A transposon molecular marker for identifying oryza sativa subsp. indica and application thereof

Abstract

The present disclosure provides a transposon molecular marker for identifying Oryza sativa subsp. indica and its application. The transposon molecular marker is first provided as a specific transposon insertion marker for Oryza sativa subsp. indica, and the insertion site is located between the 39,031,819th and 39,031,820th nucleotides of chromosome 1 of the Oryza sativa japonica reference genome version IRGSP-1.0. The variety of Oryza sativa subsp. indica contains a 259 bp transposon insertion at the insertion site, while the variety of other Oryza sativa subspecies does not contain the transposon insertion at the insertion site. The application of the above transposon molecular marker is further provided. The transposon molecular marker for identifying Oryza sativa subsp. indica of the present disclosure has the advantages of strong specificity, high accuracy, simple operation, and being not affected by the environment, and can be applied to Oryza sativa subsp. indica germplasm identification, molecular marker assisted breeding, and rapid seed purity detection, and has important practical value.

Description

Technical Field

[0001] This disclosure relates to the field of biotype identification technology, and in particular to a transposon molecular marker for identifying the rice subspecies of fragrant rice and its application. Background Technology

[0002] Rice (Oryza sativa L.) is an important global food crop, mainly divided into two major subspecies, indica and japonica, and two minor subspecies, aus and aromatic (3K RGP: The 3,000 rice genomes project). GigaScience 2014, 3:7; WS Wang, R. Mauleon, ZQHu , et al. : Genomic variation in 3,010 diverse accessions of Asian cultivated rice. Nature 2018, 557:43; D. Guo, Y. Li, H. Lu , et al. : A pangenome reference of wild and cultivated rice. Nature (2025, 642:662-671). Among them, indica rice is closely related to Ausnutria, while japonica rice is closely related to fragrant rice. Fragrant rice is highly favored in the market due to its pleasant aroma. Aroma is one of the key indicators for evaluating rice quality and an important factor determining its economic value. In the global market, fragrant rice commands a significantly higher price than ordinary high-quality rice. However, the existing populations of fragrant rice are relatively small, mainly including Basmati rice from India and northern and northwestern Pakistan, Jasmine rice from northern and northeastern Thailand, and Sadri rice from Iran. These varieties generally suffer from low yields, lodging at maturity, and susceptibility to pests and diseases. For a long time, the improvement of fragrant rice varieties has lagged far behind other rice varieties, primarily due to: 1) the complex genetic mechanisms of aroma traits, which are easily influenced by other rice quality indicators; 2) compatibility issues when fragrant rice is hybridized with high-yielding non-fragrant rice, making it difficult to introduce superior genes (such as high-yield and disease-resistant genes) into the fragrant rice background; and 3) the expression of quality traits such as aroma is highly dependent on environmental and cultivation conditions, leading to unstable phenotypic identification results and increasing the difficulty of breeding selection.

[0003] Accurate variety identification and subspecies classification are prerequisites for the protection of fragrant rice germplasm resources, maintenance of variety rights, and molecular breeding. Currently, the commonly used methods for identifying fragrant rice mainly include: (1) Sensory evaluation method: Evaluation is made by professionals smelling the aroma of the rice grains after steaming. This method is highly subjective, has poor repeatability, and cannot be used for identification at the seedling or seed stage. (2) Physicochemical analysis method: The content of aroma substances is quantitatively detected using techniques such as gas chromatography-mass spectrometry (GC-MS). This method has high accuracy, but the equipment is expensive, the operation is complicated, and the detection cycle is long, making it unsuitable for large-scale breeding screening. (3) DNA molecular marker method: Molecular markers developed based on gene sequence polymorphism (such as SSR and SNP markers) are currently the mainstream auxiliary identification methods. However, existing markers often have problems such as low polymorphism information content, insufficient discrimination, or cumbersome detection procedures. In particular, there is a lack of universal molecular markers that can specifically distinguish between fragrant rice subspecies and other subspecies (indica, japonica, and Austria).

[0004] Therefore, developing a rapid, simple, environmentally unaffected, and highly efficient molecular marker that can stably distinguish the fragrant rice subspecies from other rice subspecies is of great theoretical and practical significance for the identification of fragrant rice germplasm resources, the detection of variety purity, and molecular marker-assisted breeding. Summary of the Invention

[0005] This disclosure provides a stable, accurate, and efficient transposon molecular marker for identifying rice subspecies *Rhizophora aromatica* and its application, thereby at least solving the above-mentioned technical problems existing in the prior art.

