SNP molecular marker related to thousand kernel weight of brassica napus and application thereof

Abstract

The application belongs to the technical field of molecular breeding of Brassica napus, and particularly relates to a SNP molecular marker related to the thousand seed weight of Brassica napus and application thereof. The SNP molecular marker is located at the position of 43,480,336 of the scaffold C05 chromosome of Brassica napus reference genome ZS11 v0. The site has T / G polymorphism, wherein the T allele is a favorable allele variation for increasing the thousand seed weight of Brassica napus. The SNP molecular marker can be used for screening high thousand seed weight potential material at the seedling stage or early stage through DNA detection, improving the high yield breeding efficiency of Brassica napus, and can be used for screening high thousand seed weight material of Brassica napus, molecular assisted selection breeding, evaluation of germplasm resources and improvement of yield-related traits.

Description

Technical Field

[0001] This invention belongs to the field of molecular breeding technology of Brassica napus, specifically involving SNP molecular markers related to the thousand-grain weight of Brassica napus and their applications. Background Technology

[0002] Brassica napus ( Brassica napus Brassica napus (L.) is one of the most important oilseed crops in my country and worldwide, and its yield directly affects the supply capacity of edible vegetable oil and the economic benefits of rapeseed production. Rapeseed yield is determined by multiple factors, including the number of pods per plant, the number of seeds per pod, and the thousand-seed weight. Among these, the thousand-seed weight is a crucial indicator reflecting seed size, seed plumpness, and yield potential. Improving the thousand-seed weight is one of the important goals of high-yield breeding programs for Brassica napus.

[0003] Thousand-grain weight is a typical quantitative trait, usually controlled by multiple genes and easily influenced by environmental conditions, cultivation management practices, population structure, and genotype-environment interactions. In traditional breeding, selection for thousand-grain weight mainly relies on field phenotypic identification, which suffers from problems such as long identification cycles, significant environmental influences, and low early selection efficiency. Especially in large-scale breeding populations, relying solely on phenotypic selection is insufficient for quickly and accurately screening materials carrying superior allelic variations.

[0004] With the development of whole-genome resequencing, SNP genotyping, and genome-wide association analysis (GWAS) technologies, mining SNP molecular markers associated with important agronomic traits from natural populations and applying them to molecular-assisted selection breeding has become an important means to improve breeding efficiency. By developing SNP molecular markers that are significantly associated with thousand-grain weight, DNA genotyping technology can be used to screen for high-thousand-grain-weight potential materials at the seedling stage or early stage, thereby improving the selection efficiency of high-yield breeding in Brassica napus.

[0005] Therefore, developing a SNP molecular marker that is associated with the thousand-grain weight of Brassica napus and has clear polymorphism and stable phenotypic effect is of great significance for high-yield breeding, screening of superior germplasm resources and molecular design breeding of Brassica napus. Summary of the Invention

[0006] To address the aforementioned shortcomings, this invention provides a SNP molecular marker associated with the thousand-grain weight of Brassica napus, and provides the application of this SNP molecular marker in screening high thousand-grain weight materials, molecular-assisted selection breeding, and germplasm resource improvement.

[0007] The first objective of this invention is to provide an SNP molecular marker related to the thousand-grain weight of Brassica napus.

[0008] A second objective of the present invention is to provide the use of the SNP molecular marker or the reagent for detecting the SNP molecular marker.

[0009] A third objective of the present invention is to provide a method for detecting or assisting in detecting the 1000-seed weight of Brassica napus.

[0010] A fourth objective of the present invention is to provide a method for breeding or assisting in breeding of Brassica napus.

[0011] Based on a natural population of Brassica napus, the present invention carries out genome-wide association analysis of Brassica napus by combining the phenotypic data of 1000-seed weight of Brassica napus from 2024 to 2025 and the genome-wide SNP genotype data of Brassica napus, so as to screen and obtain candidate SNP loci related to the 1000-seed weight of Brassica napus. Further, the present invention conducts genotype effect analysis on the candidate SNP loci, and finds that the SNP molecular marker scaffoldC05:43480336:T:G located at position 43,480,336 on the scaffoldC05 chromosome of the Brassica napus reference genome ZS11 v0 is significantly associated with the 1000-seed weight of Brassica napus.

