Application of GmbZIP111 protein and / or its encoding gene in improving resistance of soybean to phytophthora

Abstract

The application belongs to the technical field of plant disease resistance breeding, and provides application of GmbZIP111 protein and / or its coding gene in improving resistance of soybean to pythium. GmbZIP111 The gene positively regulates resistance of soybean to pythium root rot, overexpression of the gene can significantly inhibit pythium infection of soybean, and knockout of the gene leads to reduced resistance. GmbZIP111 The gene has important theoretical significance and application value for analyzing the mechanism of soybean resistance to pythium root rot and cultivating new disease-resistant varieties.

Description

Technical Field

[0001] This invention relates to the field of plant disease resistance breeding technology, and in particular to the application of the GmbZIP111 protein and / or its encoding gene in improving soybean resistance to Phytophthora infestans. Background Technology

[0002] Soybeans Glycine max Soybeans are an important food and oilseed crop, and one of the main sources of plant protein and vegetable oil. During soybean production, various pathogens seriously affect its yield and quality, among which Phytophthora soybeanum (… Phytophthora sojae Phytophthora root rot (PRR), caused by the fungus, is a significant disease affecting soybeans. This pathogen can infect the roots, stems, and seedlings of soybeans, leading to wilting, lodging, and even death of the plants. It is particularly severe under high temperature and humidity conditions, often causing large-scale yield reductions in soybeans and hindering the sustainable development of the soybean industry.

[0003] Currently, the control of soybean Phytophthora root rot mainly relies on the breeding of resistant varieties and chemical control. However, the physiological races of Phytophthora soybeanis are complex and mutate rapidly, making it easy for existing resistance genes to be overcome by new physiological races, leading to a gradual loss of resistance. Furthermore, long-term use of chemical agents not only increases production costs but may also cause environmental pollution and enhance pathogen resistance. Therefore, identifying new resistance-related genes and elucidating their regulatory mechanisms is of great significance for breeding broad-spectrum, long-lasting resistant soybean varieties.

[0004] In the interaction between plants and pathogens, plants form a complex immune regulatory network. Transcription factors play a crucial role in plant disease resistance by regulating the expression of downstream defense-related genes. The bZIP (basic leucine zipper) transcription factor family is an important class of transcriptional regulators widely distributed in eukaryotes, with members possessing conserved basic DNA-binding regions and leucine zipper domains. Studies have shown that bZIP transcription factors are widely involved in biological processes such as plant growth and development, hormone signal transduction, abiotic stress responses, and disease resistance regulation, and can participate in plant immune responses by regulating signaling pathways such as salicylic acid (SA), jasmonic acid (JA), ethylene (ET), and reactive oxygen species (ROS). However, current research on the specific functions and regulatory mechanisms of soybean bZIP transcription factors in soybean Phytophthora root rot resistance remains very limited. Therefore, identifying and cloning bZIP transcription factor genes related to resistance to Phytophthora root rot in soybean, and clarifying their expression characteristics and regulatory network in the disease resistance response, has important theoretical value and practical application prospects for enriching the molecular mechanisms of soybean disease resistance and creating new disease-resistant germplasm. Summary of the Invention

[0005] To address the aforementioned problems in the existing technology and the current situation of insufficient soybean disease resistance gene resources, this invention provides the application of GmbZIP111 protein and / or its encoding gene in improving soybean resistance to Phytophthora blight.

[0006] This invention has made a new discovery in soybeans. GmbZIP111 The gene and its protein were investigated to identify and define the biological function of this gene in positively regulating soybean resistance to Phytophthora sojae, thereby improving... GmbZIP111 Gene expression levels can enhance soybean disease resistance, while knockout... GmbZIP111 Lowering the expression level of genes reduces the disease resistance of soybeans.

[0007] The present invention adopts the following technical solution: The amino acid sequence of the soybean GmbZIP111 protein provided by this invention is shown in SEQ ID NO:5.

[0008] Those skilled in the art should understand that proteins with the same function obtained by substituting, inserting, or deleting one or more amino acids in the amino acid sequence shown in SEQ ID NO:5 can also achieve the technical effects of the present invention.

[0009] In a first aspect, the present invention provides the GmbZIP111 protein and / or GmbZIP111 The application of the gene in improving soybean resistance to Phytophthora sojae, the amino acid sequence of the GmbZIP111 protein is shown in SEQ ID NO:5.

[0010] The GmbZIP111 protein and / or provided by the present invention GmbZIP111 The application of genes in improving soybean resistance to Phytophthora sojae, preferably, in the application of the GmbZIP111 protein and / or GmbZIP111 The gene is used to reduce the biomass of Phytophthora soybeanis and / or the area of ​​lesions in soybeans.

