A firming anti-wrinkle polypeptide that inhibits the activity of SNAP25 protein

Abstract

The present application provides a kind of compact anti-wrinkle polypeptide for inhibiting SNAP25 protein activity, specifically, the present application takes SNAP25 protein as antigen, and polypeptide library is screened out with SNAP25 protein specific binding and inhibiting the polypeptide of SNAP25 protein participating in forming vesicle complex, the polypeptide inhibits acetylcholine from vesicle, has the efficacy of compact anti-wrinkle.

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, and more specifically, this invention relates to a firming and anti-wrinkle polypeptide that inhibits the activity of SNAP25 protein. Background Technology

[0002] Neuronal communication is a tightly interconnected process. Information transfer between neurons occurs at synapses, where neuronal information is converted from electrical action potentials into neurochemical signals. A synapse contains a presynaptic active region (a cluster of vesicle fusion sites and calcium channels on the presynaptic cell membrane), a synaptic cleft, and a postsynaptic dense region (an electron-dense domain containing specialized postsynaptic neurons that receive and integrate synaptic signals). Synaptosome-associated protein 25 kDa (SNAP-25) is a key protein involved in the formation of the neurosoluble N-ethylmaleimide-sensitive factor attachment protein receptor complex, responsible for calcium-dependent exocytosis of neurotransmitters. SNAP-25 is a member of this protein superfamily, located on the cytoplasmic surface of the plasma membrane. It forms a stable ternary complex, the SNARE complex, with two other family members, syntaxin and synaptobrevin. SNAP-25 directly participates in the regulation of neurotransmitter release and neuronal plasticity. It plays a significant role in the efflux of synaptic vesicles, mediating the fusion of the synaptic vesicle membrane and the plasma membrane, thus preparing for the release of calcium-dependent neurotransmitters.

[0003] SNAP-25 is also expressed at certain levels in muscle tissue. This suggests that SNAP-25 may play a role in maintaining muscle function and motor regulation. SNAP-25 protein is mainly expressed at neuronal synaptic terminals and participates in regulating the release of neurotransmitters.

[0004] Therefore, inhibiting the activity of SNAP-25 protein, and thus inhibiting the release of acetylcholine, helps to slow down muscle movement and achieve anti-aging and wrinkle-reducing effects. Summary of the Invention

[0005] The purpose of this invention is to provide a firming and anti-wrinkle polypeptide that inhibits the activity of SNAP-25 protein.

[0006] This invention targets SNAP25, a neurotransmitter release-related target, and designs and screens highly efficient and specific active peptides to inhibit SNAP25 protein activity, thereby inhibiting acetylcholine release and achieving anti-aging and wrinkle-reducing effects.

[0007] In a first aspect of the invention, there is provided an isolated polypeptide or a pharmaceutically acceptable salt thereof that binds to SNAP25 protein, said polypeptide or pharmaceutically acceptable salt thereof having an amino acid sequence as shown in any of SEQ ID NO. 5-11, and said polypeptide having the effect of inhibiting acetylcholine release.

[0008] In another preferred embodiment, the polypeptide specifically binds to the SNAP25 protein.

[0009] In another preferred embodiment, the polypeptide inhibits the SNAP25 protein from participating in the formation of vesicle complexes.

[0010] In another preferred embodiment, the polypeptide inhibits the release of acetylcholine from the vesicle complex.

[0011] In another preferred embodiment, the polypeptide has an amino acid sequence as shown in SEQ ID NO.5.

[0012] In another preferred embodiment, the polypeptide has an amino acid sequence as shown in SEQ ID NO.7.

[0013] In another preferred embodiment, the polypeptide has an amino acid sequence as shown in SEQ ID NO.8.

[0014] In another preferred embodiment, the polypeptide has an amino acid sequence as shown in SEQ ID NO.10.

[0015] In another preferred embodiment, the polypeptide is a polypeptide having ≥50%, ≥60%, ≥70%, ≥80%, or ≥90% identity (or homology) with any of the amino acid sequences shown in SEQ ID NO. 5-11.

[0016] In another preferred embodiment, the polypeptide is a polypeptide having acetylcholine-inhibiting activity formed by substituting, deleting or adding 1-3 (preferably 1-2) amino acid residues of any of the amino acid sequences shown in SEQ ID NO. 5-11.

[0017] In another preferred embodiment, the polypeptide is obtained by screening a polypeptide library using SNAP25 protein, which is induced to be expressed in vitro, as an antigen.

[0018] In another preferred embodiment, the amino acid sequence of the in vitro induced SNAP25 protein is shown in SEQ ID NO.1.

[0019] In another preferred embodiment, the nucleotide sequence of the in vitro induced SNAP25 protein is shown in SEQ ID NO.3.