[0006] According to a first aspect of this disclosure, a transposon molecular marker for identifying the fragrant rice subspecies is provided. The transposon molecular marker is a fragrant rice subspecies-specific transposon insertion marker, the insertion site of which is located between nucleotides 39,031,819 and 39,031,820 on chromosome 1 of the rice Nipponbare reference genome version IRGSP-1.0. Varieties of the fragrant rice subspecies contain a transposon insertion of 259 bp at the insertion site, while varieties of other rice subspecies do not contain the transposon insertion at the insertion site.

[0007] In one possible implementation, the transposer is Stowaway17 Transposable.

[0008] In a preferred embodiment, the nucleotide sequence of the transposon is shown in SEQ ID NO:1.

[0009] In one embodiment, the other rice subspecies include Indica rice, Japonica rice, and / or Agrosciformis rice.

[0010] According to a second aspect of this disclosure, this disclosure provides a PCR primer set for amplifying the above-mentioned transposon molecular marker, the PCR primer set being designed based on the flanking sequences on both sides of the insertion site of the above-mentioned transposon molecular marker, and capable of specifically amplifying the above-mentioned transposon molecular marker.

[0011] In one embodiment, the upstream 200 bp flanking sequence and the downstream 200 bp flanking sequence of the flanking sequence are shown in SEQ ID NO:2 and SEQ ID NO:3, respectively.

[0012] In a preferred embodiment, the nucleotide sequences of the PCR primer combination are shown in SEQ ID NO:4 and SEQ ID NO:5.

[0013] According to a third aspect of this disclosure, this disclosure provides a kit for identifying the fragrant rice subspecies, the kit comprising the above-described PCR primer combination.

[0014] In one embodiment, the kit further includes: PCR reaction buffer, DNA polymerase, dNTPs and / or standard control samples (including a positive control of rice genomic DNA known to be from the fragrant rice subspecies and a negative control of rice genomic DNA known to be from a non-fragrant rice subspecies).

[0015] According to the fourth aspect of this disclosure, this disclosure provides the use of the above-described transposon molecular markers, the above-described PCR primer combinations, or the above-described kits in any of the following: A1. Application in identifying or assisting in the identification of rice subspecies *Rhizophora stenoptera*; A2. Application in the preparation of products for identification or auxiliary identification of rice subspecies Aromatic Rice.

[0016] According to the fifth aspect of this disclosure, this disclosure provides a method for identifying whether a rice variety to be tested belongs to the fragrant rice subspecies, comprising the following steps: S1. DNA Extraction: Extract genomic DNA from the rice sample to be tested (such as leaves, seeds, etc.); S2. PCR amplification: Using the genomic DNA as a template, PCR amplification is performed using the above-mentioned PCR primer combination to obtain PCR amplification products; S3. Result Interpretation: The PCR amplification products were detected by agarose gel electrophoresis. If the PCR amplification product contains the above-mentioned transposon molecular marker insertion, the rice to be tested is determined to belong to the fragrant rice subspecies. If the PCR amplification product does not contain the above-mentioned transposon molecular marker insertion (i.e., only contains flanking sequences), then the rice to be tested is determined to belong to other rice subspecies (such as indica, japonica and / or Australopithecus subspecies).

[0017] According to one possible implementation of this disclosure, at least the following beneficial effects are achieved: 1. High accuracy in identification: The transposon molecular marker disclosed in this invention for identifying the rice subspecies of fragrant rice is based on a fixed transposon insertion marker unique to the fragrant rice subspecies. This insertion is present in all varieties of the fragrant rice subspecies, but absent in varieties of non-fragrant rice subspecies, showing perfect inter-subspecies polymorphism, and the identification accuracy can reach 100%.

[0018] 2. Rapid and simple detection: The transposon molecular markers used in this invention for identifying the rice subspecies of fragrant rice are detected using PCR technology. From DNA extraction to result interpretation, it only takes 3-4 hours. No expensive instruments (such as GC-MS) are required, making it suitable for routine molecular biology laboratory operations.