[0012] Further, genotype effect analysis shows that in 2024 and 2025, the 1000-seed weight of materials with different genotypes at this locus all presents a trend that the 1000-seed weight of Brassica napus with GG genotype < the 1000-seed weight of Brassica napus with TG genotype < the 1000-seed weight of Brassica napus with TT genotype; after TG and TT are further combined into the T allele carrier type, the 1000-seed weight of T allele carrier type materials is significantly higher than that of GG genotype materials in both two years. The two-year joint analysis shows that the main effect of the T allele carrier type is significant, while the interaction between the T allele carrier type and the year is not significant, indicating that the T allele of this SNP locus has a stable positive effect on the 1000-seed weight of Brassica napus.

[0013] In conclusion, the SNP molecular marker is located at position 43,480,336 on the scaffoldC05 chromosome of the Brassica napus reference genome Brassica napus cv. ZS11, and the version of the Brassica napus reference genome is ZS11 v0 / HZAU_v0. The assembly number of this version in the NGDC Genome Warehouse is GWHANRE00000000, and the BioProject number is PRJCA002883; or it is located at the 101st base of the nucleotide sequence shown in SEQ ID No.1. This locus has a T / G polymorphism, wherein the T allele is a favorable allelic variation for increasing the 1000-seed weight of Brassica napus.

[0014] To achieve the above objectives, the present invention provides the following technical solutions: On the one hand, the present invention provides an SNP molecular marker related to the thousand-grain weight of Brassica napus. The SNP site is located at position 43,480,336 bp on chromosome C05 of Brassica napus, with the reference genome version being ZS11.v0, and exhibits T / G polymorphism.

[0015] Furthermore, T represents the superior allele of the SNP locus.

[0016] In some specific implementations, the SNP site is located at position 101 bp of the sequence shown in SEQ ID No. 1.

[0017] On the other hand, the present invention provides any one of the following uses for the SNP molecular marker or the reagent for detecting the SNP molecular marker: (1) To detect or assist in the detection of the thousand-grain weight of rapeseed; (2) Predict or assist in predicting the thousand-grain weight of Brassica napus; (3) Breeding or assisted breeding of Brassica napus; (4) Screening or identifying rapeseed of different thousand-seed weights; (5) Prepare products for testing or auxiliary testing of the thousand-grain weight of rapeseed; (6) Prepare products for predicting or assisting in predicting the thousand-grain weight of Brassica napus; (7) Prepare products for breeding or assisted breeding of Brassica napus; (8) Prepare, screen or identify products of Brassica napus with different thousand-seed weights; It is understood that the SNP molecular markers can be detected by whole-genome resequencing, targeted sequencing, PCR amplification followed by sequencing, KASP genotyping, fluorescent probe detection, gene chips, or other SNP genotyping methods.

[0018] Optionally, the reagents for detecting the SNP molecular markers include any one or more of primers, probes, kits, or gene chips.

[0019] On the other hand, the present invention provides a method for detecting or assisting in the detection of the thousand-grain weight of Brassica napus, comprising extracting genomic DNA of the Brassica napus to be tested, detecting the genotype of the SNP molecular marker, and detecting or assisting in the detection of the thousand-grain weight of the Brassica napus based on the genotype.

[0020] In some specific implementations, when the genotype of the rapeseed to be tested is TG or TT, its thousand-seed weight is determined to be high; when the genotype of the rapeseed to be tested is GG, its thousand-seed weight is determined to be low.

[0021] On the other hand, the present invention provides a method for breeding or assisted breeding of Brassica napus, which involves detecting or assisting in the detection of the genotype of the SNP molecular marker, and selecting Brassica napus with the TG or TT genotype as parents for breeding.

[0022] Preferably, TT genotype rapeseed is selected as the parent for breeding.

[0023] Compared with the prior art, the present invention has the following beneficial effects: This invention provides a SNP molecular marker, scaffoldC05:43480336:T:G, associated with the thousand-grain weight of Brassica napus. This SNP locus exhibits clear T / G polymorphism, and the T allele is associated with higher thousand-grain weight. This SNP locus showed a consistent genotypic effect trend in both 2024 and 2025, indicating good trans-annual stability. Using this SNP molecular marker, high-thousand-grain-weight potential materials can be screened through DNA detection at the seedling stage or early stage, improving the efficiency of high-yield breeding of Brassica napus. It can be used for screening high-thousand-grain-weight materials in Brassica napus, molecular-assisted selection breeding, germplasm resource evaluation, and improvement of yield-related traits. Attached Figure Description

[0024] Figure 1 Manhattan plot for genome-wide association analysis of 1,000-grain weight in Brassica napus in 2024.