[0011] The GmbZIP111 protein and / or provided by the present invention GmbZIP111 The application of genes in improving soybean resistance to Phytophthora sojae, preferably, the GmbZIP111 The gene includes any of the following nucleotide sequences: (1) the nucleotide sequence shown in SEQ ID NO:3 or SEQ ID NO:4; (2) the complete complementary sequence of the nucleotide sequence shown in (1); (3) the nucleotide sequence shown in (1) or (2) that encodes a protein with the same function by substitution, deletion or insertion of one or more nucleotides.

[0012] In some specific embodiments, the nucleotide sequence of the nucleic acid molecule has at least 80% to 95% homology with the nucleotide sequence shown in SEQ ID NO:3 or SEQ ID NO:4 and is capable of encoding a protein with the same function.

[0013] In this invention, GmbZIP111 The genome sequence of the gene is shown in SEQ ID NO:3, and the CDS sequence is shown in SEQ ID NO:4.

[0014] More preferably, the nucleotide sequence of the nucleic acid molecule is as shown in SEQ ID NO:3 or SEQ ID NO:4.

[0015] In a second aspect, the present invention provides the GmbZIP111 protein and / or GmbZIP111 The application of the gene in the prevention and / or treatment of soybean diseases caused by Phytophthora in soybean, wherein the amino acid sequence of the GmbZIP111 protein is shown in SEQ ID NO:5.

[0016] The GmbZIP111 protein and / or provided by the present invention GmbZIP111 The application of genes in the prevention and / or treatment of soybean diseases caused by Phytophthora in soybean, preferably, the soybean disease being Phytophthora root rot in soybean.

[0017] The GmbZIP111 protein and / or provided by the present invention GmbZIP111 The application of the gene in the prevention and / or treatment of soybean diseases caused by Phytophthora soybeanis, preferably, when applied, the GmbZIP111 protein and / or GmbZIP111 The gene is used to reduce the biomass of Phytophthora soybeanis and / or the area of ​​lesions in soybeans.

[0018] The GmbZIP111 protein and / or provided by the present invention GmbZIP111 The application of genes in the prevention and / or treatment of soybean diseases caused by Phytophthora in soybean, preferably, the... GmbZIP111 The gene includes any of the following nucleotide sequences: (1) the nucleotide sequence shown in SEQ ID NO:3 or SEQ ID NO:4; (2) the complete complementary sequence of the nucleotide sequence shown in (1); (3) the nucleotide sequence shown in (1) or (2) that encodes a protein with the same function by substitution, deletion or insertion of one or more nucleotides.

[0019] In some specific embodiments, the nucleotide sequence of the nucleic acid molecule has at least 80% to 95% homology with the nucleotide sequence shown in SEQ ID NO:3 or SEQ ID NO:4 and is capable of encoding a protein with the same function.

[0020] In this invention, GmbZIP111 The genome sequence of the gene is shown in SEQ ID NO:3, and the CDS sequence is shown in SEQ ID NO:4.

[0021] More preferably, the nucleotide sequence of the nucleic acid molecule is as shown in SEQ ID NO:3 or SEQ ID NO:4.

[0022] In actual production, due to the complex physiological races and rapid mutation rate of Phytophthora soybeanis, the resistance of existing resistant varieties is easily overcome by new physiological races, leading to a gradual loss of resistance. Therefore, improving the disease resistance of susceptible soybean varieties through genetic engineering has more direct practical significance for breeding new varieties with long-lasting disease resistance. Therefore, in a third aspect, this invention provides the GmbZIP111 protein and / or GmbZIP111 Application of genes in breeding soybean varieties resistant to Phytophthora soybeanis.

[0023] The GmbZIP111 protein and / or provided by the present invention GmbZIP111 In the application of genes in the breeding of soybean varieties resistant to Phytophthora soybeanis, preferably, susceptible soybean varieties are used as recipient materials for breeding soybean varieties resistant to Phytophthora soybeanis. Those skilled in the art can select suitable susceptible soybean varieties as transformation recipients according to actual needs.

[0024] The GmbZIP111 protein and / or provided by the present invention GmbZIP111 The application of genes in breeding soybean varieties resistant to Phytophthora soybeanis, preferably, the GmbZIP111 The gene includes any of the following nucleotide sequences: (1) the nucleotide sequence shown in SEQ ID NO:3 or SEQ ID NO:4; (2) the complete complementary sequence of the nucleotide sequence shown in (1); (3) the nucleotide sequence shown in (1) or (2) that encodes a protein with the same function by substitution, deletion or insertion of one or more nucleotides.

[0025] In some specific embodiments, the nucleotide sequence of the nucleic acid molecule has at least 80% to 95% homology with the nucleotide sequence shown in SEQ ID NO:3 or SEQ ID NO:4 and is capable of encoding a protein with the same function.

[0026] In this invention, GmbZIP111 The genome sequence of the gene is shown in SEQ ID NO:3, and the CDS sequence is shown in SEQ ID NO:4.

