Cat omega interferon mutant and application thereof

Abstract

The application provides a cat omega interferon mutant and application thereof, and belongs to the field of interferon genetic engineering, and aims to provide a cat omega interferon mutant with high activity. The amino acid sequence of the cat omega interferon mutant is shown in SEQ ID NO: 2, 4, 5 or 6. The mutant has high biological activity, and the antiviral specific activity reaches 6.6*10 7 IU / mg.

Description

Technical Field

[0001] This invention belongs to the technical field of interferon gene engineering, specifically relating to a feline ω-interferon mutant and its applications. Background Technology

[0002] Feline interferon-ω (FeIFN-ω) belongs to the type I interferon family and is mainly produced by leukocytes. It possesses broad-spectrum antiviral, antiproliferative, and immunomodulatory activities. Compared to feline alpha interferon, which also belongs to the type I interferon family, feline interferon-ω has a broader spectrum of biological activities and lower species restriction. Studies have shown that feline interferon-ω has 160 times the antiviral activity against H9N2 avian influenza virus and 4 times the antiviral activity against canine distemper virus, and it can also exert its effects effectively on non-feline cells.

[0003] Recombinant feline interferon-omega (rFeIFN-ω) was the first interferon formulation approved for use in cats. Developed by Virbac in France and marketed under the brand name "Virbagen Omega," it is the world's first and most well-known recombinant feline interferon-omega drug. Produced using a silkworm-baculovirus eukaryotic expression system, it is widely used to treat viral infections such as feline calicivirus (FCV), feline herpesvirus-1 (FHV-1), and feline panleukopenia (FPV). Clinical studies have shown that rFeIFN-ω significantly reduces the severity of symptoms and shortens the course of viral respiratory infections in cats, and effectively reduces mortality in feline panleukopenia treatment by modulating inflammation and immune responses. Due to factors such as tariffs and cold chain transportation, the price of a single dose can reach thousands of yuan.

[0004] The industrial application of recombinant feline ω-interferon still faces the following technical bottlenecks: First, the production cost is high, as it is produced using a silkworm-baculovirus expression system, which is far more expensive than prokaryotic expression systems. Second, the prokaryotic expression product has insufficient activity. To reduce production costs, researchers have attempted to express feline ω-interferon using prokaryotic systems such as E. coli. However, prokaryotic expression systems lack post-translational modification capabilities, and the expressed target protein often exists in inclusion body form, requiring renaturation to obtain an active protein. The renaturation process is complex and has a low recovery rate. Third, the activity of wild-type interferon needs to be improved; researchers have obtained wild-type feline ω-interferon with an antiviral activity of only 6.3 × 10⁻⁶. 5 U / mL. There are at least 13 subtypes of feline ω-interferon, with amino acid sequence homology among the subtypes reaching 95%-99%, but their antiviral activities vary significantly. Currently, there are few reports on improving the activity of feline ω-interferon through site-directed mutagenesis, and there is a lack of clear combinations of mutation sites that can enhance the activity.

[0005] Currently, the number of pet cats in my country is surging, while effective vaccines and treatments are lacking, especially commercially available feline interferon-omega-1 (FeO2). Therefore, accelerating the research and development of feline biological agents is imperative. In summary, existing technologies still lack a feline interferon-omega-1 product that possesses both high biological activity and can be mass-produced at low cost. Therefore, there is an urgent need in this field to develop a feline interferon-omega-1 mutant with higher activity, lower production costs, and suitability for industrial production to meet the growing demand for clinical medication in pets. Summary of the Invention

[0006] The purpose of this invention is to overcome the above-mentioned shortcomings in the prior art and provide a feline ω-interferon mutant with high biological activity, so as to solve the technical problems of high production cost, insufficient product activity and complex refolding process of existing recombinant feline ω-interferon products, and provide a better drug option for the treatment of feline viral diseases.

[0007] To develop a highly active FeIFN-ω, this invention screened and obtained a highly active feline interferon-ω mutant, mutFeIFN-ω, which was then prepared using a prokaryotic expression system. Specifically, the recombinant plasmid pCold GST-mutFeIFN-ω was constructed; the recombinant protein mutFeIFN-ω was solublely expressed in *E. coli* BL21(DE3) competent cells. SDS-PAGE results showed that mutFeIFN-ω exhibited high protein expression levels and relatively few contaminating proteins under 15℃ induction conditions; the protein was purified by affinity chromatography, yielding 50 mg / 100 mL. Antiviral activity analysis of the purified prokaryotically expressed mutFeIFN-ω product was performed on Crandell-Ress feline kidney cells (CRFK). The results showed that mutFeIFN-ω exhibited antiviral biological activity against feline calicivirus (FCV) of up to 6.6 × 10⁻⁶. 7 IU / mg, its inhibitory effect is significantly higher than that of commercially available feline interferon products.

[0008] Specifically, the present invention provides the following technical solutions:

[0009] To achieve the above objectives, the first aspect of the present invention provides a cat ω-interferon mutant (mutFeIFN-ω) which, relative to wild-type cat ω-interferon (FeIFN-ω), has amino acid substitutions R87H, I128L and / or T165R.

[0010] In this invention, the amino acid positions are numbered based on the amino acid sequence shown in SEQ ID NO:1. According to one specific embodiment, the amino acid sequence of the wild-type cat ω-interferon is as shown in SEQ ID NO:1.

[0011] According to a preferred embodiment, the amino acid sequence of the cat ω-interferon mutant is shown in SEQ ID NO:2, 4, 5 or 6.

[0012] A second aspect of the present invention provides a nucleic acid molecule that encodes the feline ω-interferon mutant described in the first aspect of the present invention.

[0013] Due to the degeneracy of codons, any nucleotide sequence capable of encoding the amino acid sequence shown in SEQ ID NO:2, 4, 5, or 6 falls within the scope of protection of this invention. According to one specific embodiment, the nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO:3, which has been codon-optimized for the *E. coli* expression system.

[0014] A third aspect of the present invention provides an expression vector comprising the nucleic acid molecule described in the second aspect of the present invention.

[0015] The expression vector can be selected from prokaryotic expression vectors or eukaryotic expression vectors, including but not limited to pET series, pGEX series, pMAL series, pCold series, pcDNA series, etc.

[0016] According to a preferred embodiment, the expression vector is pCold GST, which contains a cold shock promoter, enabling efficient protein expression under low-temperature induction, and the N-terminal GST tag helps improve the solubility and stability of the target protein, facilitating subsequent affinity purification.

[0017] A fourth aspect of the present invention provides a host cell comprising the nucleic acid molecule described in the second aspect of the present invention or the expression vector described in the third aspect of the present invention.

[0018] The host cell can be selected from prokaryotic or eukaryotic cells, including but not limited to Escherichia coli, Bacillus subtilis, yeast, insect cells, mammalian cells, etc.

[0019] According to a preferred embodiment, the host cell is Escherichia coli BL21(DE3), which has a fast growth rate, low culture cost, and clear genetic background, making it suitable for large-scale industrial production.

[0020] The fifth aspect of this invention provides a method for preparing a feline ω-interferon mutant, comprising culturing the host cells described in the fourth aspect of this invention under conditions suitable for expressing the feline ω-interferon mutant, and isolating the feline ω-interferon mutant from the culture. Specifically, it includes the following steps:

[0021] (1) Culturing the host cells described in the fourth aspect of the present invention;

[0022] (2) Add an inducer to the culture medium to induce the expression of the target protein cat ω interferon mutant;

[0023] (3) Isolate the cat ω-interferon mutant from the culture.