[0025] Figure 2 Manhattan plot for genome-wide association analysis of 1,000-grain weight in Brassica napus in 2025.

[0026] Figure 3 The image shows a comparison of the thousand-grain weight of different genotypes GG, TG, and TT materials at the scaffoldC05:43480336:T:G locus; the left image shows the thousand-grain weight comparison in 2024; and the right image shows the thousand-grain weight comparison in 2025.

[0027] Figure 4 The image shows a comparison of the thousand-grain weight between GG genotype materials and T allele carrier materials at the scaffoldC05:43480336:T:G locus. The left image shows the thousand-grain weight comparison in 2024, and the right image shows the thousand-grain weight comparison in 2025. Detailed Implementation

[0028] The following embodiments are used to further illustrate the present invention, but should not be construed as limiting the scope of protection of the present invention. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods in the art. Unless otherwise specified, the reagents and instruments in the following embodiments are commercially available. Unless otherwise specified, the software, parameters, and statistical methods used in the following embodiments can be adjusted according to conventional methods in the art. Modifications, substitutions, or equivalent transformations made by those skilled in the art to the present invention without departing from the essential content of the present invention should all fall within the scope of protection of the present invention.

[0029] Example 1: Screening of SNP molecular markers related to the thousand-seed weight of Brassica napus 1. Natural Community Building A natural population of 520 Brassica napus accessions was selected for thousand-grain weight phenotypic survey and genome-wide association analysis. The 520 accessions were planted in Linping District, Hangzhou City in 2023 and 2024, and were sourced from Zhejiang Academy of Agricultural Sciences, Zhejiang University, Xinyang Academy of Agricultural Sciences, and Xianghu Laboratory, respectively.

[0030] 2. Thousand-grain weight phenotypic survey The above-mentioned natural populations of Brassica napus were surveyed in 2024 and 2025 respectively. n = 520) A thousand-grain weight phenotypic survey was conducted. After harvesting seeds of each material at maturity, their thousand-grain weight phenotype was measured, and missing and outlier records were cleaned up. After verification and correction of the phenotypic data, the thousand-grain weight phenotypic data for 2024 and 2025 were obtained. The above phenotypic data were used for subsequent genome-wide association analysis and SNP genotype effect validation.

[0031] 3. Whole genome resequencing and SNP genotyping Young leaves from 520 samples of Brassica napus were collected and submitted for testing according to Novogene's sample submission requirements. Novogene performed genomic DNA extraction, quality control, library construction, and whole-genome resequencing. After obtaining the raw sequencing data, quality control was performed, and high-quality sequences were aligned to the Brassica napus reference genome ZS11 v0. Subsequently, SNP detection and genotyping were performed, and SNP sites were quality filtered to obtain high-quality SNP data for genome-wide association analysis.

[0032] 4. Genome-wide association analysis Genome-wide association analysis (GWAS) was performed using 2024 and 2025 thousand-grain weight phenotype data and whole-genome SNP genotype data, employing a mixed linear model. Population structure covariates and a kinship matrix were incorporated into the analysis to correct for population structure and inter-individual genetic correlations.

[0033] Genome-wide association analysis (GWAS) detected candidate SNPs associated with thousand-grain weight on the scaffoldC05 chromosome. Among them, the SNP molecular marker scaffoldC05:43480336:T:G showed a positive support signal in the 2024 data, with a p-value of 2.28847e-05 and an effect size b of 0.380606. Figure 1 The 2025 data showed a strong correlation, with a p-value of 1.43335e-08 and an effect size b of 0.421638. Figure 2 The effect of this locus was consistent in both years, showing a positive increase in thousand-grain weight due to the T allele.

[0034] Information on the SNP sites is detailed in Table 1. The SNP molecular markers are located at positions 43,480,336 on chromosome scaffoldC05 of the Brassica napus cv. ZS11 reference genome. The version of the Brassica napus reference genome is ZS11 v0 / HZAU_v0. This version has the assembly number GWHANRE00000000 in the NGDC Genome Warehouse and the BioProject number PRJCA002883.