[0027] More preferably, the nucleotide sequence of the nucleic acid molecule is as shown in SEQ ID NO:3 or SEQ ID NO:4.

[0028] A method for creating a soybean variety resistant to Phytophthora soysarum should also be within the scope of protection of this invention, said method comprising: increasing the GmbZIP111 protein and / or... GmbZIP111 The expression level of the gene, and the amino acid sequence of the GmbZIP111 protein as shown in SEQ ID NO:5.

[0029] Preferably, the creation method includes: increasing the GmbZIP111 protein and / or... in the roots of the target soybean. GmbZIP111 Gene expression levels.

[0030] Preferably, the creation method includes: treating target soybeans with the biological material to increase the GmbZIP111 protein and / or... GmbZIP111 Gene expression levels.

[0031] Preferably, the target soybean is a susceptible variety of Phytophthora soybeanis.

[0032] Soybean varieties resistant to Phytophthora soybeanis obtained according to the described method should also be within the scope of protection of this invention.

[0033] Fourthly, the present invention provides the GmbZIP111 protein and / or GmbZIP111 Application of the gene in reducing the biomass and / or lesion area of ​​Phytophthora soybeanis in soybeans, wherein the amino acid sequence of the GmbZIP111 protein is shown in SEQ ID NO:5.

[0034] The present invention provides GmbZIP111 protein and / or GmbZIP111 The application of genes in reducing the biomass and / or lesion area of ​​Phytophthora soybean in soybeans, the aforementioned GmbZIP111 The gene includes any of the following nucleotide sequences: (1) the nucleotide sequence shown in SEQ ID NO:3 or SEQ ID NO:4; (2) the complete complementary sequence of the nucleotide sequence shown in (1); (3) the nucleotide sequence shown in (1) or (2) that encodes a protein with the same function by substitution, deletion or insertion of one or more nucleotides.

[0035] In some specific embodiments, the nucleotide sequence of the nucleic acid molecule has at least 80% to 95% homology with the nucleotide sequence shown in SEQ ID NO:3 or SEQ ID NO:4 and is capable of encoding a protein with the same function.

[0036] In this invention, GmbZIP111 The genome sequence of the gene is shown in SEQ ID NO:3, and the CDS sequence is shown in SEQ ID NO:4.

[0037] More preferably, the nucleotide sequence of the nucleic acid molecule is as shown in SEQ ID NO:3 or SEQ ID NO:4.

[0038] Fifthly, the present invention provides a method for improving the resistance of soybean to Phytophthora sojae, the method comprising: increasing the GmbZIP111 protein and / or... GmbZIP111 The expression level of the gene, and the amino acid sequence of the GmbZIP111 protein as shown in SEQ ID NO:5.

[0039] According to the present invention, a method for improving the resistance of soybean to Phytophthora soybeanis is preferably provided, the method comprising: using a mixture of... GmbZIP111 Gene-based biological material treatment of target soybeans to increase the content of GmbZIP111 protein and / or GmbZIP111 Gene expression level; the biological material is recombinant DNA, expression cassette, vector or microorganism.

[0040] According to the present invention, a method for improving the resistance of soybean to Phytophthora sojae is preferably provided, the method comprising: increasing the GmbZIP111 protein and / or... in the roots of the target soybean. GmbZIP111 Gene expression levels.

[0041] To facilitate implementation GmbZIP111 Visual screening and real-time tracking of positive transformants of genes, according to a method for improving soybean resistance to Phytophthora sojae provided by the present invention, preferably, the vector further comprises a screening marker selected from any one of RUBY, GFP, EGFP, RFP, mCherry, YFP and CFP.

[0042] RUBY is a key enzyme encoding the betaine synthesis pathway, which gives transformed cells their red color. More preferably, the vector contains RUBY.

[0043] Those skilled in the art will understand that the vector used in this invention can be any type of multi-expression vector suitable for soybeans or plants, and the specific type of vector does not affect the accuracy of the expression. GmbZIP111 Regarding the gene expression effect, those skilled in the art can select appropriate vectors according to actual needs, including but not limited to: pCAMBIA series, pBI series, pGreen series, pFGC5941, pEarleyGate series, pMDC series, etc.

[0044] According to the present invention, a method for improving the resistance of soybean to Phytophthora sojae is provided, wherein preferably, the carrier is based on the pCAMBIA1300 carrier.

[0045] According to the present invention, a method for improving the resistance of soybean to Phytophthora sojae is provided, wherein the microorganism is Agrobacterium.

