion levels and pyroptosis level (LDH release rate).
[0110] The secretion levels of TNF-α and IL-1β were detected using the commercially available ABclonal kit. (1) Reagent preparation 1) Before the experiment, the required reagents should be equilibrated to room temperature.
[0111] 2) After preparing the standards according to the instructions, perform serial dilutions. The standard curve concentrations are set as follows: 1000, 500, 250, 125, 62.5, 31.25, 15.63, and 0 pg / mL. The remaining standards can be stored at 4 ℃ and used within one week.
[0112] 3) The biotinylated antibody working solution is prepared by diluting the concentrated antibody at a ratio of 1:100 with biotinylated antibody diluent and used immediately, and should be used within 30 minutes.
[0113] 4) The streptavidin-HRP working solution is prepared by diluting the concentrate at a ratio of 1:100 with the corresponding diluent and must be used within 30 minutes.
[0114] 5) Dilute the washing solution with double-distilled water at a ratio of 1:20.
[0115] (2) Sample preparation When measuring TNF-α and IL-1β, all samples were diluted 1:20. The standard / sample diluent provided with the kit was used as the diluent.
[0116] (3) Operating steps 1) Add 300 µL of 1×wash buffer to each well, let stand for 40 s and then discard the solution. Repeat this washing step 3 times.
[0117] 2) Add 100 µL of standard / sample diluent to the blank well.
[0118] 3) Add 100 µL of different concentrations of standard or sample to the other wells, seal the plate with sealing film, and incubate at 37 °C for 2 h.
[0119] 4) Discard the liquid in the hole and repeat the washing step in step ①.
[0120] 5) Add 100 µL of biotinylated antibody working solution to each well, seal the plate with a new sealing film, and incubate at 37 °C for 1 h.
[0121] 6) Discard the liquid in the hole and repeat the washing step in step ①.
[0122] 7) Add 100 µL of streptavidin-HRP working solution to each well, seal the plate with a new sealing film, and incubate at 37 °C for 30 min.
[0123] 8) During incubation, turn on the Cytation 5 instrument to preheat.
[0124] 9) Discard the liquid in the hole and repeat the washing steps in step ①.
[0125] 10) Add 100 µL of TMB substrate to each well and incubate at 37 °C in the dark for 15-20 min.
[0126] 11) Add 50 µL of stop solution to each well and immediately place it in the microplate reader. Measure the OD values of each well at 450 nm and 570 nm within 5 min. OD450-OD570 is the actual reading for that well.
[0127] 12) Plot a standard curve using the OD values obtained from the tests, and fit it with 4-PL. Calculate the corresponding concentration of the sample based on the measured OD values from the standard curve.
[0128] The level of LDH release in cell supernatant was detected using the Invitrogen CyQUANT™ LDH cytotoxicity assay kit. (1) Reagent preparation 1) Equilibrate the lysis buffer and termination solution to room temperature before use.
[0129] 2) Substrate stock solution: Add 11.4 mL of double-distilled water to the substrate powder and gently invert to mix until completely dissolved.
[0130] 3) Reaction storage solution: Equilibrate to room temperature in the dark and fully thaw.
[0131] 4) Reaction mixture: Add 600 µL of reaction stock solution to the substrate stock solution, gently invert and mix to prepare the reaction mixture, and store it in the dark for later use.
[0132] (2) Sample preparation LDH assays were performed using fresh cell culture supernatant.
[0133] (3) Operating steps 1) The cells were stimulated according to the experimental design. Spontaneous release wells and maximum release wells were set up. The former was not stimulated, while the latter was lysed with 10× lysis buffer before the end of stimulation to detect the maximum LDH release level of the sample.
[0134] 2) After stimulation, the cell culture supernatant was transferred to a centrifuge tube and centrifuged at 4 ℃ and 3000 r / min for 5 min to remove cell debris. The supernatant was then collected as the sample to be tested.
[0135] 3) Take a new 96-well plate, add 50 µL of sample to each well, then add 50 µL of reaction mixture, mix gently, and incubate at 37°C in the dark for 20 min.
[0136] 4) After incubation, add 50 µL of stop solution to each well and gently tap the bottom of the plate to mix.
[0137] 5) Use the Cytation 5 microplate reader to read the absorbance values of each well at wavelengths of 490 nm and 680 nm. The actual detection value of each well is calculated according to OD. 490 -OD 680 calculate.