[0020] In another preferred embodiment, the optimized nucleotide sequence of the in vitro induced SNAP25 protein is shown in SEQ ID NO.2.

[0021] In another preferred embodiment, the expression vector for the in vitro induced expression of SNAP25 protein is pET32a.

[0022] In another preferred embodiment, the polypeptide is used to prepare a drug that inhibits the release of acetylcholine.

[0023] In another preferred embodiment, the polypeptide is used to prepare a firming and anti-wrinkle cosmetic product.

[0024] In a second aspect of the invention, a fusion protein is provided, the fusion protein comprising:

[0025] (a) A polypeptide or a pharmaceutically acceptable salt thereof as described in the first aspect of the invention;

[0026] (b) A peptide fused with the polypeptide or a pharmaceutically acceptable salt thereof as described in the first aspect of the invention.

[0027] In a third aspect of the invention, an isolated nucleic acid is provided, said nucleic acid encoding a polypeptide as described in the first aspect of the invention or a pharmaceutically acceptable salt thereof, and / or a fusion protein as described in the second aspect of the invention.

[0028] In a fourth aspect of the invention, a carrier is provided that comprises the nucleic acid described in the third aspect of the invention.

[0029] In a fifth aspect of the invention, a host cell is provided, the host cell containing the vector of the fourth aspect of the invention or the genome of which is integrated with exogenous nucleic acid of the third aspect of the invention.

[0030] In a sixth aspect of the invention, a composition is provided, the composition comprising:

[0031] (a) a polypeptide or a pharmaceutically acceptable salt thereof as described in the first aspect of the invention; and

[0032] (b) A pharmaceutically acceptable carrier or a cosmetically acceptable excipient.

[0033] In another preferred embodiment, the composition is a pharmaceutical composition or a cosmetic composition.

[0034] In another preferred embodiment, the composition is used to inhibit the release of acetylcholine.

[0035] In another preferred embodiment, the composition is used for firming and anti-wrinkle purposes.

[0036] In another preferred embodiment, the excipients acceptable for use in cosmetics are selected from the group consisting of: moisturizers, skin conditioning agents, thickeners, emollients, emulsifiers, antioxidants, preservatives, UV protectants, film-forming agents, oil-soluble gelling agents, organically modified clay minerals, resins, fragrances, salts, pH adjusters, conditioning agents, chelating agents, cooling agents, anti-inflammatory agents, skin-beautifying ingredients, vitamins, amino acids, nucleic acids, inclusion compounds, solvents (such as water), or combinations thereof.

[0037] In another preferred embodiment, the dosage form of the composition is selected from the group consisting of liquid dosage forms, semi-solid dosage forms or solid dosage forms, more preferably ointments, creams, emulsions, oils, powders, solutions, gels, sprays, foams, suspensions, lotions or sticks.

[0038] In another preferred embodiment, the composition is a face cream, lotion, serum, cleanser, or essence.

[0039] In a seventh aspect of the invention, a method for skin firming and anti-wrinkle treatment is provided, the method comprising the steps of:

[0040] Apply an effective amount of the polypeptide, fusion protein, nucleic acid, vector, host cell, or composition as described in the first aspect of the invention, the second aspect of the invention, the third aspect of the invention, the fourth aspect of the invention, the fifth aspect of the invention, or the sixth aspect of the invention to the desired object.

[0041] In another preferred embodiment, the application includes injection, topical application to the skin, topical application to mucous membranes, and wound dressing.

[0042] In another preferred embodiment, the method helps to improve the skin barrier, smooth fine lines, and shrink pores.

[0043] In an eighth aspect of the invention, there is provided the use of a polypeptide as described in the first aspect of the invention, a fusion protein as described in the second aspect of the invention, a nucleic acid as described in the third aspect of the invention, a carrier as described in the fourth aspect of the invention, a host cell as described in the fifth aspect of the invention, or a composition as described in the sixth aspect of the invention, for the preparation of a drug that inhibits the release of acetylcholine or a firming and anti-wrinkle cosmetic product.

[0044] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description

[0045] Figure 1 The results of the SNAP25 protein domain prediction are shown.

[0046] Figure 2 The complete map of the pET32a-SNAP25 expression plasmid is shown.

[0047] Figure 3 The expression of SNAP25 protein is shown.

[0048] Figure 4The results of SNAP-25 affinity chromatography SDS-PAGE are shown.

[0049] Figure 5 The image shows the SDS-PAGE results after SNAP-25 digestion.

[0050] Figure 6 The results of SNAP25 desalting and replacement are shown.

[0051] Figure 7 The results of the first library elution with SNAP25 are shown (titer: 5.25 × 10⁶ PFU / mL).