[0046] This invention does not specifically limit the type of Agrobacterium used for plant transformation. Any Agrobacterium capable of mediating the transfer of the target gene into plant cells and achieving overexpression can be used to achieve the technical effects of this invention. Those skilled in the art can flexibly select according to different experimental systems or transformation materials, including but not limited to: Agrobacterium tumefaciens (…). Agrobacterium tumefaciens GV3101, EHA105, LBA4404, and AGL1, as well as Agrobacterium rhizogenes ( Agrobacterium rhizogenes K599 and AR1193.

[0047] More preferably, the microorganism is Agrobacterium K599.

[0048] More preferably, the method includes: increasing the content of hairy root transformation in the target soybean by Agrobacterium-mediated transformation. GmbZIP111 Gene expression levels.

[0049] According to the present invention, a method for improving the resistance of soybean to Phytophthora sojae is preferably provided. GmbZIP111 The gene includes any of the following nucleotide sequences: (1) the nucleotide sequence shown in SEQ ID NO:3 or SEQ ID NO:4; (2) the complete complementary sequence of the nucleotide sequence shown in (1); (3) the nucleotide sequence shown in (1) or (2) that encodes a protein with the same function by substitution, deletion or insertion of one or more nucleotides.

[0050] In some specific embodiments, the nucleotide sequence of the nucleic acid molecule has at least 80% to 95% homology with the nucleotide sequence shown in SEQ ID NO:3 or SEQ ID NO:4 and is capable of encoding a protein with the same function.

[0051] In this invention, GmbZIP111 The genome sequence of the gene is shown in SEQ ID NO:3, and the CDS sequence is shown in SEQ ID NO:4.

[0052] More preferably, the nucleotide sequence of the nucleic acid molecule is as shown in SEQ ID NO:3 or SEQ ID NO:4.

[0053] In this invention, by... GmbZIP111 The CDS sequence of the gene was ligated into a vector to construct the gene. GmbZIP111 Gene overexpression vectors, thereby achieving increased expression in target soybeans. GmbZIP111Gene expression level. More preferably, the nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO:4.

[0054] Furthermore, those skilled in the art should understand that increasing the GmbZIP111 protein and / or the content of this invention in different soybean varieties can improve the quality of the protein. GmbZIP111 After gene administration, the resistance level of soybean plants to Phytophthora soybeanis can be significantly improved.

[0055] According to the present invention, a method for improving the resistance of soybean to Phytophthora soybeanis is provided, wherein preferably, the target soybean is a susceptible variety of Phytophthora soybeanis.

[0056] The present invention has the following beneficial effects: This invention provides a novel method for positively regulating soybean resistance to Phytophthora root rot. GmbZIP111 The gene can be significantly induced by Phytophthora soybeanis. Overexpression GmbZIP111 The gene significantly inhibits Phytophthora infection in soybean and enhances soybean resistance to Phytophthora root rot, while knocking out the gene leads to decreased resistance. This invention provides a new gene resource for molecular breeding of soybean disease resistance, specifically the GmbZIP111 protein and... GmbZIP111 Genes are of great theoretical and practical significance for elucidating the mechanism of soybean resistance to root rot and for breeding new disease-resistant varieties. Attached Figure Description

[0057] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0058] Figure 1 yes GmbZIP111 Schematic diagram of the structure of the gene and the GmbZIP111 protein.

[0059] Figure 2 yes GmbZIP111 Gene expression pattern analysis results; A is GmbZIP111 Gene expression levels in different soybean tissues; B represents... GmbZIP111 Gene expression levels after infection with Phytophthora soybeanis, CK is root tissue treated with H2O, and ZS is root tissue 4 hours after inoculation with Phytophthora soybeanis zoospores; This indicates that the difference relative to CK is extremely significant (P<0.001).

[0060] Figure 3 yes GmbZIP111The results of gene overexpression vector and identification of overexpressing plants; A is a schematic diagram of the pCAMBIA1300-GmbZIP111 vector; B shows the hairy root growth of soybean plants; C is... GmbZIP111 Genes in EV plants and GmbZIP111 OE Expression levels in the hairy roots of plants; This indicates that the difference relative to EV plants is extremely significant (P<0.001).

[0061] Figure 4 yes GmbZIP111 A schematic diagram of the gene structure, sgRNA knockout target sites, and four GmbZIP111-CR plants (GmbZIP111-CR1~GmbZIP111-CR4). GmbZIP111 Gene sequence alignment results.

[0062] Figure 5 yes GmbZIP111 The effect of gene overexpression on resistance to Phytophthora in soybean; A represents EV plants and GmbZIP111 OE In the plant GmbZIP111 Gene expression levels before and after *Phytophthora sojae* infection; CK represents root tissue before inoculation with *Phytophthora sojae* zoospores, Zs represents root tissue after inoculation with *Phytophthora sojae* zoospores; B represents EV plants after inoculation with *Phytophthora sojae* zoospores and... GmbZIP111 OE Statistical results of relative biomass of Phytophthora in plants; This indicates that the difference relative to EV plants is extremely significant (P<0.001).