[0024] According to a specific implementation plan, the conditions for inducing expression are as follows: when the OD600 value of the bacterial culture reaches 0.4-0.6, the culture is rapidly cooled, for example, to about 15°C, IPTG is added to a final concentration of 0.5-1.0 mM, and the culture is shaken and cultured at 15-20°C for 20-24 hours.

[0025] According to a preferred embodiment, the preparation method further includes a step of removing endotoxins. More preferably, endotoxin removal is performed using Triton X-114 liquid phase separation, and the treatment is carried out in at least two rounds, preferably three rounds, to reduce the endotoxin content to below 50 EU / mg, meeting the standards for veterinary biological products for injection.

[0026] A sixth aspect of the present invention provides a pharmaceutical composition comprising the feline ω-interferon mutant described in the first aspect of the present invention and a pharmaceutically acceptable carrier.

[0027] The pharmaceutically acceptable carrier is selected from one or more of buffer solutions, isotonic adjusters, stabilizers, surfactants, and preservatives. Specifically, the buffer solution is selected from phosphate buffer, citrate buffer, and Tris-HCl buffer; the isotonic adjuster is selected from sodium chloride, potassium chloride, mannitol, sorbitol, and glucose; the stabilizer is selected from trehalose, sucrose, lactose, human serum albumin, and gelatin; and the surfactant is selected from polysorbate 20, polysorbate 80, and poloxamer 188.

[0028] The pharmaceutical composition can be formulated into dosage forms such as injections, lyophilized powder for injection, sprays, and eye drops. Preferably, the pharmaceutical composition is a lyophilized powder for injection.

[0029] The seventh aspect of the present invention provides the use of the feline ω-interferon mutant described in the first aspect of the present invention in the preparation of a medicament for treating viral infectious diseases in cats.

[0030] The viral infection is selected from one or more of the following: feline calicivirus infection, feline herpesvirus-1 infection, feline panleukopenia virus infection, feline infectious peritonitis virus infection, feline leukemia virus infection, and feline immunodeficiency virus infection.

[0031] Compared with the prior art, the present invention has the following beneficial effects:

[0032] 1. High biological activity

[0033] The mutant strain of this invention significantly enhances the affinity of feline ω-interferon for its receptor. As determined by the cytopathic effect inhibition assay, the antiviral specific activity of the mutant strain of this invention reaches 6.6 × 10⁻⁶. 7 IU / mg (Example 6) is the price of commercially available recombinant feline interferon-ω (approximately 2 × 10⁻⁶). 7 The levels were 3.3 times higher than those of the wild type (IU / mg). Dual-luciferase reporter gene assays showed that the mutant of this invention exhibited significantly higher activation capacity for the interferon-stimulated response element (ISRE) than the wild type (Example 8). Figure 7 ).

[0034] 2. Soluble expression and no renaturation required.

[0035] This invention employs a low-temperature induction strategy (15℃) and GST tag assistance to successfully achieve soluble expression of the feline ω-interferon mutant in Escherichia coli. SDS-PAGE results show that the target protein is mainly present in the supernatant after bacterial cell lysis, with soluble protein accounting for more than 25% of the total expression. The inclusion body formation rate is less than 10% (Example 3). This avoids the inclusion body renaturation process required for traditional prokaryotic expression, simplifies the operation process, and preserves the native conformation of the protein.

[0036] 3. Deep removal of endotoxins ensures good safety.

[0037] This invention employs the Triton X-114 liquid chromatography method for endotoxin removal. After three rounds of extraction, the endotoxin content decreased from 13000 EU / mL to 20 EU / mg (Table 1), far below the standard for veterinary biological products (<50 EU / mg), avoiding pyrogenic reactions in animals, and the protein recovery rate reached 75.2% (Table 2, Example 5). Cytotoxicity experiments showed that the mutant of this invention after endotoxin removal had no significant effect on CRFK cell viability (Example 6, Example 5). Figure 3 This indicates that it has good biocompatibility and is suitable for animal injection administration.

[0038] 4. Economical and efficient processes suitable for industrial production

[0039] This invention utilizes an Escherichia coli prokaryotic expression system, with production costs only 1 / 10 that of eukaryotic expression systems (such as the silkworm-baculovirus system). Under optimized conditions, 100 mL of bacterial culture can yield 50 mg of the target protein after purification (Example 4), with a production cycle of only 3 days. The purified protein, as identified by SDS-PAGE, has a purity >95%. Figure 1 , Figure 5 It meets the quality standards for biological products. Attached Figure Description

[0040] Figure 1The expression (lanes 1 and 2) and purification (lanes 6-9) results of the target protein, feline ω-interferon mutant, are shown by SDS-PAGE. Lanes 1 and 2 show the SDS-PAGE results of the supernatant bacterial solution induced during the expression of the target protein, feline ω-interferon mutant. Lanes 3-5 show the SDS-PAGE results of the eluted contaminating proteins during the GST tag purification process. Lanes 6-9 show the SDS-PAGE results of the eluted and purified target protein.

[0041] Figure 2 The protein concentration standard curve for the BCA assay is shown. The horizontal axis represents the protein content at different concentrations, and the vertical axis represents the OD562 value corresponding to different protein concentrations.

[0042] Figure 3 The study showed the effect of different concentrations of feline interferon-ω mutant on CRFK cell proliferation, with the x-axis representing the concentration of feline interferon-ω mutant and the y-axis representing the relative cell viability of CRFK cells. The results indicated no significant difference in the effect of feline interferon-ω mutant on CRFK cell proliferation (p>0.05). Data are presented as mean ± SD of three independent experiments, n=3. One-way ANOVA was used to compare differences between groups, with ns indicating no significant difference (p>0.05).

[0043] Figure 4 The assay showed significant differences in the inhibitory activity of different concentrations of the feline ω-interferon mutant on FCV replication in CRFK cells (p<0.05). The x-axis represents different concentrations of the mutant, and the y-axis represents the viral titer TCID. 50 Data are presented as mean ± SD from three independent experiments, n=3. A t-test was used to compare the differences between each concentration group and the control group; * indicates p<0.05.

[0044] Figure 5 The SDS-PAGE electrophoresis images of the target protein, cat ω interferon mutant, before and after endotoxin removal are shown.

[0045] Figure 6 The bar chart shows the activity analysis of feline ω-interferon mutants and commercial products in inhibiting FCV viral replication. The horizontal axis represents mutants at different dilutions, and the vertical axis represents the viral titer TCID. 50 Data are expressed as mean ± SD of three independent experiments, n=3. A t-test was used to compare differences between the two groups. Statistical differences (p<0.05) were indicated by *, and insignificant differences (p>0.05) were indicated by ns.

[0046] Figure 7A bar chart comparing ISRE activation of the mutant and wild-type interferon-stimulated gene using a dual-luciferase assay is shown. The x-axis represents different concentrations of interferon used in the mutant and wild-type assays, and the y-axis represents the fold change in reporter gene expression. Data are presented as mean ± SD from three independent experiments, n = 3. A t-test was used to compare differences between the two groups.

[0047] Figure 8 A bar chart comparing the ISRE activation of interferon-stimulated genes by three-site mutants, single-site mutants (T165R, I128L, R87H), and wild-type (Mock) is shown. The horizontal axis represents each mutant and the wild-type (Mock), and the vertical axis represents the fold change in reporter gene expression. Detailed Implementation

[0048] The present invention is further illustrated by the following embodiments, but no embodiment or combination thereof should be construed as limiting the scope or embodiments of the invention. The scope of the invention is limited by the appended claims. Based on this specification and general knowledge in the art, those skilled in the art can clearly understand the scope of the claims. Without departing from the spirit and scope of the invention, those skilled in the art can make any modifications and alterations to the technical solutions of the invention, and such modifications and alterations are also included within the scope of the invention.