[0019] 3. Unaffected by the environment: The transposon molecular marker detection method disclosed in this invention for identifying rice subspecies directly reflects DNA sequence differences and is not affected by planting environment, growth stage and sample processing conditions. It can be detected in seeds, seedlings or any tissue stage.

[0020] 4. Wide range of applications: The transposon molecular markers disclosed herein for identifying rice subspecies are applicable to rice varieties from different geographical origins worldwide (such as Basmati, Jasmine Rice, and Sadri), and have universal applicability.

[0021] It should be understood that the description in this section is not intended to identify key or essential features of the embodiments of this disclosure, nor is it intended to limit the scope of this disclosure. Other features of this disclosure will become readily apparent from the following description. Attached Figure Description

[0022] The above and other objects, features, and advantages of this disclosure will become readily apparent from the following detailed description of exemplary embodiments, taken in conjunction with the accompanying drawings. Several embodiments of this disclosure are illustrated in the drawings by way of example and not limitation, in which: In the accompanying drawings, the same or corresponding reference numerals indicate the same or corresponding parts.

[0023] Figure 1 The location of the transposon molecular markers used in this disclosure to identify rice subspecies (A) and structural diagrams in different subspecies (B) are shown; in A, TIR (Terminal Inverted Repeats) represents terminal inverted repeat sequences; TSD (Target Site Duplication) represents target site repeat sequences.

[0024] Figure 2The present disclosure presents the identification results of 41 different subspecies of rice based on genome sequence using transposon molecular markers for identifying rice jasmine subspecies; wherein, the rice varieties represented by Acc_1 to Acc_41 are shown in Table 1.

[0025] Figure 3 The results of PCR detection of 20 different rice materials using transposon molecular markers for identifying rice subspecies of fragrant rice are shown in Table 2. M is a DNA molecular weight marker; the rice varieties represented by 1 to 20 are shown in Table 2. Detailed Implementation

[0026] To make the objectives, features, and advantages of this disclosure more apparent and understandable, the technical solutions in the embodiments of this disclosure will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only a part of the embodiments of this disclosure, and not all of them. All other embodiments obtained by those skilled in the art based on the embodiments of this disclosure without creative effort are within the scope of protection of this disclosure.

[0027] The transposon molecular marker disclosed herein for identifying the fragrant rice subspecies is a subspecies-specific transposon insertion marker, with its insertion site located between nucleotides 39,031,819 and 39,031,820 on chromosome 1 of the Nipponbare rice reference genome (IRGSP-1.0 version). Figure 1 The cultivar of fragrant rice contains a 259 bp long gene at this insertion site. Stowaway17 Transposon insertion occurred, while varieties of other rice subspecies (Indica, Japonica, and / or Agrostis) did not contain the aforementioned transposon at the insertion site. Stowaway17 Insert the rotary connector.

[0028] The Stowaway17 The transposon sequence is shown in SEQ ID NO:1 (the underlined part represents the TIR), specifically: CTCCCTCCGTACTCGTAAAGGAAGTCGTTTAGGACA GCGACACGGTTCCCAAAACACAACTTTGACTTCTTGTTTCTATAAAAATATTTTTTGAAAAGTGATATATGTATACTTTTATGAAAGTATTTTTCAAAACAAATCTATTCATATAATTTTTACATTTTTCAAACTCAACAACTTGAGAGTTATTCATGATTTATATTCCCAAGGTTTGACTTAAACAT TGTTCTAAACGACTTCCTTTACAAGTACGGAGAGAG The Stowaway17The upstream 200bp flanking sequence of the transposon is shown in SEQ ID NO:2, specifically: GAAAACATAACATTTCCATCACAAAATTCTGTGAATTGCACTAGTGAGTGTTTTAGTGATGCACATGGTGGTTTGCCCTGTATCATGGGCAGAGTTAATGCCATGCTTCAGCTGCTCTAAGATTTTAAGTCCATGTGTTGATGTTATAATAAACTTATAATGGAAACCTTTTCCTGTATTTATACTACTAAATAGTGGAG The Stowaway17 The downstream 200bp flanking sequence of the transposon is shown in SEQ ID NO:3, specifically: TACTATTTAGAATCATAACAGACACATGTGGCATCTAAGTACTTCTATTTTTATCTTGGAGAAAGGAATGGAGTTGAATGTTTTTCACCAATTAACTGCTATAAGCTGGTTTGCTTGCCCAATGATGGCGTGACAGCGCTTTCTATCATCAATGCTATCCTTTTAGAAGAAATTAACATATTAGATGTAAGGACATGTG Example 1 This embodiment describes a method for identifying rice subspecies *Rhizophora aromatica* based on genome sequence using transposon molecular markers for identification. The specific process is as follows: I. Materials Forty-one rice accessions with known subspecies classifications and genome assembly were selected, as shown in Table 1. These included 12 japonica rice varieties, 11 indica rice varieties, 11 Australopithecus rice varieties, and 7 aromatic rice varieties.