[0063] Figure 6 yes GmbZIP111 The effect of gene knockout on resistance to Phytophthora soysarum; A shows the root phenotype of W82 plants and GmbHZIP111-CR1~GmbZIP111-CR4 plants 2 days after inoculation with Phytophthora soysarum zoospores, with a scale bar of 1 mm; B shows the relative biomass of Phytophthora soysarum in W82 plants, Wm plants, and GmbHZIP111-CR1~GmbZIP111-CR4 plants after inoculation with Phytophthora soysarum zoospores; C shows the lesion area in W82 plants, Wm plants, and GmbHZIP111-CR1~GmbZIP111-CR4 plants after inoculation with Phytophthora soysarum zoospores; ns indicates no significant difference relative to W82 plants (P>0.05). This indicates a significant difference compared to W82 plants (P<0.05). This indicates a highly significant difference compared to W82 plants (P<0.01). This indicates a highly significant difference compared to W82 plants (P<0.001). Detailed Implementation

[0064] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0065] Unless otherwise specified, the experimental methods involved in the following embodiments are conventional methods in the art. For example, you can refer to the experimental manual in the art or follow the conditions recommended in the manufacturer's instructions.

[0066] Unless otherwise specified, all experimental materials and reagents used in the following examples are commercially available.

[0067] The strain of Phytophthora soybeanae involved in the following examples is race P6497.

[0068] Example 1 Soybeans GmbZIP111 Gene acquisition, structure and expression pattern analysis 1. GmbZIP111 Acquisition of genes Genomic DNA was extracted from young leaves of soybean (variety: Williams 82). Using this DNA as a template, PCR amplification was performed using primer F (5'-ACGGGGGACGACGTCGGTACCTATGGCTTCTCCTGGTGGAAGT-3' (SEQ ID NO:1)) and primer R (5'-ATGGTCTTTGTAGTCGTCGACATACATGAACAACATTTCATTGTCAGC-3' (SEQ ID NO:2)). GmbZIP111 Gene.

[0069] The PCR reaction system consisted of 2 μL DNA template, 25 μL 2×PCR Mix, 4 μL primer mixture, and sterile ultrapure water to a final volume of 50 μL. The primer mixture was prepared by mixing 10 μM primer F and 10 μM primer R in a 1:1 volume ratio.

[0070] The PCR reaction program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 56℃~72℃ annealing for 15 s, 72℃ extension for 30 s, for a total of 33 cycles; 72℃ complete extension for 5 min.

[0071] 2. GmbZIP111 Structural analysis of genes and their proteins soybeans GmbZIP111The structure of the gene's genomic sequence (SEQ ID NO:3) is as follows: Figure 1 As shown, the total length is 881bp and contains 1 exon.

[0072] soybeans GmbZIP111 The CDS sequence of the gene is shown in SEQ ID NO:4, with a total length of 492 bp.

[0073] From soybeans GmbZIP111 The structure of the GmbZIP111 protein (SEQ ID NO:5) encoded by the gene is as follows: Figure 1 As shown, there are a total of 163 amino acids.

[0074] 3. GmbZIP111 Gene expression pattern analysis (1) GmbZIP111 Analysis of gene expression patterns in different tissues Identification in soybean (variety: Williams 82) GmbZIP111 Gene expression patterns. Total RNA was extracted from the roots, stems, leaves, flowers, pods, and cotyledons of soybean, and cDNA was obtained by reverse transcription using a reverse transcription kit.

[0075] Using cDNA as a template, RT-qPCR was used for detection. GmbZIP111 Gene expression levels, in soybeans GmACT11 The primers used for the gene as an internal reference are shown in Table 1.

[0076] Table 1 RT-qPCR primers

[0077] The RT-PCR reaction system consisted of: 1 μL cDNA template, 10 μL 2×RealStar Fast Pro SYBR qPCR Mix, 0.8 μL primer combination, and 20 μL sterile water. The primer mixture was prepared by mixing 10 μM primer F and 10 μM primer R in a 1:1 volume ratio.

[0078] The RT-PCR reaction program was as follows: 95℃ pre-denaturation for 2 min; 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 30 s, for a total of 40 cycles.

[0079] The results are as follows Figure 2 As shown in A, compared to stem, leaf, flower, pod, and cotyledon tissues, GmbZIP111 The gene was expressed at a high level in soybean root tissue. This indicates that... GmbZIP111 Genes mainly play a regulatory role in the soybean roots.

[0080] (2) GmbZIP111Analysis of gene expression patterns after infection with Phytophthora in soybean The root system was inoculated with zoospores of Phytophthora soybeanis. Soybean materials resistant to Phytophthora soybeanis (variety: Williams 82, denoted as W82) and soybean materials susceptible to Phytophthora soybeanis (variety: Williams, denoted as Wm) were inoculated separately. The inoculation amount of zoospores was 1 × 10⁻⁶. 3 cfu / mL.