[0052] Figure 8 The results of the second round of library elution with SNAP25 are shown (titer: 1 × 10⁹ PFU / mL).

[0053] Figure 9 The results of the third round of library elution with SNAP25 are shown (titer: 3 × 10⁸ PFU / mL).

[0054] Figure 10 The results of the interaction fitting between SNAP25 and the peptide are shown.

[0055] Figure 11 The results of the acetylcholine content test are displayed. Detailed Implementation

[0056] Through extensive and in-depth research, the inventors have developed a firming and anti-wrinkle polypeptide that inhibits the activity of the SNAP25 protein. This polypeptide specifically binds to the SNAP25 protein, thereby preventing the SNAP25 protein from participating in the formation of vesicle complexes and thus inhibiting the release of acetylcholine. Based on this, the present invention was completed.

[0057] the term

[0058] To facilitate understanding of this invention, certain technical and scientific terms are specifically defined below. Unless otherwise expressly defined herein, all other technical and scientific terms used herein have the meanings commonly understood by one of ordinary skill in the art to which this invention pertains. Before describing this invention, it should be understood that it is not limited to the specific methods and experimental conditions described, as such methods and conditions can be varied.

[0059] As used herein, the terms “comprising,” “including,” and “containing” are used interchangeably and include not only closed definitions but also semi-closed and open definitions. In other words, the terms include “consisting of” and “substantially consisting of”.

[0060] SNAP-25 protein

[0061] Synaptic vesicle membrane docking and fusion are mediated by SNAREs (soluble N-ethylmaleimide-sensitive factor attachment protein receptors) located on the vesicle membrane (v-SNAREs) and target membrane (t-SNAREs). Synaptosome-associated protein 25 kDa (SNAP-25) is one of the key proteins involved in the formation of the neurosoluble N-ethylmaleimide-sensitive factor attachment protein receptor complex, responsible for calcium-dependent exocytosis of neurotransmitters. Synaptosome-associated protein 25 is a member of this protein superfamily, located on the cytoplasmic surface of the plasma membrane. It forms a stable ternary complex, the SNARE complex, with two other family members, syntaxin and synaptobrevin. When the complex is unstable, vesicles cannot effectively release neurotransmitters, resulting in weakened muscle contraction and preventing wrinkle formation.

[0062] In this invention, the SNAP25 protein is indexed as P60880, its amino acid sequence is shown in SEQ ID NO.1, its native nucleotide sequence is shown in SEQ ID NO.3, and its optimized nucleotide sequence is shown in SEQ ID NO.2. The homology between the optimized and unoptimized SNAP25 nucleotide sequences is 77.58%. After induction of expression in E. coli, the SNAP25 protein was used as an antigen to screen for peptides that specifically bind to it in a peptide library. After elution, purification, and sequencing, seven interacting peptides were finally obtained, with amino acid sequences shown in SEQ ID NO.5-11. Affinity and efficacy were then verified.

[0063] Active peptides

[0064] In this invention, the terms "polypeptide of the invention" and "active polypeptide" are used interchangeably, both referring to polypeptides with the effects of inhibiting acetylcholine release and firming and anti-wrinkle properties. Furthermore, the term also includes variant forms of polypeptides having the same activities described above, including (but not limited to): the addition of one or more amino acids (usually up to 5, preferably up to 3, and more preferably up to 2) to the N-terminus. Additionally, the term also includes the polypeptide of the invention in monomeric and polymeric forms, or pharmaceutically acceptable salts thereof.

[0065] This invention also includes active fragments, derivatives, and analogs of the polypeptides of the invention. As used herein, the terms “fragment,” “derivative,” and “analyte” refer to polypeptides that substantially retain the activity of inhibiting acetylcholine release. The polypeptide fragments, derivatives, or analogs of the invention may be (i) polypeptides having one or more conserved or non-conserved amino acid residues (preferably conserved amino acid residues) substituted, or (ii) polypeptides having substituent groups in one or more amino acid residues, or (iii) polypeptides formed by fusing the polypeptide of the invention with another compound (e.g., a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol), or (iv) polypeptides formed by fusing an additional amino acid sequence to this polypeptide sequence (proteins formed by fusing with a leader sequence, secretion sequence, or tag sequence such as 6His). Based on the teachings herein, these fragments, derivatives, and analogs are within the scope well known to those skilled in the art.

[0066] A preferred class of active derivatives refers to peptides formed by replacing up to three, more preferably up to two, and most preferably one amino acid with an amino acid of similar or analogous properties, compared to the specific peptides of this invention. These conserved variant peptides are preferably generated by amino acid substitutions according to Table 1a.