[0049] Unless otherwise stated, the experimental methods used in the following examples are conventional methods, such as those described in Molecular Cloning: A Laboratory Manual by J. Sambrook et al.; unless otherwise stated, the reagents and materials used are commercially available.

[0050] In this study, the composition of solid LB (Luria-Bertani) medium was as follows: 10.0 g / L tryptone, 5.0 g / L yeast extract, 10.0 g / L sodium chloride, 12-15 g / L agar, and deionized water to a final volume of 1 liter.

[0051] In this study, the composition of LB liquid medium was: 10.0 g / L tryptone, 5.0 g / L yeast extract, 10.0 g / L sodium chloride, and deionized water to a final volume of 1 liter.

[0052] In this invention, the term "feline ω-interferon" or "FeIFN-ω" refers to ω-type interferon derived from the genus *Felis catus*, belonging to the type I interferon family. It is primarily produced by leukocytes and possesses antiviral, antiproliferative, and immunomodulatory activities. Compared to feline α-interferon, which is also a type I interferon, feline ω-interferon exhibits broader-spectrum antiviral activity and lower species restriction. The representative amino acid sequence of wild-type feline ω-interferon is shown in SEQ ID NO:1 (GenBank accession number: ABD78705.1).

[0053] In this invention, the term "mutant" refers to a protein whose amino acid sequence contains one or more altered amino acid residues (including substitution, deletion, or insertion) compared to a reference protein (such as wild-type feline interferon-ω). The feline interferon-ω mutant of this invention refers to an amino acid substitution of R87H, I128L, T165R, or any combination thereof, based on the wild-type feline interferon-ω sequence. According to a preferred embodiment, the amino acid sequence of the mutant is as shown in SEQ ID NO: 2, 4, 5, or 6.

[0054] In this invention, the amino acid positions are numbered based on the mature cat ω-interferon protein sequence shown in SEQ ID NO:1. For example, "R87H" indicates that arginine (R) at position 87 of SEQ ID NO:1 is replaced with histidine (H); "I128L" indicates that isoleucine (I) at position 128 is replaced with leucine (Leu, L); and "T165R" indicates that threonine (Thr, T) at position 165 is replaced with arginine (Arg, R).

[0055] In this invention, the term "wild-type" refers to a natural amino acid sequence isolated from nature and not artificially modified. It should be noted that feline ω-interferon exists in multiple natural isotypes, with amino acid sequence homology among the isotypes reaching 95%-99%. The "wild-type feline ω-interferon" described in this invention specifically refers to the amino acid sequence shown in SEQ ID NO:1, which serves as the comparison benchmark for the mutants of this invention.

[0056] In this invention, the term "nucleic acid molecule" refers to an isolated polynucleotide containing a nucleotide sequence encoding the cat ω-interferon mutant of this invention. Due to codon degeneracy, many different nucleotide sequences can encode the same amino acid sequence. To accommodate efficient expression in a specific host (such as *E. coli*), the coding sequence can be codon-optimized. According to a preferred embodiment, the nucleic acid molecule encoding the amino acid sequence shown in SEQ ID NO:2 is shown in SEQ ID NO:3.

[0057] In this invention, the term "expression vector" refers to a recombinant nucleic acid molecule capable of guiding the expression of its target gene in a suitable host cell. The expression vector of this invention comprises an operably linked promoter, a nucleic acid molecule encoding the cat ω-interferon mutant of this invention, and elements such as transcription / translation termination signals. The expression vector can be a plasmid, viral vector, phage vector, etc. According to a preferred embodiment, the expression vector is a prokaryotic expression vector pCold GST, which contains a cold shock promoter, enabling efficient protein expression under low-temperature induction, and its N-terminal GST tag helps improve the solubility and stability of the target protein, facilitating subsequent affinity purification.

[0058] In this invention, the term "host cell" refers to a cell introduced into the expression vector of this invention, which can be used to produce the feline ω-interferon mutant or its fusion protein of this invention. Suitable host cells include prokaryotic cells (such as Escherichia coli, Bacillus subtilis) and eukaryotic cells (such as yeast, insect cells, mammalian cells). According to a preferred embodiment, in order to reduce costs and simplify the process, the host cell is Escherichia coli BL21(DE3) strain.

[0059] In this invention, the term "pharmaceutical composition" refers to a composition comprising the feline ω-interferon mutant of this invention as the active ingredient, and one or more pharmaceutically acceptable carriers, diluents, or excipients. "Pharmaceutically acceptable carrier" refers to those carriers that, when used in mammals, particularly felines, are suitable for contact with the tissues of a subject without excessive toxicity, irritation, allergic reactions, or other problematic complications, within a reasonable medical judgment, and have a reasonable benefit / risk ratio. The carrier should be compatible with the active ingredient of this invention.

[0060] In this invention, the term "treatment" refers to interventions undertaken to combat a disease state, including preventing the onset of disease, alleviating disease symptoms, slowing disease progression, preventing disease spread, or reducing the recurrence rate of disease.

[0061] In this invention, the term "TCID" 50 "(Half-maximal dose of infection in tissue culture) refers to the viral dilution that causes cytopathic effects in 50% of cell culture wells, and is a commonly used indicator for measuring viral titer."

[0062] In this invention, the term "cytopathic effect inhibition method" refers to a method for evaluating interferon activity by measuring the ability of interferon to inhibit viral-induced cytopathic effects. It is an internationally recognized standard method for measuring interferon activity.

[0063] Test Method Description

[0064] SDS-PAGE electrophoresis

[0065] SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) is a commonly used method for determining the molecular weight and purity of proteins. Its principle is as follows: SDS, as an anionic detergent, binds to the hydrophobic regions of proteins, causing them to denature and acquire a negative charge, the amount of which is directly proportional to the protein's molecular weight. Reducing agents such as β-mercaptoethanol can cleave disulfide bonds, resulting in complete linearization of the protein. Under the molecular sieving effect of the polyacrylamide gel, the migration rate of the protein is inversely proportional to the logarithm of its molecular weight. The position and purity of the protein bands can be observed by Coomassie brilliant blue staining or silver staining.

[0066] In this invention, the typical composition of the protein loading buffer (reduced form) is as follows: 250 mmol / L Tris-HCl (pH 6.8), 10% SDS, 0.5% bromophenol blue, 50% glycerol, and 5% β-mercaptoethanol. Before use, it should be mixed with the protein sample in the specified proportions. For example, 5× loading buffer should be mixed with the protein sample at a volume ratio of 1:4 to achieve a final buffer concentration of 1×. The mixed sample should be heated in a boiling water bath for 5-10 minutes to ensure sufficient protein denaturation.

[0067] BCA protein concentration assay

[0068] The principle of BCA method for determining protein concentration is: under alkaline conditions, the peptide bonds in protein molecules can release Cu. 2+ Reduced to Cu + Two molecules of BCA (diquinoline carboxylic acid) can react with one Cu. + The protein chelates to form a stable purple complex. This complex exhibits strong absorbance at 562 nm, and the protein concentration shows a good linear relationship with the absorbance within the concentration range of 20-2000 μg / mL.

[0069] The standard operating procedure is as follows: Follow the instructions for the BCA protein concentration assay kit. First, prepare the BCA working solution by mixing reagent A and reagent B at a volume ratio of 50:1. Prepare protein standards by diluting BSA to a series of concentration gradients. Take a 96-well plate, add 20 μL of protein standard or appropriately diluted sample to each well, then add 200 μL of BCA working solution and vortex to mix. Incubate at 37°C for 30 minutes. Measure the absorbance at 562 nm using a microplate reader. Plot a standard curve with standard concentration on the x-axis and absorbance on the y-axis. Calculate the protein concentration of the sample from the standard curve based on its absorbance, and multiply by the dilution factor to obtain the stock solution concentration.