[0081] Root tissues of each soybean material were collected after 4 hours of H2O treatment (as a control, denoted as CK) and after 4 hours of inoculation with zoospores (denoted as Zs), and RNA was extracted. RNA was detected using the RT-qPCR method described in this embodiment. GmbZIP111 Gene expression levels.

[0082] The results are as follows Figure 2 As shown in B, in Williams 82 and Williams, GmbZIP111 Gene expression levels significantly increased after inoculation with Phytophthora soybeanis, with even higher levels observed in the Phytophthora soybeanis-resistant Williams 82 strain. This indicates that Phytophthora soybeanis induces... GmbZIP111 The expression of the gene, which may be a positive regulator of resistance to Phytophthora infestans.

[0083] Example 2: Construction of gene-edited soybean plants 1. Soybeans GmbZIP111 Construction of gene overexpression plants (1) GmbZIP111 Construction of gene overexpression vectors Total RNA was extracted from soybean (variety: Williams 82) leaves and cDNA was obtained by reverse transcription using a reverse transcription kit.

[0084] Using cDNA as a template, PCR amplification was performed using a forward primer (5'-GGACCTCGAGAATTCGAGCTCATGGCTTCTCCTGGTGGAAGTGGA-3' (SEQ ID NO:10)) and a reverse primer (5'-CACCATGGTGGCGACCGGTGGATACATGAACAACATTTCATTGTC-3' (SEQ ID NO:11)) with a high-fidelity enzyme to obtain... GmbZIP111 The CDS sequence of the gene (SEQ ID NO:4) was constructed into the modified pCAMBIA1300 vector backbone containing RUBY, resulting in the following: Figure 3 A in GmbZIP111 The gene overexpression vector is designated as pCAMBIA1300-GmbZIP111.

[0085] (2) Construction of Agrobacterium The pCAMBIA1300-GmbZIP111 vector plasmid was added to competent cells of Agrobacterium tumefaciens K599. The cells were then incubated on ice for 5 min, in a water bath at 37°C for 5 min, flash-frozen in liquid nitrogen for 5 min, and incubated on ice for 5 min. 700 μL of antibiotic-free LB medium was added, and the cells were incubated at 28°C and 220 rpm for 3 h. The bacterial culture was then plated onto LB agar plates containing 50 µg / mL kanamycin and 25 µg / mL streptomycin for selection. pCAMBIA1300-GmbZIP111 was transformed into Agrobacterium tumefaciens K599 to obtain cells carrying the vector. GmbZIP111 Gene-positive Agrobacterium, denoted as GmbZIP111 OE Agrobacterium.

[0086] Following the same method, the empty vector was transformed into Agrobacterium K599, and the resulting positive Agrobacterium was designated as Agrobacterium EV.

[0087] (3) Hairy root transformation Constructing a receptor using soybean (variety: Williams) as the receptor material GmbZIP111 Plants with overexpressed genes.

[0088] Select plump soybean seeds and sow them in vermiculite. Five days later, take seedlings whose cotyledons have not yet separated, and make a 45° incision at the hypocotyl with a blade to create a wound. GmbZIP111 OE Agrobacterium cells were applied to the wound. Sterile filter paper was laid flat in a glass dish, and 10 mL of sterile water was added to moisten the filter paper. The seedlings were placed with the wound facing upwards in the glass dish and incubated for 24 hours. The resulting soybean plants were recorded as follows: GmbZIP111 OE The soybean plants were then transferred to transparent pots containing vermiculite to induce hairy roots, such as... Figure 3 As shown in B, the soybean plant had formed clearly visible hairy roots by the time it had grown for 14 days.

[0089] Following the same method, Agrobacterium EV was transformed into soybean plants and hairy roots were induced. The resulting soybean plants were designated as EV plants and used as a control.

[0090] (4) GmbZIP111 Gene expression level detection Extract separately GmbZIP111 OE Total RNA from the hairy roots of the plant and EV plants was reverse transcribed into cDNA using a reverse transcription kit.

[0091] Using cDNA as a template, the RT-qPCR method described in Example 1 was used for detection. GmbZIP111 Gene expression levels.

[0092] The results are as follows Figure 3 As shown in C, compared to EV plants, GmbZIP111 OE In the plant GmbZIP111 Gene expression was significantly elevated. This indicates... GmbZIP111 Gene overexpression plants have been successfully constructed.

[0093] 2. Soybeans GmbZIP111 Construction of gene knockout plants (1) GmbZIP111 Construction of gene knockout vector Through analysis GmbZIP111 The CDS sequence of the gene (SEQ ID NO:4) was used to obtain a highly specific sgRNA (5'-GAAGAGAATGTTGTCCAATA-3' (SEQ ID NO:12)). The primers for this sgRNA were annealed and cloned into the PGES201-Cas9 knockout vector to obtain... GmbZIP111 Gene knockout vector, denoted as p GmbZIP111 CR Carrier.