[0067] Table 1a

[0068]

[0069]

[0070] This invention also provides analogs of the polypeptides of the present invention. These analogs may differ from the natural polypeptides of the present invention in terms of amino acid sequence differences, differences in modifications that do not affect the sequence, or both. Analogs also include those having residues different from natural L-amino acids (such as D-amino acids), and those having non-naturally occurring or synthetic amino acids (such as β-, γ-amino acids). For example, Cys can form disulfide bonds with non-natural Hcy. It should be understood that the polypeptides of the present invention are not limited to the representative polypeptides exemplified above.

[0071] Some commonly used non-natural amino acids are listed in Table 1b below.

[0072] Table 1b

[0073]

[0074]

[0075] Modifications (typically without altering the primary structure) include chemically derived forms of peptides, such as acetylation or carboxylation, either in vivo or in vitro. Modifications also include glycosylation, such as those resulting from glycosylation modifications performed during peptide synthesis and processing or further processing steps. This modification can be accomplished by exposing the peptide to glycosylating enzymes (such as mammalian glycosylation or deglycosylation enzymes). Modifications also include sequences containing phosphorylated amino acid residues (such as phosphotyrosine, phosphotyserine, phosphotythreonine). Modifications also include peptides modified to improve their resistance to proteolysis or optimize their solubility.

[0076] A preferred polypeptide of the present invention includes SEQ ID NO.5-11.

[0077] The polypeptides of the present invention also include polypeptides modified from the polypeptides shown in SEQ ID NO.5-11.

[0078] The polypeptides of this invention can also be used in the form of salts derived from pharmaceutically or physiologically acceptable acids or bases. These salts include (but are not limited to) salts formed with the following acids: hydrochloric acid, hydrobromic acid, sulfuric acid, citric acid, tartaric acid, phosphoric acid, lactic acid, pyruvic acid, acetic acid, succinic acid, oxalic acid, fumaric acid, maleic acid, oxaloacetic acid, methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, or hydroxyethanesulfonic acid. Other salts include salts formed with alkali metals or alkaline earth metals (such as sodium, potassium, calcium, or magnesium), and salts in the form of esters, carbamates, or other conventional "prodrugs."

[0079] Pharmaceutical Compositions and Methods of Administration

[0080] The present invention also provides a pharmaceutical composition comprising (a) a safe and effective amount of the polypeptide of the present invention or a pharmaceutically acceptable salt thereof; and (b) a pharmaceutically acceptable carrier or excipient. The amount of the polypeptide of the present invention or a pharmaceutically acceptable salt thereof is typically 10 micrograms to 100 milligrams per dose, preferably 100 to 1000 micrograms per dose.

[0081] For the purposes of this invention, an effective dosage is to administer to an individual from about 0.01 mg / kg to 50 mg / kg, preferably from 0.05 mg / kg to 10 mg / kg body weight, of the polypeptide of the invention or a pharmaceutically acceptable salt thereof. Furthermore, the polypeptide of the invention or a pharmaceutically acceptable salt thereof may be used alone or in combination with other therapeutic agents (e.g., formulated in the same pharmaceutical composition).

[0082] Pharmaceutical compositions may also contain pharmaceutically acceptable carriers. The term "pharmaceutically acceptable carrier" refers to a carrier used for the administration of a therapeutic agent. This term refers to pharmaceutical carriers that do not induce antibodies harmful to the individual receiving the composition and do not cause excessive toxicity after administration. These carriers are well known to those skilled in the art. A thorough discussion of pharmaceutically acceptable excipients can be found in Remington's Pharmaceutical Sciences (Mack Pub. Co., NJ 1991). Such carriers include (but are not limited to): saline, buffer solutions, glucose, water, glycerol, ethanol, adjuvants, and combinations thereof.

[0083] Pharmaceutically acceptable carriers in therapeutic compositions may contain liquids such as water, saline, glycerin, and ethanol. Additionally, these carriers may contain auxiliary substances such as wetting agents or emulsifiers, pH buffers, etc.

[0084] Typically, therapeutic compositions can be formulated as injectable preparations, such as liquid solutions or suspensions; they can also be formulated as solid forms suitable for reconstitution into solutions or suspensions prior to injection, using liquid carriers.

[0085] Once formulated into the compositions of the present invention, they can be administered via conventional routes, including (but not limited to): intratumoral, intramuscular, intravenous, subcutaneous, intradermal, or local administration. The subjects of prevention or treatment may be animals; particularly humans.

[0086] When the pharmaceutical compositions of the present invention are used for actual treatment, various dosage forms of pharmaceutical compositions may be used depending on the application.