[0035] Table 1. SNP molecular markers associated with thousand-grain weight of Brassica napus

[0036] Example 2: scaffoldC05:43480336:T:G site and its upstream and downstream sequences Based on the *Brassica napus* reference genome ZS11 v0, 100 bp sequences were extracted upstream and downstream of the scaffoldC05:43480336:T:G site (i.e., the nucleotide sequence of the scaffoldC05:43,480,236 - 43,480,436 region in the *Brassica napus* reference genome ZS11v0), resulting in a 201 bp nucleotide sequence, denoted as SEQ ID No. 1. The SNP site is located at position 101 of the nucleotide sequence shown in SEQ ID No. 1. The reference base for this site is T, and T / G polymorphism exists in the natural population of *Brassica napus*.

[0037] The sequence shown in SEQ ID No. 1 is as follows, where position 101 is the T / G polymorphism site: TTTTGGATTAGCTTCGATGCCGCGGAATGTGACTAGGTAGCCGAGGAATTCCCCTAATGCCACGGTAAACCTGCATTTTGTCGGGTTGAGCTTCATGTTATGGGAATTTAACTGCACGAAACATTCCTCGAGATGTGATACGTGATCCTTTGCTTTGAGGGATTTGACGAGTATGTCGTCGATATAAACCTCCATCGTTTT (the bold font indicates the SNP site).

[0038] In the officially submitted ST.26 sequence listing, position 101 of SEQ ID No.1 is represented by the reference base T. It should be noted that this site can be detected as T or G in the test material, and the favorable allele is T.

[0039] Example 3 Genotype effect analysis of the scaffoldC05:43480336:T:G site SNP genotype data were obtained based on whole-genome resequencing, and the genotypes of the scaffoldC05:43480336:T:G site in each material were extracted. This site has T / G polymorphism, and the genotypes include GG, TG and TT.

[0040] From Table 2 and Figure 3 it can be seen that in 2024, the number of Brassica napus materials with GG, TG and TT genotypes was 362, 34 and 7 respectively, and the average 1000-seed weight was 3.0967 g, 3.3676 g and 4.4571 g respectively; in 2025, the number of Brassica napus materials with GG, TG and TT genotypes was 391, 37 and 7 respectively, and the average 1000-seed weight was 2.4471 g, 2.7486 g and 3.9429 g respectively. In both years, a trend was presented that the 1000-seed weight of Brassica napus with GG genotype < the 1000-seed weight of Brassica napus with TG genotype < the 1000-seed weight of Brassica napus with TT genotype.

[0041] Table 2 Comparison of 1000-seed weight of Brassica napus materials with different genotypes of scaffoldC05:43480336:T:G

[0042] In this example, a linear model was also used for variance analysis of materials with different genotypes, and covariates PC1-PC5 were added for correction. The specific results are shown in Table 3.

[0043] Table 3 Statistical results of genotype effect of scaffoldC05:43480336:T:G

[0044] The results showed (Table 3) that the difference between materials of different genotypes in 2024 was extremely significant, and the GENOTYPE effect p value was 8.472e-09; the difference between materials of different genotypes in 2025 was extremely significant, and the GENOTYPE effect p value was 7.101e-15. In the two-year joint model, the main effect of GENOTYPE was extremely significant, p with a value less than 2.2e-16; the GENOTYPE × Year interaction effect was not significant, p with a value of 0.9047, indicating that the genotype effect of this SNP locus was relatively stable in the two years, which further verified the relationship between this SNP locus and the 1000-seed weight of Brassica napus.

[0045] Example 4 Analysis of the effect of the T allele carrier type at the scaffoldC05:43480336:T:G locus Since the sample size of Brassica napus with TT genotype is relatively small, to improve the robustness of statistical analysis, in this example, Brassica napus with TG genotype and Brassica napus with TT genotype are combined into the T allele carrier type, namely T-carrier, for comparison with Brassica napus materials of GG genotype.