[0094] (2) Construction of Agrobacterium Constructed with reference to this embodiment GmbZIP111 OE The Agrobacterium method, p GmbZIP111 CR The vector was transformed into Agrobacterium K599, and samples carrying p were screened. GmbZIP111 CR The positive Agrobacterium of the vector is denoted as GmbZIP111 CR Agrobacterium.

[0095] (3) Cotyledonary node transformation Using soybean (variety: Williams 82) as the recipient material, knockout strains were obtained through Agrobacterium-mediated transformation of soybean cotyledonary nodes. GmbZIP111 Genetically modified plants with heritable genes.

[0096] Disease-free and undamaged mature soybean seeds were selected, sterilized, and germinated under aseptic conditions. The hypocotyl was then used as explant material after the upper hypocotyl tissue was removed. GmbZIP111 CR Agrobacterium infection of explants was followed by co-culture and differentiation regeneration treatment. Regenerated plants were obtained through glufosinate screening, and positive transgenic plants were obtained through resistance screening, which were designated as GmbZIP111-CR plants.

[0097] The obtained GmbZIP111-CR plants were cultured in a greenhouse until fruit set, and T1 generation seeds were harvested. After planting the T1 generation seeds, genomic DNA was extracted from leaves and analyzed using specific primer pairs (upstream primer: 5'-ATGGCTTCTCCTGGTGGAAG-3' (SEQ ID NO:13) and downstream primer: 5'-GTCAGCGGAAGCCATGATTG-3' (SEQ ID NO:14)). GmbZIP111 The gene-edited region was amplified by PCR, and the PCR products were collected for sequencing analysis. The sequencing results were compared with the reference genome sequence (SEQ ID NO:3). A total of 4 GmbZIP111-CR plants were obtained, designated as GmbZIP111-CR1 to GmbZIP111-CR4.

[0098] The results are as follows Figure 4 As shown, compared with wild-type soybean (WT), GmbZIP111-CR1 has... GmbZIP111 The CDS of the gene contains the deletion of CCA at bases 116-118, GmbZIP111-CR2. GmbZIP111 The gene CDS deletes bases 69 to 119 in the form AGGAGACAGAGACATCATGGAACAGAGGAAGAGGAAGAGAATGTTGTCCAA, GmbZIP111-CR3. GmbZIP111 The CDS gene lacks the A at base 119, GmbZIP111-CR1. GmbZIP111 The gene CDS has the CA at positions 117-118 deleted.

[0099] show GmbZIP111 Gene knockout plants have been successfully constructed.

[0100] Example 3: Inoculation with Phytophthora in soybean and identification of soybean resistance 1. GmbZIP111 Effects of gene overexpression on resistance to Phytophthora in soybean (1) Inoculation with Phytophthora in soybean The root system was inoculated with zoospores of Phytophthora soybean, and the EV plants obtained in Example 2 and GmbZIP111 OE The plants were inoculated with zoospores at a rate of 1×10⁻⁶. 3 cfu / mL.

[0101] (2) GmbZIP111 Gene expression level detection Root tissues from each plant were collected 4 hours after H2O treatment (as a control, denoted as CK) and 4 hours after inoculation with zoospores (denoted as Zs). RNA was extracted and detected using the RT-qPCR method described in Example 2. GmbZIP111 Gene expression levels.

[0102] like Figure 5 As shown in A, after inoculation with Phytophthora soybeanis, the root system of EV plants... GmbZIP111 There was no significant difference in gene expression levels; while GmbZIP111 OE In the plant root system GmbZIP111 Gene expression levels were significantly higher in soybean plants than in EV plants, and after inoculation with Phytophthora soybeanis... GmbZIP111 Gene expression levels increased significantly.

[0103] (3) Biomass detection of Phytophthora soybeanis Four hours after inoculation with zoospores, total RNA was extracted from the root tissues of each plant and cDNA was obtained by reverse transcription using a reverse transcription kit.

[0104] Using cDNA as a template, the RT-qPCR method described in Example 1 was used for detection. PsACT Gene expression levels, in soybeans GmCYP The primers used for the gene as an internal reference are shown in Table 2.

[0105] Table 2 RT-qPCR primers

[0106] by PsACT The relative expression level of genes is used as the relative biomass of Phytophthora.

[0107] like Figure 5 As shown in B, GmbZIP111 OE The mean relative biomass of Phytophthora soybean in the plant roots (0.42) was significantly lower than that of EV plants (4.43). P =1.40×10 -7 .

[0108] The above results indicate that overexpression GmbZIP111 The gene can significantly inhibit Phytophthora infection in soybean and improve soybean resistance to Phytophthora root rot.