[0087] These pharmaceutical compositions can be formulated by mixing, diluting or dissolving according to conventional methods, and occasionally by adding suitable pharmaceutical additives such as excipients, disintegrants, binders, lubricants, diluents, buffers, isotonicities, preservatives, wetting agents, emulsifiers, dispersants, stabilizers and solubilizers, and the formulation process can be carried out in the conventional manner depending on the dosage form.

[0088] The pharmaceutical compositions of the present invention can also be administered in a sustained-release form. For example, the polypeptides of the present invention or their pharmaceutically acceptable salts can be incorporated into a pill or microcapsule carried by a sustained-release polymer, and then the pill or microcapsule is surgically implanted into the tissue to be treated. Examples of sustained-release polymers include ethylene-vinyl acetate copolymers, polyhydrometaacrylate, polyacrylamide, polyvinylpyrrolidone, methylcellulose, lactic acid polymers, lactic acid-glycolic acid copolymers, etc., and preferably biodegradable polymers such as lactic acid polymers and lactic acid-glycolic acid copolymers.

[0089] When the pharmaceutical composition of the present invention is used for actual treatment, the dosage of the polypeptide of the present invention or its pharmaceutically acceptable salt as the active ingredient can be reasonably determined according to the weight, age, sex, and symptom severity of each patient to be treated.

[0090] Compared with the prior art, the advantages of the present invention are as follows:

[0091] 1. The polypeptide molecules of the present invention target and inhibit SNAP25 protein, reduce acetylcholine content, and have excellent firming and anti-wrinkle effects.

[0092] 2. The polypeptides and their derivatives of the present invention have small molecular weights, low toxicity to biological tissues, and high safety.

[0093] 3. It can be prepared by solid-phase synthesis, with high purity, large yield, and low cost.

[0094] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and parts by weight.

[0095] Example 1. Obtaining the SNAP25 protein sequence

[0096] The amino acid sequence of SNAP25 is obtained from the National Center for Biotechnology Information (NCBI) in the United States, with accession number P60880 (https: / / www.ncbi.nlm.nih.gov / protein / P60880), and is 206 amino acids in length.

[0097] The amino acid sequence is (SEQ ID NO.1):

[0098] MAEDADMRNELEEMQRRADQLADESLESTRRMLQLVEESKDAGIRTLVMLDEQGEQLERIEEGMDQINKDMKEAEKNLTDLGKFCGLCVCPCNKLKSSDAYKKAWGNNQDGVVASQPARVVDEREQMAISGGFIRRVTNDARENEMDENLEQVSGIIGNLRHMALDMGNEIDTQNRQIDRIMEKADSNKTRIDEANQRATKMLGSG.

[0099] Furthermore, the SMART (https: / / smart.embl.de / ) and CD-search (https: / / www.ncbi.nlm.nih.gov / Structure / cdd / wrpsb.cgi) online bioinformatics prediction software were used to predict the functional domains of the SNAP25 protein. The results of repeated predictions from the two software programs were combined, yielding two functional domain segments, such as... Figure 1 As shown.

[0100] Example 2. Codon optimization and synthesis of SNAP25 base sequence

[0101] To analyze the expression of the SNAP25 protein sequence fragment, an *E. coli* expression system was used. Since the base sequence encoding SNAP25 is derived from humans, and considering that the expression host is *E. coli*, there is a codon bias between the two. Therefore, the SNAP25 protein sequence fragment was codon optimized using the GenSmart™ codon optimization (Version Beta 1.0) online software to make it more suitable for the *E. coli* expression system.

[0102] Optimized sequence (SEQ ID NO.2):

[0103] ATGGCTGAAGACGCGGATATGCGTAATGAACTGGAGGAAATGCAGCGTCGTGCAGACCAACTGGCGGACGAGTCTCTGGAATCCACCCGCCGCATGTTACAGCTCGTGGAAGAGTCGAAAGACGCGGGTATCCGCACCCTGGTGATGCTGGACGAGCAAGGTGAACAGCTGGAACGCATCGAAGAGGGCATGGATCAAATTAACAAGGACATGAAAGAAGCGGAAAAGAACTTGACTGATTTGGGCAAATTCTGCGGTCTGTGCGTTTGTCCGTGCAATAAGCTGAAATCCAGCGATGCCTACAAAAAGGCCTGGGGTAACAACCAAGATGGTGTTGTTGCTAGCCAGCCGGCTCGTGTGGTGGATGAGCGCGAACAAATGGCAATTAGCGGTGGTTTTATCCGTCGTGTCACCAATGATGCGCGGGAGAACGAGATGGACGAGAACTTGGAACAGGTAAGCGGCATCATCGGCAACCTTCGTCACATGGCGCTGGACATGGGTAACGAGATCGATACCCAGAATCGTCAGATTGACCGTATTATGGAAAAGGCGGATAGCAACAAGACCAGAATTGACGAGGCAAATCAACGTGCTACGAAAATGCTGGGCTCTGGC。