[0046] From Table 4 and Figure 4 it can be seen that in 2024, the number of Brassica napus materials of GG genotype was 362, with an average 1000-seed weight of 3.0967 g; the number of T-carrier Brassica napus materials was 41, with an average 1000-seed weight of 3.5537 g. In 2025, the number of Brassica napus materials of GG genotype was 391, with an average 1000-seed weight of 2.4471 g; the number of T-carrier Brassica napus materials was 44, with an average 1000-seed weight of 2.9386 g. Similarly, in both two years, there was a trend that the 1000-seed weight of Brassica napus with GG genotype was less than that of Brassica napus with T-carrier genotype, which was consistent with Example 3, proving that the T allele is a dominant allele.

[0047] Table 4 Comparison of 1000-seed weight of Brassica napus materials with different genotypes at scaffoldC05:43480336:T:G

[0048] In this example, a linear model was also used for analysis of variance on materials of different genotypes, with PC1-PC5 covariates added for correction, and the specific results are shown in Table 5.

[0049] Table 5 Statistical results of genotype effect of scaffoldC05:43480336:T:G

[0050] Statistical analysis (Table 5) shows that in 2024, the thousand-particle weight of T-carrier materials was significantly higher than that of GG materials, indicating a significant CARRIER effect. p The value is 9.384e-06; similarly, in 2025, the thousand-grain weight of T-carrier materials was significantly higher than that of GG materials, indicating a CARRIER effect. p The value is 4.210e-09. In the two-year joint model, the main effect of CARRIER is highly significant. p The value was 1.83e-10, while the CARRIER × Year interaction effect was not significant. p The value was 0.7986, indicating that the T allele has a stable positive effect on the thousand-grain weight of Brassica napus, regardless of the planting years. This result is consistent with the prediction in Example 1.

[0051] Example 5: Additive effect analysis of scaffoldC05:43480336:T:G site This embodiment further constructs an additive model using T allele dosage, where the GG, TG, and TT genotypes of Brassica napus are denoted as 0, 1, and 2, respectively. The model is constructed as follows: TRAIT ~ DOSAGE + Year + DOSAGE:Year + PC1 + PC2 + PC3 + ​​PC4 + PC5 Table 6 Statistical results of scaffoldC05:43480336:T:G genotype effects

[0052] Table 6 shows that the main effect of DOSAGE (dose) was extremely significant. p The value was 1.234e-15; the DOSAGE × Year interaction effect was not significant. p The value was 0.7294, indicating that the increase in T allele dosage was significantly associated with the increase in thousand-grain weight of Brassica napus. Moreover, this additive effect was relatively stable in both years and was less affected by external factors, further proving that the T allele has a stable positive effect on the thousand-grain weight of Brassica napus.

[0053] Example 6: Neighbor gene analysis of scaffoldC05:43480336:T:G locus Based on the ZS11 v0 annotation file of the Brassica napus reference genome, genes within a 100 kb range upstream and downstream of the scaffoldC05:43480336:T:G site were searched. The results showed that this SNP site did not fall within any annotated genes; however, the neighboring gene BnaC05G0382000ZS was detected approximately 83.8 kb downstream. These results suggest that this SNP site can be used as a molecular marker associated with the thousand-grain weight of Brassica napus for selection assistance. The scope of protection of this invention is not limited to whether the SNP is located within a specific candidate gene.

[0054] Example 7: A method for screening the thousand-grain weight of Brassica napus based on SNP molecular markers This embodiment uses the SNP molecular marker scaffoldC05:43480336:T:G obtained in Example 1 to screen for high thousand-grain weight materials in a Brassica napus breeding population, including the following steps: (1) Collect tender leaves or other tissues of the rapeseed material to be tested; (2) Extract genomic DNA from the material to be tested; (3) The genotype of the scaffoldC05:43480336:T:G site was obtained by whole-genome resequencing, targeted sequencing, PCR amplification and sequencing, KASP typing, fluorescent probe detection or gene chip detection; In some specific implementations, the scaffoldC05:43480336:T:G site can be detected by PCR amplification and sequencing. The primers used to amplify the adjacent sequences of this SNP site are as follows: C05-43480336-F2: CCACGGTAAACCTGCATTTTGT (SEQ ID No. 2); C05-43480336-R2: ACTTAAACAAGGCCTGTCCACA (SEQ ID No. 3).