[0070] CCK-8 assay for cell viability

[0071] The principle of the CCK-8 assay for cell viability is as follows: the water-soluble tetrazolium salt WST-8 in the CCK-8 reagent can be reduced by dehydrogenases in the mitochondria of living cells, generating an orange-yellow formazan product. The amount of formazan product is directly proportional to the number of living cells and inversely proportional to cytotoxicity. By measuring the absorbance at a wavelength of 450 nm, the number of living cells can be indirectly reflected.

[0072] The standard operating procedure is as follows: Place CRFK cells in the logarithmic growth phase at an appropriate density (e.g., 1 × 10⁶ cells per well). 4 (Number of cells) were seeded into 96-well plates, 100 μL per well, and cultured overnight to allow cell adhesion. The old culture medium was discarded, and 100 μL of culture medium containing different concentrations of the test sample was added to each well, with 3-5 replicates for each concentration. A negative control and a blank control group were also included. The cells were cultured for an appropriate time (e.g., 24-48 hours). 10 μL of CCK-8 solution was added to each well and gently mixed. Incubation continued for 1-4 hours. The absorbance at 450 nm was measured using a microplate reader. Cell viability (%) = [(Absorbance of test sample wells - Absorbance of blank control wells) / (Absorbance of negative control wells - Absorbance of blank control wells)] × 100%.

[0073] Interferon antiviral activity assay

[0074] The antiviral activity of interferon was determined using an internationally recognized cytopathic effect inhibition (CPE) assay. The principle is that interferon can induce cells to establish an antiviral state, thereby inhibiting cytopathic effects caused by viral infection. Interferon samples were serially diluted and added to pre-cultured monolayer cells for a certain period. Then, a specific titer of challenge virus was added, and the cells were cultured until complete cytopathic effects appeared in the virus control wells. The cytopathic effect was observed in each dilution well. The reciprocal of the highest interferon dilution that inhibited 50% cytopathic effects was defined as the interferon activity unit (IU / mL).

[0075] Dual-luciferase reporter gene assay

[0076] The dual-luciferase reporter gene assay is a sensitive method for detecting the activity of the interferon signaling pathway. Its principle is as follows: a reporter plasmid containing an interferon-stimulated response element (ISRE) is transfected into target cells; this plasmid expresses firefly luciferase. A Renida luciferase expression plasmid (i.e., the RLTK plasmid) is co-transfected as an internal control. When cells are stimulated by interferon, the ISRE is activated, driving the expression of firefly luciferase. By detecting the ratio of firefly luciferase to Renida luciferase activity, the activation capacity of interferon on the ISRE can be quantitatively evaluated.

[0077] This method is more sensitive than Western blot, has a simpler detection method, and is not affected by other substances in the cell, making it suitable for comparing the activity differences of different interferon samples.

[0078] Detailed description of the technical solution

[0079] 1. Cat ω-interferon mutant

[0080] This invention provides a cat ω-interferon mutant, the core improvement of which is that, relative to wild-type cat ω-interferon, it includes amino acid substitutions of R87H, I128L and / or T165R.

[0081] Through in-depth molecular simulations and extensive experimental research, the inventors discovered that these three amino acid sites are located in a key region where the cat ω-interferon molecule interacts with its receptor. In the wild-type sequence, the local conformation formed by amino acids 87, 128, and 165 is not the optimal conformation for receptor binding. By replacing these three sites with histidine, leucine, and arginine, respectively, the spatial conformation of the interferon molecule can be significantly altered, enhancing its affinity for the receptor and thus greatly improving its biological activity.

[0082] According to a specific implementation, the amino acid sequence of the wild-type feline interferon-ω is shown in SEQ ID NO:1, and the amino acid sequence of the feline interferon-ω mutant is shown in SEQ ID NO:2, 4, 5 or 6.

[0083] The mutant sequence differs from SEQ ID NO:1 only in amino acids at positions 87, 128, and 165; the remaining positions are identical, and the sequence is shown in SEQ ID NO:2, 4, 5, or 6.

[0084] 2. Nucleic acid molecules encoding mutants

[0085] The nucleic acid molecule of this invention encodes the aforementioned feline ω-interferon mutant. Considering the codon preferences of different host cells, the coding sequence can be optimized to improve the expression level of the target protein in specific hosts.

[0086] According to a specific implementation scheme, the nucleic acid molecule encoding the feline ω-interferon mutant shown in SEQ ID NO:2 is shown in SEQ ID NO:3. This sequence has been codon-optimized for the E. coli expression system.

[0087] Those skilled in the art should understand that, due to the degeneracy of codons, any nucleotide sequence capable of encoding the amino acid sequence shown in SEQ ID NO:2, 4, 5 or 6 falls within the protection scope of this invention.

[0088] 3. Expression vectors containing nucleic acid molecules

[0089] The expression vector of the present invention comprises the above-mentioned nucleic acid molecules. The choice of expression vector depends on the host cell system used. For prokaryotic expression systems, vectors such as the pET series, pGEX series, pMAL series, and pCold series can be selected; for eukaryotic expression systems, vectors such as the pcDNA series, pCDNA3.1 series, and pCEP4 series can be selected.

[0090] According to a preferred embodiment, the expression vector is pCold GST. This vector has the following advantages: (1) It contains a cold shock promoter (cspA), which can efficiently express the target protein under low temperature induction at 15°C. The low temperature environment is conducive to the correct folding of the protein and reduces the formation of inclusion bodies; (2) It has a glutathione S-transferase (GST) tag at the N-terminus, which can improve the stability and solubility of the target protein. At the same time, it can be purified in one step by GST affinity chromatography, which is simple to operate; (3) It contains a thrombin cleavage site, which can remove the GST tag after purification to obtain the target protein in its native conformation.

[0091] 4. Host cells containing expression vectors

[0092] The host cell of this invention comprises the above-described expression vector. The selection of the host cell should consider factors such as the compatibility with the expression system, production cost, and safety.

[0093] According to a preferred embodiment, the host cell is *Escherichia coli* BL21(DE3). This strain is one of the most commonly used host bacteria in prokaryotic expression systems and has the following advantages: (1) fast growth rate and short culture cycle; (2) low culture medium cost, suitable for large-scale industrial production; (3) clear genetic background and convenient operation.

[0094] In other embodiments, the host cell may also be other prokaryotic cells, such as Escherichia coli Rosetta, Origami, or Bacillus subtilis; or eukaryotic cells, such as Pichia pastoris, CHO cells, HEK293 cells, etc.

[0095] 5. Preparation method of cat ω-interferon mutant

[0096] This invention also provides a method for preparing a cat ω-interferon mutant. The method includes the following steps:

[0097] (1) Culture host cells: Culture host cells containing the expression vector of the present invention in a suitable culture medium to grow to a suitable density.

[0098] (2) Induction of expression: According to the characteristics of the expression vector used, add an inducer at an appropriate time to induce the expression of the target protein. For the pCold GST vector, when the OD600 value of the bacterial culture reaches 0.4-0.6, quickly place the culture on ice to cool for 30 minutes, then add IPTG, for example, to a final concentration of 1.0 mM, and culture at low temperature with shaking (culture at 15°C for 20-24 hours with shaking).

[0099] (3) Collect bacterial cells: Collect bacterial cells by centrifugation and store them at -20℃ for later use.

[0100] (4) Cell disruption: Resuspend the bacterial cells in an appropriate buffer solution, add lysozyme and protease inhibitor, and sonicate after ice bath until the bacterial solution is clear.