[0029] Table 1 Information on 41 rice samples

[0030] II. Methods 1. Extract the transposon molecular marker shown in SEQ ID NO:1 according to the transposon molecular markers used for identifying rice subspecies in this disclosure. Stowaway17 Transposons, as shown in SEQ ID NO:2 Stowaway17 The upstream 200bp flanking sequence of the transposon, shown in SEQ ID NO:3 Stowaway17 Downstream 200bp flanking sequence of the transposon.

[0031] 2. Download the genome assembly sequences of each rice variety listed in Table 1 from the following URL. Acc_1:http: / / ricerc.sicau.edu.cn / ; Acc_2:https: / / zenodo.org / record / 3355330#.X5KEU1MzbOQ; Acc_3:https: / / zenodo.org / record / 3355330#.X5KEU1MzbOQ; Acc_4:https: / / figshare.com / s / e8bd43ec6e29f56d9edd; Acc_5:https: / / cgm.sjtu.edu.cn / TGSrice / index.html; Acc_6:https: / / www.ncbi.nlm.nih.gov / nuccore / VYID00000000; Acc_7:https: / / cgm.sjtu.edu.cn / TGSrice / index.html; Acc_8:https: / / www.ncbi.nlm.nih.gov / assembly / GCA_052625515.1 / ; Acc_9:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH193.te_GWHDRGP00000000 / GWHDRGP00000000.genome.fasta.gz; Acc_10:https: / / cgm.sjtu.edu.cn / TGSrice / index.html; Acc_11:https: / / www.ncbi.nlm.nih.gov / nuccore / VYIH00000000; Acc_12:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH005.te_GWHDRAP00000000 / GWHDRAP00000000.genome.fasta.gz; Acc_13:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH040.te_GWHDRBS00000000 / GWHDRBS00000000.genome.fasta.gz ; Acc_14:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH142.te_GWHDRFA00000000 / GWHDRFA00000000.genome.fasta.gz ; Acc_15:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH191.te_GWHDRGN00000000 / GWHDRGN00000000.genome.fasta.gz ; Acc_16:https: / / www.ncbi.nlm.nih.gov / assembly / GCF_001433935.1 ; Acc_17:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH022.te_GWHDRBE00000000 / GWHDRBE00000000.genome.fasta.gz ; Acc_18:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH168.te_GWHDRFV00000000 / GWHDRFV00000000.genome.fasta.gz ; Acc_19:https: / / cgm.sjtu.edu.cn / TGSrice / index.html ; Acc_20:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH051.te_GWHDRCA00000000 / GWHDRCA00000000.genome.fasta.gz ; Acc_21:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH133.te_GWHDRER00000000 / GWHDRER00000000.genome.fasta.gz ; Acc_22:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH178.te_GWHDRGD00000000 / GWHDRGD00000000.genome.fasta.gz ; Acc_23:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH222.te_GWHDRHO00000000 / GWHDRHO00000000.genome.fasta.gz ; Acc_24:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH166.te_GWHDRFT00000000 / GWHDRFT00000000.genome.fasta.gz ; Acc_25:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH184.te_GWHDRGI00000000 / GWHDRGI00000000.genome.fasta.gz ; Acc_26:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH011.te_GWHDRAV00000000 / GWHDRAV00000000.genome.fasta.gz ; Acc_27:https: / / cgm.sjtu.edu.cn / TGSrice / index.html ; Acc_28:https: / / cgm.sjtu.edu.cn / TGSrice / index.html ; Acc_29:https: / / cgm.sjtu.edu.cn / TGSrice / index.html ; Acc_30:https: / / cgm.sjtu.edu.cn / TGSrice / index.html; Acc_31: https: / / zenodo.org / doi / 10.5281 / zenodo.12770803; Acc_32: https: / / www.ncbi.nlm.nih.gov / assembly / GCA_040181785.1 / ; (The "Oryza sativa Indica Group" listed on the webpage is incorrect; the relevant literature "K. Sedeek, N. Mohammed, Y. Zhou" was consulted.) , et al. : Multitrait engineering of Hassawi red rice forsustainable cultivation. Plant Science 2024, 341:112018.” This confirms that the corresponding variety is indeed Osmocote. Acc_33:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH144.te_GWHDRFC00000000 / GWHDRFC00000000.genome.fasta.gz; Acc_34:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH227.te_GWHDRHS00000000 / GWHDRHS00000000.genome.fasta.gz; Acc_35:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH241.te_GWHDRIB00000000 / GWHDRIB00000000.genome.fasta.gz; Acc_36:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_AUS449_GWHESQL00000000 / GWHESQL00000000.genome.fasta.gz; Acc_37: https: / / zenodo.org / doi / 10.5281 / zenodo.12770803; Acc_38:https: / / cgm.sjtu.edu.cn / TGSrice / index.html; Acc_39:https: / / cgm.sjtu.edu.cn / TGSrice / index.html; Acc_40:https: / / cgm.sjtu.edu.cn / TGSrice / index.html; Acc_41: https: / / www.ncbi.nlm.nih.gov / nuccore / VYIG00000000.