[0138] 6) Calculate the LDH release percentage according to the experimental grouping and control settings using the following formula.
[0139] LDH release rate (%) = [(experimental group measured value - spontaneous release group measured value) / (maximum release group measured value - spontaneous release group measured value)] × 100.
[0140] The results are as follows Figure 4 As shown.
[0141] The results showed that: (1) There was no significant difference in TNF-α secretion levels between the WT and C767A groups under all stimulation conditions, indicating that the C767A point mutation did not affect the activation of the NF-κB pathway and the production of TNF-α, that is, the upstream pre-activated signal transduction pathway was intact. Figure 4 A). (2) IL-1β secretion levels showed significant pathway-selective differences: For activators of the NLRP3 inflammasome (Nigericin, ATP, Imiquimod, CL097, Nano-SiO2), IL-1β secretion in the WT group was significantly higher than that in the C767A group; however, for poly(dA:dT) stimulation of the AIM2 inflammasome and Flagellin stimulation of the NLRC4 inflammasome, there was no significant difference in IL-1β secretion levels between the two groups. IL-1β was undetectable in both groups in the Veh group, ensuring baseline comparability. Figure 4 B). (3) The LDH release trend was consistent with that of IL-1β, indicating that NLRP3 inflammasome-mediated pyroptosis was specifically blocked, while AIM2 and NLRC4 inflammasome-mediated pyroptosis were unaffected. Figure 4 C).
[0142] The above results fully demonstrate that the C767A point mutation achieves precise and specific blockade of the NLRP3 inflammasome pathway without affecting other inflammasome pathways such as AIM2 and NLRC4, or the upstream signaling pathway of NF-κB. This result confirms in vitro that C767 is the core functional site for NLRP3 inflammasome activation, providing a solid biological basis for drug development targeting this site.
[0143] Example 3 In vivo LPS-induced endotoxemia model (1) Experimental animals and model grouping: Eight-week-old WT and C767A homozygous point mutant mice with similar body weights were selected. To eliminate interference from sex-difference phenotypic assessment, completely independent male and female mouse cohorts were set up for all in vivo experiments.
[0144] Mice of each strain and sex were randomly assigned to two treatment groups: Control group (Vehicle group): Only a complex of DOTAP and sterile saline was injected; Model group (LPS group): injected with a complex of DOTAP and LPS.
[0145] (2) Modeling of lethal endotoxin shock (intracellular LPS delivery): LPS was delivered into the cytoplasm of mouse cells via cationic liposomes (DOTAP) to strongly activate the inflammasome pathway.
[0146] Based on the pre-experimental mouse weight, the injection solution was calculated and prepared as needed. For the model group (LPS group), a dose of 22.5 mg / kg LPS was mixed with a dose of 40 mg / kg DOTAP, and the two were thoroughly mixed in sterile saline and incubated to form a liposome complex. Finally, the total injection volume per mouse was brought up to 200 µL with sterile saline. For the control group (Vehicle group), an equal dose of 40 mg / kg DOTAP was mixed with sterile saline and incubated to form a complex. The total volume was also brought up to 200 µL with saline.
[0147] The prepared 200 µL solution was injected into mice via intraperitoneal injection (ip).
[0148] (3) Cytokine detection: After injection to establish the model, whole blood samples were collected from the mouse tail vein at 2 hours and 8 hours after stimulation, respectively.
[0149] After the collected whole blood samples were allowed to clot at room temperature, they were centrifuged at 2500 ×g for 15 minutes at 4°C. The supernatant yellow, clear serum was carefully aspirated and transferred to a new sterile centrifuge tube, which was then immediately frozen at -80°C for later use.
[0150] The concentrations of cytokines in serum at corresponding time points were measured using a commercially available mouse TNF-α and IL-1β ELISA kit. The measurement method was the same as in Example 2.
[0151] The results are as follows Figure 5 As shown.