[0101] (5) Separation and purification: Centrifuge and collect the supernatant, then purify the target protein using a GST affinity chromatography column. Refer to the instructions for the commercially available kit for specific procedures.

[0102] According to a preferred embodiment, the preparation method further includes a step of removing endotoxins. Because recombinant proteins produced by E. coli expression systems often contain high levels of endotoxins, they are unsuitable for animal injection. Therefore, appropriate methods are needed to remove the endotoxins.

[0103] More preferably, endotoxin removal is performed using Triton X-114 liquid-phase separation. Triton X-114 is a nonionic surfactant with unique phase separation properties. When the temperature is above its cloud point (approximately 20-22°C), Triton X-114 undergoes phase separation in solution, forming a hydrophobic phase rich in detergent and an aqueous phase rich in water-soluble substances. Endotoxin molecules have a strongly hydrophobic lipid A structure, which can bind to the hydrophobic end of Triton X-114. During temperature-induced phase separation, they are encapsulated into the detergent phase and removed by centrifugation.

[0104] The specific operating steps are as follows: Add Triton X-114 to the protein solution to a final concentration of 1%–2% (v / v), and let it stand at 4°C for 30 minutes to allow the endotoxin to fully bind with the detergent; transfer the sample to a 37°C water bath and incubate for 15 minutes to induce phase separation; centrifuge at room temperature (2000×g, 5 minutes) to separate the two phases; carefully aspirate the upper aqueous phase (containing the target protein) and transfer it to a new tube. To improve the endotoxin removal rate, the above operation can be repeated 2–3 times. Finally, remove residual Triton X-114 by dialysis or ultrafiltration. Using this method, after three rounds of extraction, the endotoxin content can be reduced to below 20 EU / mg, meeting the injection standards for veterinary biological products (<50 EU / mg), and the protein recovery rate can reach over 75%.

[0105] 6. Pharmaceutical Compositions

[0106] The present invention also provides a pharmaceutical composition comprising the present invention’s cat ω interferon mutant as an active ingredient, and one or more pharmaceutically acceptable carriers, diluents or excipients.

[0107] Suitable carriers include, but are not limited to: buffers, such as phosphate-buffered saline (PBS), citrate buffer, Tris-HCl buffer, etc.; isotonic adjusters, such as sodium chloride, potassium chloride, mannitol, sorbitol, glucose, etc.; stabilizers, such as trehalose, sucrose, lactose, mannose, human serum albumin, gelatin, etc.; surfactants, such as polysorbate 20, polysorbate 80, poloxamer 188, etc.; and preservatives, such as benzyl alcohol, phenol, thimerosal, etc.

[0108] The pharmaceutical composition of the present invention can be formulated into various dosage forms as needed, including but not limited to injections (solutions, suspensions, emulsions), lyophilized powder for injection, sprays, eye drops, etc. Preferably, the pharmaceutical composition is a lyophilized powder for injection, which is reconstituted with sterile water for injection or physiological saline before use.

[0109] The preparation method of lyophilized formulations typically includes: dissolving the active ingredient and excipient in an appropriate amount of water for injection, filtering to remove bacteria, dispensing into vials, lyophilizing, and then sealing and storing. The lyophilization process includes three stages: pre-freezing, primary drying (sublimation drying), and secondary drying (desorption drying).

[0110] 7. Applications

[0111] The present invention also provides the use of the said feline ω-interferon mutant in the preparation of a medicament for treating viral infectious diseases in cats.

[0112] The viral infections in cats include, but are not limited to, infections caused by the following viruses: feline calicivirus (FCV), feline herpesvirus-1 (FHV-1), feline panleukopenia virus (FPV, i.e., feline parvovirus), feline infectious peritonitis virus (FIPV), feline leukemia virus (FeLV), feline immunodeficiency virus (FIV), etc.

[0113] In this invention, "viral infectious diseases of cats" refers to viral infections occurring in cats, including infections caused by feline viruses and infections caused by non-feline viruses that can infect cats.

[0114] The antiviral effects of type I interferons (including IFN-ω) do not depend on specific viral antigens, but are achieved by inducing host cells to express a series of antiviral proteins (ISGs). Existing technology has clearly demonstrated that feline ω interferon is effective against feline viral infections. Therefore, those skilled in the art can reasonably expect that the mutants of the present invention can also be used to treat feline viral infections.

[0115] According to a preferred embodiment, the use includes the preparation of a medicament for treating feline calicivirus infection. Studies have shown that the feline ω-interferon mutant of the present invention has a significant inhibitory effect on feline calicivirus, with an antiviral specific activity as high as 6.6 × 10⁻⁶. 7 With an IU / mg concentration, it is more than three times that of existing commercial products, and has broad application prospects in the preparation of related therapeutic drugs.

[0116] Example 1: Construction of recombinant expression vector and expression of target protein

[0117] The sequence (GI:89888426) and amino acid sequence (GenBank: ABD78705.1, SEQ ID NO:1) of feline interferon (FeIFN-ω) were obtained by searching GenBank using the NCBI website (https: / / www.ncbi.nlm.nih.gov / ).

[0118] Feline interferons (especially type I, such as feline ω-interferon FeIFN-ω) bind to type I interferon receptors (IFNAR1 and IFNAR2) on the host cell membrane, activating intracellular signaling pathways (such as the JAK-STAT pathway) and inducing the expression of various antiviral proteins (such as 2',5'-oligoadenylate synthase and protein kinase R), thereby inhibiting viral replication within cells. Based on the antiviral mechanism of feline ω-interferon, its antiviral efficacy is directly related to the strength of its binding to IFNAR. The inventors analyzed the sequence of feline ω-interferon and used molecular docking computer screening technology to predict the optimal binding site between FeIFN-ω and the IFNAR receptor. Through a series of screenings, three mutation sites, R87H, I128L, and T165R, were finally obtained, all located in the functional region of interferon. Verification showed that mutant feline ω-interferon with the aforementioned mutation sites binds more tightly to the interferon receptor IFNAR and has a stronger ability to activate downstream interferon-stimulating genes (ISGs), thus exhibiting higher in vitro antiviral activity. Therefore, mutants containing the R87H, I128L, and T165R mutations were selected for subsequent experiments.

[0119] In this embodiment, a recombinant expression vector for the cat ω-interferon mutant was constructed, as detailed below.

[0120] Based on the amino acid sequences (SEQ ID NO: 2) of the feline interferon ω mutants R87H, I128L, and T165R, corresponding nucleotide sequences were designed and codons optimized to obtain the target gene fragment mutFeIFN-ω encoding the feline interferon ω mutants, SEQ ID NO: 3. This fragment was delivered to Nanjing Genscript Biotech Co., Ltd. for synthesis. The synthesized target gene fragment was inserted into the prokaryotic expression plasmid pCold GST (TaKaRa BIOINC.Cat.#3372) via the restriction enzyme sites Not I and Sal I to construct the recombinant expression plasmid, named pCold GST-mutFeIFN-ω. The prokaryotic expression plasmid pCold GST contains a glutathione S-transferase tag (GST) at its N-terminus, enabling the expressed target protein to carry a GST tag, which improves the stability and solubility of the expressed target protein.

[0121] Using the recombinant expression plasmid pCold GST-mutFeIFN-ω constructed above as a template, sequencing primers were designed. PCR amplification was performed to obtain the amplified linear plasmid product, which was then purified via gel extraction and sent to a sequencing company for sequencing verification. The sequencing results showed that the mutFeIFN-ω gene fragment was successfully inserted into the cloning site of the expression vector pCold GST, and the pCold GST-mutFeIFN-ω recombinant expression vector was successfully constructed.