[0104] Native Sequence (SEQ ID NO. 3):

[0105] ATGGCCGAAGACGCAGACATGCGCAATGAGCTGGAGGAGATGCAGCGAAGGGCTGACCAGTTGGCTGATGAGTCGCTGGAAAGCACCCGTCGTATGCTGCAACTGGTTGAAGAGAGTAAAGATGCTGGTATCAGGACTTTGGTTATG TTGGATGAACAAGGAGAACAACTCGATCGTGTCGAAGAAGGCATGAACCATATCAACCAAGACATGAAGGAGGCTGAGAAAAATTTAAAAGATTTAGGGAAATGCTGTGGCCTTTTCATATGTCCTTGTAACAAGCTTAAATCAAGT GATGCTTACAAAAAAGCCTGGGGCAATAATCAGGACGGAGTGGTGGCCAGCCAGCCTGCTCGTGTAGTGGACGAACGGGAGCAGATGGCCATCAGTGGCGGCTTCATCCGCAGGGTAACAAATGATGCCCGAGAAAATGAAATGGATGAAAACCTAGAGCAGG TGAGCGGCATCATCGGGAACCTCCGTCACATGGCCCTGGATATGGGCAATGAGATCGATACACAGAATCGCCAGATCGACAGGATCATGGAGAAGGCTGATTCCAACAAAACCAGAATTGATGAGGCCAACCAACGTGCAACAAAGATGCTGGGAAGTGGTTAA

[0106] The optimized SNAP25 nucleotide sequence showed 77.58% homology with the unoptimized SNAP25 nucleotide sequence. The optimized sequence was then sent to GenScript for synthesis, and the synthesized sequence was integrated into the PUC57 vector, named PUC57-SNAP25.

[0107] Example 3. Construction of pET32a-SNAP25 vector

[0108] After obtaining the target protein sequence, an expression vector is constructed for protein-induced expression. The specific steps are as follows:

[0109] (3.1) Restriction digestion of pET32a expression vector: The pET32a expression vector plasmid was extracted and digested with BamHI and SalI restriction endonucleases. The restriction digestion system and ligation system are as follows:

[0110] Enzyme digestion system (50 μL):

[0111]

[0112] The plasmid was digested at 37℃ for 3 hours. After digestion, the plasmid was purified using a standard DNA product purification kit (DP204) and is ready for use.

[0113] (3.2) SNAP25 exogenous fragment amplification:

[0114] By designing primers to amplify the target exogenous fragment,

[0115] SNAP25-F:

[0116] GCCATGGCTGATATCGGATCCGAGAATCTATATTTTCAATCAATGGCTGAAGACGCGGA.

[0117] SNAP25-R:

[0118] GTGCGGCCGCAAGCTTGTCGACTTAGCCAGAGCCCAGCATTTTC.

[0119] The DNA sequence of SNAP25 was amplified by PCR using TAKARA R45Q DNA polymerase. The PCR system is as follows:

[0120]

[0121] The PCR procedure is as follows:

[0122] 98℃ 10sec

[0123] 58℃ 5sec

[0124] 72℃ 50sec

[0125] The PCR program was used for 28 cycles of amplification.

[0126] The target band was detected by agarose gel electrophoresis and then purified using a DNA gel recovery kit (DP204) for later use.

[0127] (3.3) Ligation and positive clone verification: The pET32a linearized vector and SNAP25 PCR exogenous material from 3.1 and 3.2, respectively, were ligated using TSINGKE TSV-S3. The Seamless Cloning Kit is used for connection, and the connection system is as follows;

[0128] Connection system (10 μL):

[0129] pET32a(BamHI + SalI) 1.5μL

[0130] SNAP25 PCR exogenous 3.5 μL

[0131] 2x Seamless Cloning Mix 5μL

[0132] The reaction was carried out at 50℃ for 45 minutes. After ligation, the bacteria were transformed into DH5α Escherichia coli (purchased from Jinsha Biotechnology). The specific steps are as follows:

[0133] Pretreatment: Remove the competent DH5α cells stored at -80℃ and place them on ice until they reach a semi-thawed state (this state yields the best transformation effect). At this point, quickly aspirate 50 μL of DH5α competent cells into a pre-cooled, sterile 1.5 mL EP tube. Immediately afterward, aspirate 10 μL of the enzyme-ligated recombinant expression plasmid (pET32a-SNAP25) and mix it with the 50 μL of DH5α competent cells. Then, incubate on ice for 30 min.