[0109] 2. Soybeans GmbZIP111 Gene knockout resistance to Phytophthora in soybean (1) Inoculation with Phytophthora in soybean The root system was inoculated with zoospores of Phytophthora soybeanis. Soybean materials resistant to Phytophthora soybeanis (variety: Williams 82, denoted as W82), soybean materials susceptible to Phytophthora soybeanis (variety: Williams, denoted as Wm), and GmbZIP111-CR plants (GmbZIP111-CR1~GmbZIP111-CR4) obtained in Example 2 were inoculated with zoospores at a rate of 1×10⁻⁶. 3 cfu / mL.

[0110] (2) Observation of root phenotype Two days after inoculation with zoospores, root tissues from each plant were taken and observed under a microscope to examine the root phenotype.

[0111] like Figure 6 As shown in A, compared with W82 plants, Wm and GmbZIP111-CR1~GmbZIP111-CR4 all showed significant lesions on their roots.

[0112] (3) Biomass detection of Phytophthora soybeanis Two days after inoculation with zoospores, the relative biomass of Phytophthora in each plant was measured according to the method described in this embodiment.

[0113] like Figure 6 As shown in B, the mean relative biomass of Phytophthora soybeanis in the roots of GmbZIP111-CR1 to GmbZIP111-CR4 were 1.348, 1.161, 2.373 and 2.060 respectively, all of which were significantly higher than the mean relative biomass of Phytophthora soybeanis in the roots of W82 plants (0.429).

[0114] (4) Measurement of lesion area Two days after inoculation with zoospores, photographs were taken of the lesion sites on each plant. The lesion area was detected using ImageJ software. During measurement, the image format was converted to 8-bit. The software parameters were set to Threshold in Adjust in ImageJ, using RED mode, and the parameter range was set to 0-81.

[0115] like Figure 6 As shown in C, the lesion area of ​​W82 plant (mean value 0.1507 mm) is compared with that of W82 plant. 2 Compared to the previous year, the lesion area of ​​Wm plants and GmbZIP111-CR1 to GmbZIP111-CR2 plants (mean values ​​were 5.608 mm) was significantly larger. 2 3.491mm 2 and 2.114mm 2 All three showed a significant increase, with the lesion area of ​​GmbZIP111-CR3 to GmbZIP111-CR4 (mean values ​​of 2.189 mm).2 and 0.899mm 2 The number of [items] also shows a clear increasing trend.

[0116] The above results indicate that knockout GmbZIP111 Genes reduce soybean resistance to soybean root rot caused by Phytophthora infestans.

[0117] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. GmbZIP111 protein and / or GmbZIP111 The application of genes in improving soybean resistance to Phytophthora soybeanis is characterized by, The amino acid sequence of the GmbZIP111 protein is shown in SEQ ID NO:5; GmbZIP111 The gene encodes the GmbZIP111 protein.

2. GmbZIP111 protein and / or GmbZIP111 The application of genes in the prevention and / or treatment of soybean diseases caused by Phytophthora soybeanis is characterized by, The amino acid sequence of the GmbZIP111 protein is shown in SEQ ID NO:5; GmbZIP111 The gene encodes the GmbZIP111 protein.

3. GmbZIP111 protein and / or GmbZIP111 The application of genes in reducing the biomass and / or lesion area of ​​Phytophthora soybeanis in soybeans is characterized by, The amino acid sequence of the GmbZIP111 protein is shown in SEQ ID NO:5; GmbZIP111 The gene encodes the GmbZIP111 protein.

4. The application according to any one of claims 1 to 3, characterized in that, The GmbZIP111 The nucleotide sequence of the gene is shown in SEQ ID NO:3 or SEQ ID NO:

4.

5. A method for improving the resistance of soybeans to Phytophthora soybeanis, characterized in that, The method includes: increasing the GmbZIP111 protein in the target soybean and / or GmbZIP111 The gene expression level, the amino acid sequence of the GmbZIP111 protein is shown in SEQ ID NO:5; GmbZIP111 The gene encodes the GmbZIP111 protein.

6. The method according to claim 5, characterized in that, The method includes: containing GmbZIP111 Gene-based biological material treatment of target soybeans to increase the content of GmbZIP111 protein and / or GmbZIP111 Gene expression levels; The biological material is recombinant DNA, expression cassette, vector, or microorganism.

7. The method according to claim 6, characterized in that, The vector also includes a selection marker, which is selected from any one of RUBY, GFP, EGFP, RFP, mCherry, YFP, and CFP.

8. The method according to claim 6, characterized in that, The microorganism in question is Agrobacterium.

9. The method according to claim 5, characterized in that, The GmbZIP111 The nucleotide sequence of the gene is shown in SEQ ID NO:3 or SEQ ID NO:4.

Images