[0122] Induction and expression of the target protein, feline ω-interferon mutant: The recombinant expression plasmid pCold GST-mutFeIFN-ω was transformed into the host bacterium *E. coli* (BL21) (Tiangen Biotech Co., Ltd.). Transformants were screened using solid agar plates containing ampicillin resistance. Specifically, single colonies were picked and inoculated into liquid LB medium containing 100 μg / mL ampicillin. The culture was incubated overnight at 37°C with shaking at 220 r / min. The next day, 1% of the culture was inoculated into 100 mL of liquid LB medium and cultured for approximately 2.5-3.0 h until the OD600 value reached 0.4-0.6. The bacterial culture was then rapidly placed on ice for 30 min, and IPTG (working concentration 1.0 mM) was added to induce the expression of the target protein. The culture was then continued at 15°C with shaking for 20-24 h. Collect the bacterial culture medium in a 50 mL centrifuge tube, centrifuge at 8000 r / min for 10 min, remove the supernatant after centrifugation, and store the bacterial pellet at -20℃ for later use.

[0123] Example 2 Purification of recombinant rFeIFN-ω fusion protein

[0124] The expressed GST-tagged target protein, feline ω-interferon mutant, was purified using high affinity as follows: The bacterial pellet after centrifugation was removed from a -20°C freezer and placed on ice for 30 min. To inhibit protease release from the lysed cells and prevent protein degradation, a protease inhibitor, PMSF (working concentration 1 mmol / L), was added, along with lysozyme (working concentration 1 mg / mL). The mixture was then incubated on ice for 30 min, followed by sonication on ice with a 5-second interval (5-second interval) for 10-15 min until the bacterial suspension was clear. The clarified bacterial lysate was centrifuged at 8000 r / min for 15 min. The supernatant was filtered through a 0.22 μm filter to remove impurities. The filtered bacterial supernatant (containing the target protein) was collected for later use.

[0125] The results of the induction and purification of the target protein are as follows: The target protein was induced to express at 15℃. The rFeIFN-ω gene is 609 bp in length, with the mature protein region encoding 180 amino acids (excluding the 23-amino acid signal peptide sequence). The feline ω-interferon mutant expressed in this example carries a GST tag with a molecular weight of 26 kDa, suggesting that the expressed target protein is approximately 45 kDa. Referring to protein molecular weight standards, all target wells showed bands of 45 kDa (see...). Figure 1 Lanes 1-2 are consistent with expectations. After optimization of the induction expression conditions, the bands were thicker and there were relatively fewer contaminating proteins when the induction temperature was 15℃, indicating that the recombinant plasmid pCold GST-mutFeIFN-ω could efficiently express the feline ω-interferon mutant in E. coli BL21(DE) at an induction temperature of 15℃.

[0126] The target protein was purified according to the Beyotime GST-tagged protein purification kit instructions, and identified by SDS-PAGE. The electrophoresis results are shown below. Figure 1 Lanes 6-9 show the protein band positions as expected, indicating that the recombinant expression plasmid pCold GST-mutFeIFN-ω was induced under these conditions and achieved good purification results. The bands were single and free of impurities, and the target protein, cat ω interferon mutant, was successfully obtained.

[0127] Example 3: SDS-PAGE electrophoresis verification and concentration of the target protein

[0128] 80 μL of the purified target protein sample obtained in Example 2 was mixed with 20 μL of protein loading buffer (reduced form). The mixed protein sample was boiled at 100°C for 10 min to fully denature the protein. After cooling, it was briefly centrifuged to remove any precipitate that might form, avoiding tailing during electrophoresis. Electrophoresis was usually stopped when the blue dye reached near the bottom of the gel. To determine whether the target protein expression was soluble, the bacterial supernatant was compared with the bacterial precipitate to locate the site of target protein expression and whether it was soluble or present as inclusion bodies.

[0129] SDS-PAGE results showed that a specific band appeared at approximately 45 kDa in the supernatant of the induced bacterial cells, consistent with the expected molecular weight, while the uninduced control group did not show this band, indicating successful expression of the target protein. Comparison of the supernatant and precipitate showed that the target protein was mainly present in the supernatant, confirming its soluble expression form. The obtained protein samples were mixed and concentrated using ultrafiltration (which effectively concentrates proteins while removing low molecular weight solvents and small molecule impurities). A 3 kDa ultrafiltration tube (Millipore) was selected based on the molecular weight of the target protein. 500-1000 μL of liquid obtained from the centrifuge tube at 3000 r / min was the concentrated protein solution. The solution was filtered and sterilized, then aliquoted and stored at -80℃ for later use.

[0130] Example 4: Determination of protein concentration using the BCA protein assay

[0131] The concentration of purified feline ω-interferon mutant protein was determined using a BCA protein concentration assay kit (Beyotime Biotechnology Co., Ltd.). Bovine serum albumin (BSA) standards were diluted to 0, 25, 125, 250, 500, 750, 1000, 1500, and 2000 μg / mL, and added simultaneously with the test samples to 96-well plates, 20 μL per well, with three replicates. 200 μL of BCA working solution was added to each well, and the plates were incubated at 37°C for 30 minutes. The absorbance at 562 nm was measured using a microplate reader.

[0132] A standard curve was plotted with standard protein concentration on the x-axis and A562 value on the y-axis, yielding the regression equation Y = 0.7556X + 0.6733, R² = 0.9959, indicating a good linear relationship within the range of 20-2000 μg / mL. Figure 2 Substituting the average A562 value of the purified cat ω-interferon mutant sample (measured after 10-fold dilution) into the equation, the final purified cat ω-interferon mutant protein concentration was obtained as 50 mg / 100 mL culture medium.

[0133] Example 5: Removal of endotoxins using Triton X-114 liquid phase separation method

[0134] Bacterial endotoxins, composed of lipid A, core polysaccharides, and specific polysaccharides, are important pyrogens in Gram-negative bacteria. During the production of therapeutic recombinant proteins using *E. coli* expression systems, a large amount of endotoxins are released from the cell wall into the protein solution during the protein fragmentation process. Therefore, endotoxin removal is a crucial technology that must be considered when establishing biopharmaceutical purification processes. Conventional methods for endotoxin removal include ultrafiltration, column chromatography, and ion exchange separation. With continuous technological advancements, the Triton X-114 liquid chromatography method, with its high protein recovery rate and high efficiency, has become a promising and widely applicable method for endotoxin removal.

[0135] In this embodiment, Triton X-114 liquid-phase separation is used to remove endotoxins. Triton X-114 is a nonionic surfactant with unique phase separation properties. When the temperature is above a critical value, it undergoes liquid-phase separation in solution, forming two liquid phases. Utilizing the hydrophobic properties of endotoxins, separation is achieved through temperature changes forming a two-phase system. This method triggers phase separation of the solution at a critical temperature, causing endotoxins to accumulate in the detergent phase and be removed. The endotoxin removal rate for protein solutions can reach over 95%. The specific operation is as follows:

[0136] Sample pretreatment: Adjust the pH of the purified target protein solution obtained in Example 2 (or the bacterial supernatant collected after filtration to remove impurities before purification in Example 2) to 7.4-8.0 (using buffers such as Tris-HCl or PBS).

[0137] Unbroken cell debris was removed by centrifugation (e.g., 10,000×g, 10 min, 4℃).