[0134] Heat shock: After standing in an ice bath for 30 minutes, the 1.5 mL EP tube was placed in a 42°C water bath for 1 minute to allow the recombinant expression plasmid to enter the host.

[0135] Shake culture: Then, place the 1.5 mL EP tube on ice for 3-4 min. After the ice bath, add 200 μL of antibiotic-free LB liquid medium to the 1.5 mL EP tube and incubate at 37°C and 250 rpm for 45 min.

[0136] LB plate culture: Remove the culture from the shaker and centrifuge a 1.5 mL EP tube at 12000 rpm for 1 min at 25°C. Plate culture: Discard 150 mL of supernatant, wash and mix the remaining portion, and drop it onto LA (1‰ Amp, 100 mg / mL) bacterial culture dishes. Spread evenly with a sterile dilution spreader until dry. Then seal the culture dishes and incubate at 37°C for 16 h. (Prepare 25 mL / plate of LA culture dishes in advance.)

[0137] Positive clone verification: Two methods were used for verification: plasmid restriction enzyme digestion verification and sequencing verification.

[0138] Enzyme digestion verification: Pick 3-5 single-clone transformants from the plate and incubate them in 3 mL LB (Amp 1‰, 100 mg / mL) liquid medium at 37℃ and 250 rpm for 4 h. After incubation (preserving 300 μL of each sample in an equal volume of 40% glycerol), extract 30-40 μL of plasmid using a plasmid miniprep kit (refer to the TIANGEN plasmid miniprep kit instructions for specific procedures). Subsequently, perform double digestion with BamHI and SalI restriction endonucleases; analyze the digestion products by gel electrophoresis to check if the size of the digested products meets expectations.

[0139] Sequencing Validation: 20 μL of the extracted plasmid was sent to Wuhan Qingke Biotechnology for sequencing. The sequencing results were compared, and the correctly sequenced plasmid was named pET32a-SNAP25. The plasmid map is shown below. Figure 2 As shown.

[0140] Example 4. Induced expression of SNAP25 protein

[0141] (4.1) Small-scale induction of expression: The plasmid that was successfully sequenced was transformed into competent BL21 cells and cultured overnight. Single-clone transformants were picked from the plates and cultured in 5 mL LB (Amp1‰, 100 mg / mL) liquid medium at 37℃ and 250 rpm until OD600 = 0.6-0.8. IPTG was added to a final concentration of 0.4 mmol / L, and cultured at 18℃ / 37℃ for another 16-18 h.

[0142] (4.2) SDS-PAGE detection: After sampling the induced expression samples, centrifuge at 8000 rpm for 2 min, collect the bacterial cells, resuspend in 700 μL PBS, and disrupt the cells using an ultrasonic cell disruptor. Take 40 μL of the bacterial culture, add 10 μL of 5× reducing protein loading buffer (Biosharp, catalog number: BL502A) and mix well (W). Centrifuge the remaining sample at 12000 rpm for 2 min, take 40 μL of the supernatant, add 10 μL of 5× reducing protein loading buffer (S), discard the supernatant, resuspend in 700 μL PBS, take 40 μL of the bacterial culture, add 10 μL of 5× reducing protein loading buffer (P), and heat denature in a metal bath at 95℃ for 5 min. Take 5 μL of the denatured sample and add 4%-20% SDS-PAGE. SDS-PAGE protein gel (GenScript Biotech, catalog number: M00930) was electrophoresed at 160V for 45 minutes, then stained and destained using a destaining instrument, and photographed on a white light plate.

[0143] Based on the induced expression results, SNAP25 was highly expressed in the supernatant under both 18℃ and 37℃ induction conditions, indicating that large-scale induced expression can be performed. Figure 3 As shown.

[0144] (4.3) Large-scale induction of expression: After activating the preserved SNAP25 glycerol bacteria, cultured them in 800 mL LB (Amp 1‰, 100 mg / mL) liquid medium at 37℃ and 250 rpm until the OD600 reached 0.6-0.8. Then, IPTG was added to a final concentration of 0.4 mmol / L, and the culture was continued at 18℃ for 16-18 h. The bacterial cells were collected by centrifugation at 8000 rpm for 2 min for purification.

[0145] Example 5. SNAP-25 protein purification

[0146] (5.1) Sample purification (SNAP-25 purification: MW before enzyme digestion: 41.89kDa, MW after enzyme digestion: 23.32kDa)

[0147] Clarification and filtration of samples

[0148] The bacterial cells were collected by sonication after resuspending in a balanced solution, and the supernatant was obtained by high-speed centrifugation. A 23cm aerosol was used. 2 The sample was clarified by filtering with a Cobot depth filter (pump speed 15 rpm), and after filtration through a 0.45 μm filter membrane, it was ready for loading onto a nickel column affinity chromatography.