[0152] The results showed that: (1) Two hours after LPS stimulation, regardless of sex, the TNF-α levels in the WT LPS group and the C767A LPS group were significantly higher than those in the WT PBS group, and there was no significant difference between the two groups. Figure 5 A). This indicates that the C767A point mutation does not affect the early activation of the NF-κB pathway and the production of TNF-α. (2) Eight hours after LPS stimulation, regardless of sex, the IL-1β level in the WT LPS group was significantly higher than that in the WT PBS group, while the IL-1β level in the C767A LPS group was close to that in the WT PBS group and significantly lower than that in the WT LPS group. Figure 5 B). This indicates that the C767A point mutation specifically blocks NLRP3 inflammasome-mediated IL-1β maturation and secretion, effectively blocking the late-stage lethal inflammatory response.
[0153] These results further validated, at the in vivo level, the precise blocking effect of the C767A point mutation on the NLRP3 pathway: early warning cytokines (TNF-α, NF-κB pathway dependent) were unaffected, while late lethal inflammatory cytokines (IL-1β, NLRP3 inflammasome dependent) were significantly inhibited. This result is highly consistent with the in vitro BMDM experimental results, jointly confirming C767A's role as a core drug-forming site for NLRP3.
[0154] (4) Survival rate analysis: All mice were given intraperitoneal injections of the complex as described above (the model group was injected with a 200 µL saline complex containing 22.5 mg / kg LPS and 40 mg / kg DOTAP).
[0155] After injection to establish the model, the survival status of mice was observed and recorded every 8 hours for 5 consecutive days (120 hours). Kaplan-Meier survival curves were used to statistically analyze the recorded data.
[0156] All experiments were independently replicated in male and female mouse cohorts.
[0157] The results are as follows Figure 6 As shown.
[0158] The results showed that, regardless of sex, the 5-day survival rate of C767A point mutant mice was significantly higher than that of wild-type (WT) mice. WT mice experienced high mortality rates after intraperitoneal injection of LPS, while C767A mice exhibited a significant survival advantage. This phenotype was highly consistent with in vivo cytokine assays, confirming that the C767A mutation significantly improved the prognosis of mice with endotoxemia by effectively blocking the release of lethal inflammatory factors such as IL-1β mediated by the NLRP3 inflammasome.
[0159] Based on the combined results of in vitro BMDM experiments and in vivo endotoxemia models, this invention fully demonstrates that: (1) the C767A point mutation achieves precise and specific blocking of the NLRP3 inflammasome pathway without affecting the AIM2, NLRC4, and NF-κB upstream pathways; (2) C767A point mutation mice exhibit significant protective effects in the endotoxemia model (significantly improved survival rate); (3) the above results confirm, from both in vitro and in vivo perspectives, that C767 is the core functional site for NLRP3 inflammasome activation, providing an irreplaceable tool model for AI drug design, drug binding mechanism verification, and PROTAC drug development targeting this site.
[0160] In summary, the C767A point mutation mouse model of this invention is fundamentally different from existing NLRP3 KO models, chemical inhibitors, and pathogenic point mutation models: it is not just another inflammation model, but a target validation tool and a drug development tool. By preserving full-length protein expression and precisely mutating the C767 site, this invention simultaneously achieves in vivo confirmation of the core druggable site of C767, provides target coordinates for AI drug design, in-situ validation of the drug-target binding mechanism, and expands the PROTAC drug substrate model, filling the gap in existing technologies for structural drug development tools and demonstrating significant innovation and industrial application value.
[0161] NLRP3 is one of the most promising inflammatory targets in the global biopharmaceutical field, with several candidate compounds already in clinical trials, covering indications for major diseases such as gout, NASH, Alzheimer's disease, Parkinson's disease, and type 2 diabetes. The C767A point mutation mouse model of this invention serves as a target validation tool and drug development tool, offering the following commercial value: First, it provides NLRP3 inhibitor development companies with a site-specific mechanism validation tool, significantly improving the accuracy and efficiency of drug optimization; second, it provides AI drug design companies with biologically validated target coordinates, enhancing the credibility of AI prediction results; third, it provides PROTAC drug development companies with an NLRP3 protein substrate model, expanding the application scenarios of novel drug models; fourth, as a tool model patent in patent portfolio design, it can form a patent combination with NLRP3 inhibitor compound patents, PROTAC patents, etc., constructing a complete intellectual property barrier.
[0162] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.
[0163] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.
Citation Information
Patent Citations
Drug screening cell model with NLRP3 (NLR family, pyrin domain containing 3) as target spot and application of drug screening cell model
CN103667195A
Mouse macrophage system with nlrp3 gene knocked out and construction method thereof
CN106978399A