[0032] 3. Use the following command line to create an index for the genome assembly sequences of each rice variety: makeblastdb -inRiceGenome.fasta -dbtype nuc, where RiceGenome.fasta refers to the filename where the genome assembly sequences of each rice variety are stored.

[0033] 4. The 400bp flanking sequence (upstream 200bp flanking sequence + downstream 200bp flanking sequence) marked by BLAST software was compared with the genome assembly sequence of each rice variety. The command line used was as follows: blastn -task blastn -query FlankingSeq.fasta -db RiceGenome.fasta -out Results.txt -outfmt7 -evalue 10.

[0034] 5. If the upstream and downstream flanking sequences are directly connected in the alignment results, it indicates that the sequence does not contain [a specific sequence]. Stowaway17 Insert the transposon; otherwise, contain Stowaway17 Insert the rotary connector.

[0035] III. Results Genomic sequence identification results as follows Figure 2 As shown, the results indicate that all seven fragrant rice varieties contain [the substance] at the corresponding positions (insertion sites). Stowaway17 The insertion frequency of transposons was 100%; however, none of the 12 japonica rice varieties, 11 indica rice varieties, and 11 Ausnutria varieties contained transposons at the corresponding insertion sites. Stowaway17 The insertion of transposons resulted in a population frequency of 0%. The results were completely consistent with expectations, confirming that the transposon molecular markers disclosed herein can accurately distinguish the fragrant rice subspecies from other rice subspecies (indica, japonica, and Australopithecus subspecies).

[0036] Example 2 This embodiment describes a method for identifying rice subspecies *Rhizophora aromatica* using transposon molecular markers based on PCR. The specific process is as follows: I. Materials Twenty rice materials with known subspecies classifications were selected, as shown in Table 2, including 5 japonica rice varieties, 5 indica rice varieties, 5 Australis rice varieties, and 5 fragrant rice varieties.

[0037] Table 2 Information on 20 rice materials used for PCR amplification detection

[0038] II. Methods 1. Genomic DNA was extracted from each rice material using the standard CTAB method, as detailed below: 1) Add 500 μl of 2×CTAB and 20 μl of β-mercaptoethanol (2%) to a 2.0 mL centrifuge tube and preheat at 65 °C; 2) Take 1-2g of fresh tissue material, rinse it with distilled water, rinse it twice with sterile ddH2O, put it into a mortar pre-cooled with liquid nitrogen, add liquid nitrogen and grind it into powder, add a small amount of PVP (polyvinylpyrrolidone K30) in the middle, use a clean sterile stainless steel spoon to transfer the powder into a preheated centrifuge tube, the total volume reaches 1 ml, mix well and incubate in a 65℃ water bath for 45-60 minutes, and gently rotate the test tube from time to time. 3) Add an equal volume of phenol / chloroform / isoamyl alcohol (25:24:1) and gently invert to mix. Let stand for 5 min to allow the reaction to proceed fully. Then centrifuge at 12,000 rpm for 5 min at room temperature and transfer the supernatant to another new tube. 4) Add an equal volume of chloroform / isoamyl alcohol (24:1) and gently invert to mix. Let stand for 5 min to allow the reaction to proceed fully. Centrifuge at 12,000 rpm for 5 min at room temperature and transfer the supernatant to another new tube. 5) Repeat step 4). 6) Add 2 volumes of ice-cold 100% ethanol or 0.7 volumes of isopropanol, incubate at -20°C for 30 min or at -80°C for 10 min, and centrifuge at 12000 rpm for 10 min after flocculent precipitate appears and recover the DNA precipitate. 7) Wash the precipitate with 70% ethanol, dry it, and then dissolve it in an appropriate amount of sterile TE buffer; 8) 0.8% agarose gel electrophoresis was used to detect the integrity of genomic DNA.