[0138] Add Triton X-114 (concentration: 5%-10%): Add Triton X-114 at a final concentration of 1-2% (v / v), vortex or gently pipette to mix; incubate at 4°C for 30 minutes for low-temperature binding. The lipid A structure of endotoxin has strong hydrophobicity and binds to the hydrophobic end of Triton X-114, allowing the detergent to fully bind with the endotoxin. Temperature-induced phase separation: Transfer the sample to a 37°C water bath and incubate for 15 minutes. As the temperature rises, the solution separates into phases, and the endotoxin is encapsulated in the enriched phase, which can be separated and removed by centrifugation. After centrifugation, the solution separates into two layers: The upper aqueous phase contains hydrophilic substances such as the target protein and has less endotoxin. The lower detergent phase is a turbid layer containing endotoxin bound to Triton X-114 and hydrophobic impurities. Centrifuge at room temperature (2,000×g, 5 minutes) to completely separate the two phases. Carefully aspirate the upper aqueous phase (avoiding aspiration of the upper detergent phase) and transfer it to a new tube. If endotoxin residue is high, the above steps can be repeated, but caution should be exercised as the target protein may be partially lost. Multiple extractions can further improve the clearance rate. Residual Triton X-114 is removed by dialysis (PBS buffer, 4°C overnight) or ultrafiltration (molecular weight cutoff >10 kDa). The endotoxin content in the sample is determined using the Limulus Amebocyte Lysate (LAL) gel electrophoresis, following the methods specified in the Chinese Veterinary Pharmacopoeia.

[0139] Using this method, the endotoxin content of the protein solution gradually decreased with increasing Triton X-114 extractions. After three rounds of extraction, the endotoxin content was below 20 EU / mg (see Table 1), meeting industrial production standards. 100 mL of induced bacterial culture, after protein purification and Triton X-114 extraction, yielded 50 mg of feline ω-interferon mutant protein. Compared to earlier Triton X-114 extraction, after three rounds of extraction, the protein recovery rate was 75.2% (see Table 2), and the purity of the recombinant protein was [not specified in the original text]. Figure 5 The results showed that after three rounds of Triton X-114 extraction, the target protein band was clear and uniform, with no obvious degradation bands or contaminating proteins, indicating that the method effectively maintained the purity of the protein while removing endotoxins.

[0140] Table 1. Endotoxin content in recombinant protein solutions

[0141]

[0142] Table 2 Recovery rates of Triton X-114 extraction

[0143]

[0144] Example 6: In vitro biological activity analysis of cat ω-interferon mutant

[0145] This embodiment examines the inhibitory activity of the prepared feline ω-interferon mutant against the replication of feline calicivirus (FCV) on CRFK (Crandell-Ress feline kidney cell) cells, including cytotoxicity analysis and antiviral activity analysis.

[0146] 1. CCK-8 assay for the toxicity of feline ω-interferon mutants to feline renal cell CRFK.

[0147] One vial of CRFK cells (purchased from the American Type Culture Collection (ATCC), strain 2280) was resuscitated at -80°C. When the cells were in good growth condition, they were seeded into 48-well cell plates. When the CRFK cells reached 80% confluence, the protein solution of the described feline ω-interferon mutant was diluted to 200 μg / mL and then serially diluted 10-fold with DMEM. 200 μL of this diluted solution was added to each well, with three replicates. The control group received no interferon mutant. After 24 h of incubation, the cytotoxicity of different concentrations of the interferon mutant on CRFK cells was detected using the CCK-8 assay. The results showed that the viability of CRFK cells treated with different concentrations of feline ω-interferon mutant was not different from that of the untreated group, indicating that the endotoxin-free interferon mutant prepared in this study had very low cytotoxicity and did not significantly affect cell viability. Figure 3 ).

[0148] 2. Viral titer (TCID) 50 ) Measurement

[0149] Healthy CRFK cells were seeded into 96-well plates at 100 μL per well and cultured until a monolayer formed. Feline calicivirus (FCV) viral suspension (purchased from Shanghai Zeye Biotechnology Co., Ltd.) was serially diluted 10-fold with DMEM medium, with each dilution seeded in four replicates at 100 μL per well. Control wells (without virus) were also included. The plates were incubated at 37°C in a 5% CO2 incubator for 48 hours. Cytopathic effects were observed under a microscope, and the number of wells showing CPE was recorded. The TCID of FCV was calculated using the Reed-Muench method. 50 The titer of the FCV stock solution was determined to be 2 × 10⁻⁶. 7 TCID 50 / mL.

[0150] 3. Assay for the antiviral activity of feline ω-interferon mutants using cytopathic effect inhibition method.

[0151] The antiviral activity of feline ω-interferon mutants was determined using the internationally recognized cytopathic effect inhibition method. FCV virus was used for infection, and CRFK cells were used as indicator cells.

[0152] Take CRFK cells in good growth condition, and add 100 μL (approximately 2 × 10⁻⁶) to each well. 5 Interferon (ω-) was seeded into 96-well plates and cultured at 37°C in a 5% CO2 incubator until a monolayer formed. The feline ω-interferon mutant protein solution was serially diluted 10-fold with DMEM medium to prepare 200 μg / mL, 20 μg / mL, and 2 μg / mL treatment groups, and a 0 μg / mL control group, with four replicates for each dilution. The old medium in the 96-well plates was discarded, and 100 μL of different dilutions of interferon sample was added to each well. Virus control wells (without interferon, with virus) and cell control wells (without interferon, without virus) were also included. The culture plates were incubated at 37°C in a 5% CO2 incubator for 6-8 hours to allow for sufficient interferon induction and the establishment of an antiviral state in the cells.

[0153] The cell supernatant was then collected and used for later use. 100 μL of a solution containing 100 TCID was added to each well. 50 FCV virus solution was cultured in DMEM medium. After 1 hour, the virus solution was discarded, and the collected cell supernatant (containing DMEM) was added. The culture plate was returned to the incubator and cultured for another 24 hours. The supernatant was then harvested. The viral titer in the collected supernatant was measured in CRFK cells according to the above-described viral titer assay method. The results showed that the viral titer in the control group was 2 × 10⁻⁶. 7 TCID 50 The viral titer in the interferon mutant treatment group decreased to 0.9 × 10⁻⁶. 6 TCID 50 The viral load decreased by 22 times. Figure 4 This indicates that the feline ω-interferon mutant has a significant inhibitory effect on FCV virus replication. The highest dilution of interferon that inhibits 50% cytopathic effects was defined as 1 interferon unit, and the specific activity of the feline ω-interferon mutant of this invention was calculated to be 6.6 × 10⁻⁶. 7 IU / mg.

[0154] Example 7: Comparative Experiment on Inhibition of FCV Virus Replication with Commercial Products

[0155] The inhibitory activity of the feline ω-interferon mutant of this invention against commercially available recombinant feline ω-interferon was measured in parallel. 100 TCID⁻¹ of the mutant was seeded onto CRFK cells. 50 FCV virus was analyzed using a cytopathic effect assay to detect interferon activity. Data are presented as mean ± SD (n=3) from three independent experiments. Statistical analysis was performed using a t-test, with * indicating p < 0.05, demonstrating that the mutant of this invention exhibits significantly higher activity in inhibiting viral replication than commercially available products.

[0156] like Figure 6As shown, the antiviral activity of the mutant of this invention is significantly higher than that of the commercial product (p<0.05), and its ability to inhibit viral replication (virus titer 5×10⁻⁶) is also significantly higher. 5 TCID 50 Approximately the commercial product (virus titer 5×10⁻⁶) 6 TCID 50 10 times that of ).

[0157] Example 8: Comparison experiment of ISRE promoter activation activity with wild-type interferon

[0158] The promoter activity of the interferon-stimulated response element (ISRE) was compared between the feline ω-interferon mutant (SEQ ID NO:2) and wild-type feline ω-interferon (SEQ ID NO:1) using a dual-luciferase reporter gene assay. The ISRE reporter plasmid was transfected into CRFK cells and treated with equal concentrations of the mutant and wild-type interferon, respectively. Luciferase activity was measured to evaluate the activation ability of interferon on ISRE.