[0055] The primers amplified fragments located at scaffoldC05:43,480,295-43,480,681, with an amplification product length of 387 bp, containing the scaffoldC05:43,480,336 site. Using the primer pairs (SEQ ID No. 2 ~ SEQ ID No. 3), PCR amplification was performed on the genomic DNA of the rapeseed material to be tested, and the amplification products were sequenced. The genotype of the material at the stated SNP site was determined based on the sequencing results.

[0056] (4) Determine the genotype of the material to be tested at the scaffoldC05:43480336:T:G locus based on the test results; (5) When the genotype of the material to be tested is TG or TT, it is determined that it carries the T allele and has a higher thousand-grain weight; when the genotype of the material to be tested is GG, its thousand-grain weight is relatively low. (6) In the high-yield breeding of Brassica napus, materials carrying the T allele should be given priority as parents or offspring.

[0057] In summary, by detecting the genotype at the scaffoldC05:43480336:T:G locus, Brassica napus materials can be distinguished into three types: GG, TG, and TT. Materials with the TG or TT genotype generally exhibit higher thousand-grain weight, while materials with the GG genotype generally exhibit lower thousand-grain weight. Therefore, this SNP molecular marker can be used to assist in distinguishing Brassica napus materials with different thousand-grain weights. When the tested material has the genotype TG or TT, it can be determined that it carries the T allele and has a higher thousand-grain weight; when the tested material has the genotype GG, its thousand-grain weight can be determined to be relatively lower. The SNP molecular marker and its detection reagents described in this invention can be used for screening high thousand-grain weight Brassica napus materials, evaluating germplasm resources, and molecularly assisted selection breeding.

[0058] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, are covered within the scope of protection of the present invention.

Claims

1. Any of the following uses for reagents used to detect SNP molecular markers: (1) To detect or assist in the detection of the thousand-grain weight of rapeseed; (2) Predict or assist in predicting the thousand-grain weight of Brassica napus; (3) Cultivate or assist in the cultivation of high thousand-grain weight Brassica rape varieties; (4) Screening or identifying rapeseed of different thousand-seed weights; (5) Prepare products for testing or auxiliary testing of the thousand-grain weight of rapeseed; (6) Prepare products for predicting or assisting in predicting the thousand-grain weight of Brassica napus; (7) Prepare products for cultivating or assisting in the cultivation of high thousand-seed weight Brassica napus varieties; (8) Prepare, screen or identify products of Brassica napus with different thousand-seed weights; in, The SNP molecular marker is located at position 43,480,336 bp on chromosome C05 of Brassica napus, with the reference genome version being ZS11.v0, and exhibits T / G polymorphism. When the genotype of the SNP molecular marker in Brassica napus is TG or TT, its thousand-seed weight is considered to be high; when the genotype of the SNP molecular marker in Brassica napus is GG, its thousand-seed weight is considered to be low.

2. The use as described in claim 1, characterized in that, The reagents for detecting the SNP molecular markers include any one or more of primers, probes, kits, or gene chips.

3. A method for detecting or assisting in the detection of the thousand-grain weight of Brassica napus, characterized in that, The method includes extracting genomic DNA from the rapeseed to be tested, detecting the genotype of the SNP molecular marker, and detecting or assisting in the detection of the thousand-seed weight of the rapeseed based on the genotype: when the genotype of the rapeseed to be tested is TG or TT, its thousand-seed weight is determined to be high; when the genotype of the rapeseed to be tested is GG, its thousand-seed weight is determined to be low; the SNP molecular marker is located at position 43,480,336 bp on chromosome C05 of rapeseed, the reference genome version is ZS11.v0, and it has T / G polymorphism.

4. A method for cultivating or assisting in the cultivation of Brassica napus varieties with high thousand-seed weight, characterized in that, The genotype of SNP molecular markers was detected or assisted in the detection, and TG or TT genotypes of Brassica napus were selected as parents for breeding; the SNP molecular markers were located at positions 43,480,336 bp on chromosome C05 of Brassica napus, with the reference genome version being ZS11.v0, and exhibiting T / G polymorphism.

5. The method as described in claim 4, characterized in that, TT genotype rapeseed was selected as the parent for breeding.

6. The use as described in any one of claims 1-2 or the method as described in any one of claims 3-5, characterized in that, T represents the superior allele of the SNP molecular marker.

Images