[0039] 2. Design specific PCR primer combinations based on the flanking sequences on both sides of the insertion site of the transposon molecular marker, as follows: Forward primer (F): 5'- CCTGTATCATGGGCAGAGT-3' (SEQ ID NO:4) Reverse primer (R): 5'-AGCAAACCAGCTTATAGCA-3' (SEQ ID NO:5) Expected PCR amplification product length: Fragrant rice subspecies: 501 bp (including 240 bp flanking sequence + 259 bp) Stowaway17 (Transistor insertion +2 bp TSD) Other rice subspecies: 240 bp (flanking sequence only) 3. PCR reaction The PCR reaction system (25 μL) is shown in Table 3.

[0040] Table 3 PCR reaction system

[0041] The PCR amplification procedure is as follows: Pre-denaturation: 94°C, 5 min; Denaturation: 94°C, 30 s; Annealing: 55°C, 30 s; Extension: 72°C, 30 s; Number of cycles: 35 cycles; Final extension: 72°C, 5 min.

[0042] PCR products were detected by 2% agarose gel electrophoresis.

[0043] III. Results Agarose gel electrophoresis results are as follows Figure 3 As shown, the results indicate that all five fragrant rice varieties amplified a specific large band of 501 bp, indicating that the corresponding positions (insertion sites) in their genomes all contain [the specific gene]. Stowaway17 The insertion of transposons; and all five japonica rice varieties, five indica rice varieties, and five Osage rice varieties amplified specific small bands of 240 bp, indicating that the corresponding positions in their genomes did not contain transposons. Stowaway17 The insertion of transposons was completely consistent with expectations, further confirming that the transposon molecular markers disclosed herein can accurately distinguish the fragrant rice subspecies from other rice subspecies (Indica rice subspecies, Japonica rice subspecies, and Australopithecus subspecies).

[0044] It should be understood that the various forms of processes shown above can be used to rearrange, add, or delete steps. For example, the steps described in this disclosure can be executed in parallel, sequentially, or in different orders, as long as the desired result of the technical solution of this disclosure can be achieved, and this is not limited herein.

[0045] Furthermore, the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of technical features indicated. Thus, a feature defined as "first" or "second" may explicitly or implicitly include at least one of that feature.

[0046] The above description is merely a specific embodiment of this disclosure, but the scope of protection of this disclosure is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in this disclosure should be included within the scope of protection of this disclosure. Therefore, the scope of protection of this disclosure should be determined by the scope of the claims.

Claims

1. A method for identifying whether a rice variety belongs to the fragrant rice subspecies, characterized in that, Includes the following steps: S1. DNA Extraction: Extract genomic DNA from the rice sample to be tested; S2. PCR amplification: Using the genomic DNA as a template, PCR amplification is performed using the PCR primer combination shown in SEQ ID NO:4 and SEQ ID NO:5 to obtain PCR amplification products; S3. Result Interpretation: The PCR amplification products were detected by agarose gel electrophoresis. If the PCR amplification product contains a transposon molecular marker insertion, the rice being tested is determined to belong to the fragrant rice subspecies. If the PCR amplification product does not contain transposon molecular marker insertion, the rice being tested is determined to belong to other rice subspecies, including Indica rice, Japonica rice, and / or Agrosciformis. The transposon molecular marker is a transposon insertion marker specific to the rice subspecies, and its insertion site is located between nucleotides 39,031,819 and 39,031,820 on chromosome 1 of the rice Nipponbare reference genome of version IRGSP-1.

0. It is a transposon with a length of 259 bp and the nucleotide sequence shown in SEQ ID NO:1.

Images