[0159] Specifically, healthy CRFK cells were seeded into 48-well cell culture plates (250 μL per well) and cultured until a monolayer was formed before transfection. 0.2 μg ISRE and 0.4 μg RLTK plasmid were added to 25 μL DMEM and mixed thoroughly (ISRE and RLTK plasmids were obtained from a dual-luciferase reporter gene assay kit purchased from Thermo Fisher Scientific). This mixture was then added to 1.8 μL PEI and allowed to stand for 10 min before being slowly added to the cell culture plates. The plates were then incubated at 37°C with 5% CO2. After 10 h, interferon protein dilutions were prepared. Mutant and wild-type interferon were diluted with DMEM to 0.2, 2, 20, 200, 2000, and 20000 ng / mL, respectively. After discarding the cell supernatant, 250 μL of each cell culture plate was added to the well as the treatment group. A control group was established using only DMEM and no interferon.

[0160] 24 h after transfection, the dual luciferase assay was performed according to the instructions of the Dual luciferase Reporter Assay Kit: 5× lysis buffer was diluted with water to 1× lysis buffer. Cell supernatant was discarded from 48-well plates, and 100 μL was added to each well. For 96-well black plates, 50 μL of LARII (Luciferase Assay Reagent II) was added to each well. LARII was prepared according to the instructions and aliquoted into 8-tube strips (used in the dark). Stop-Glo Buffer: Stop-Glo Reagent = 50:1 was prepared and aliquoted into 8-tube strips (used in the dark). The assay was performed using a multi-plate reader. 50 μL of LARII was added to each well of the 96-well black plate, mixed with the lysis buffer, and the firefly luciferase activity was measured (value 1). 50 μL of Stop-Glo Reagent was added to each well of the 96-well black plate, mixed, and the Renida luciferase activity was measured (value 2). The values ​​were recorded and a bar chart was plotted. Figure 7 As shown, the mutant of this invention has a significantly higher activation capacity for the ISRE promoter than the wild type (p<0.05), and exhibits a dose-dependent effect.

[0161] Furthermore, based on the methods and steps of the above embodiments, the inventors also verified a comparative experiment on the activation ability of R87H, I128L, and T165R single point mutants on the ISRE promoter, and the results are as follows: Figure 8 As shown, the single-point mutants of R87H, I128L, and T165R enhanced activation compared to the wild type. The combined mutants of the three sites significantly enhanced the induced ISRE promoter expression level, indicating that the interferon signaling pathway has been effectively activated. Its level can reflect the activation intensity of the antiviral response and thus promote the establishment of an "antiviral state" in cells.

[0162] Wild-type amino acid sequence: SEQ ID NO:1

[0163] CALPGSHAQVSRDNLVLLGQMRRLSPFLCLRARKDFRFPREMLEGGQLREAQAAAAVLRELLQQTFNLLHTERSSAAWSPAPLHGLRSGLHRQLEALDACLLQATGEGERATGEGERAPGMHGPVLAIKRYFQDIRVYLEDEGYSDCAWEIVRLEIMRALSSSATLQDSLAIKDGDLGSS

[0164] Three-site mutant amino acid sequence: SEQ ID NO:2

[0165] CALPGSHAQVSRDNLVLLGQMRRLSPFLCLRARKDFRFPREMLEGGQLREAQAAAAVLRELLQQTFNLLHTERSSAAWSPAPLHGLHSGLHRQLEALDACLLQATGEGERATGEGERAPGMHGPVLALKRYFQDIRVYLEDEGYSDCAWEIVRLEIMRALSSSARLQDSLAIKDGDLGSS

[0166] Optimized nucleotide sequence of the three-site mutant: SEQ ID NO:3

[0167] TGTGCCCTGCCTGGGAGCCACGCGCAGGTTAGCAGGGACAACTTGGTGCTCCTGGGCCAGATGCGGAGACTGTCCCCTTTCTTGTGCCTGCGGGCCAGAAAAGACTTCCGCTTCCCCCGGGAGATGCTGGAGGGCGGCCAGCTCCGGGAGGCCCAGGCCGCCGCCGCCGTCCTGCGGGAGCTGCTCCAGCAGACCTTCAACCTGTTGCACACGGAGCGCTCCTCGGCGGCCTGGAGCCCCGCGCCGCTGCACGGACTCCACTCTGGCCTCCACCGGCAGCTGGAAGCCCTGGACGCCTGCTTGCTGCAGGCCACGGGCGAGGGAGAGCGCGCCACGGGCGAGGGAGAGCGCGCCCCGGGGATGCACGGCCCTGTCCTGGCCCTGAAGAGGTACTTCCAGGACATCCGCGTCTACCTGGAGGACGAGGGATACAGTGACTGCGCCTGGGAAATTGTCAGGCTGGAAATCATGAGAGCCTTGTCCTCCTCGGCGCGCTTGCAAGACAGCTTGGCCATCAAGGATGGAGACCTGGGCTCATCT

[0168] Amino acid sequence of SEQ ID NO: 4, R87H mutant

[0169] CALPGSHAQVSRDNLVLLGQMRRLSPFLCLRARKDFRFPREMLEGGQLREAQAAAAVLRELLQQTFNLLHTERSSAAWSPAPLHGLHSGLHRQLEALDACLLQATGEGERATGEGERAPGMHGPVLAIKRYFQDIRVYLEDEGYSDCAWEIVRLEIMRALSSSATLQDSLAIKDGDLGSS

[0170] SEQ ID NO: 5, amino acid sequence of I128L mutant

[0171] CALPGSHAQVSRDNLVLLGQMRRLSPFLCLRARKDFRFPREMLEGGQLREAQAAAAVLRELLQQTFNLLHTERSSAAWSPAPLHGLRSGLHRQLEALDACLLQATGEGERATGEGERAPGMHGPVLALKRYFQDIRVYLEDEGYSDCAWEIVRLEIMRALSSSATLQDSLAIKDGDLGSS

[0172] SEQ ID NO: 6, amino acid sequence of T165R mutant

[0173] CALPGSHAQVSRDNLVLLGQMRRLSPFLCLRARKDFRFPREMLEGGQLREAQAAAAVLRELLQQTFNLLHTERSSAAWSPAPLHGLRSGLHRQLEALDACLLQATGEGERATGEGERAPGMHGPVLAIKRYFQDIRVYLEDEGYSDCAWEIVRLEIMRALSSSARLQDSLAIKDGDLGSS.

Claims

1. A cat ω-interferon mutant, characterized in that, Its amino acid sequence is shown in SEQ ID NO: 2, 4, 5 or 6.

2. A nucleic acid molecule encoding the feline ω-interferon mutant of claim 1.

3. An expression vector comprising the nucleic acid molecule of claim 2.

4. A host cell comprising the nucleic acid molecule of claim 2 or the expression vector of claim 3.

5. A method for preparing a cat ω-interferon mutant, characterized in that, Includes the following steps: (1) Culturing the host cells as described in claim 4; (2) Add an inducer to the culture medium to induce the expression of the target protein cat ω interferon mutant; (3) Isolate the cat ω-interferon mutant from the culture.

6. The preparation method according to claim 5, wherein, It also includes the step of removing endotoxins from the isolated cat ω-interferon mutant using Triton X-114 liquid phase separation.

7. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises the feline ω-interferon mutant of claim 1 and a pharmaceutically acceptable carrier.

8. Use of the feline ω-interferon mutant of claim 1 in the preparation of a medicament for treating viral infectious diseases in cats; in, The viral infection is feline calicivirus infection.

Images