[0149] Nickel column affinity chromatography

[0150] Equilibration: Equilibrate the column to approximately 5 CV using nickel column affinity equilibration buffer, and then load the sample after zeroing the UV value.

[0151] Sample loading: Hold the sample on the Ni column for 5 minutes. After loading, continue to equilibrate with affinity equilibration solution for ≥5 CV until the conductivity is completely parallel to UV 280. Collect the flow-through liquid.

[0152] Washing: Adjust the B pump gradient to 6% B for washing, collect the washed peaks, and continue to equilibrate the column with affinity balancing buffer until the baseline and conductivity are stable. Collect the washed samples for SDS-PAGE analysis.

[0153] Elution: Adjust the B pump gradient to 60% B to elute the target protein, collect the elution peak for SDS-PAGE detection, and wash the column with 100% B.

[0154] Column preservation: Rinse 5 CV columns with water and preserve 3 CV columns with 20% ethanol at 4°C.

[0155] SNAP-25 enzyme digestion followed by affinity chromatography

[0156] Enzyme digestion: Add 4 mL of rTEV enzyme to 50 mL of eluted sample, mix well, and then place in a 10 kDa dialysis bag and dialyze overnight at room temperature in imidazole-free 1×PBS. Filter using a PVDF syringe filter with a pore size of 0.45 μm.

[0157] Sample pretreatment: Filtration using a PVDF syringe filter with a pore size of 0.45 μm.

[0158] Equilibration: Equilibrate the column to approximately 5 CVs with 1×PBS buffer, and then load the sample after zeroing the UV value.

[0159] Sample loading: Hold the sample on the Ni column for 5 minutes. After loading, equilibrate with 1×PBS buffer for 5 CVs until the conductivity is completely parallel to UV 280. Collect the flow-through.

[0160] Elution: Adjust the B pump gradient to 100% B to elute the target protein, collect the elution peak and perform SDS-PAGE detection.

[0161] Column preservation: Rinse 5 CV columns with water and preserve 3 CV columns with 20% ethanol at 4°C.

[0162] SNAP-25 desalination replacement

[0163] Equilibration: Equilibrate the column to approximately 5 CVs with 1×PBS buffer (containing 2mM DTT), and load the sample after zeroing the UV value.

[0164] Sample loading: Load the sample at 30% column volume. After loading, equilibrate with 1×PBS buffer (containing 2mM DTT) for 5 CVs until the conductivity is completely parallel to UV 280. Collect the flow-through.

[0165] Column preservation: 5 CV columns were rinsed with water, and 3 CV columns were preserved with 20% ethanol and stored at 4℃. (5.2) Results analysis

[0166] Nickel column affinity chromatography results are as follows Figure 4 As shown (stock solution: supernatant after bacterial cell disruption; L: supernatant filtrate; FT1-3 are all flow-through solutions, W...), 6％ It's a cleaning solution, E 300 It is the target protein eluent, and the deep filter retains a small amount of protein; the elution contains a large amount of target protein and a small amount of other proteins.

[0167] The affinity chromatography results after SNAP-25 digestion are as follows: Figure 5 As shown (before digestion: the purified protein before rTEV digestion; rTEV: the enzyme protein; after digestion: the purified protein after rTEV digestion; FT: the target protein after digestion and tag removal; E500: impurity proteins other than the target protein),

[0168] SNAP25 desalination replacement, such as Figure 6As shown (Loading indicates the purified target protein, E indicates the target protein replaced in 1×PBS buffer), the concentration was detected to be 0.8 mg / mL, the purity was above 90%, and it was aliquoted at 0.22 μm, filtered and stored at -80℃ for subsequent use in phage display screening experiments.

[0169] Example 6. Phage Screening

[0170] (1) Culture of host bacteria 2738:

[0171] (1.1) Activation of 2738 host bacteria: Take two 10mL centrifuge tubes, pour in 3mL of LB liquid medium, add 3uL of 500mg / mL tetracycline, add 20uL of 2738 glycerol bacteria to one tube, and use the other tube as a blank control. Incubate at 37℃ and 210rpm for 4h in a shaker.

[0172] (1.2) Take a tetracycline plate, dip a small amount of activated 2738 into the inoculation loop, streak it on the tetracycline plate, and place it in a 37°C incubator overnight.

[0173] (2) Screening of peptide phage display libraries

[0174] (2.1) Antigen coating: PBS was used as coating buffer to dilute the protein / antigen. 5 μg / well of 4 wells was coated onto the microplate and coated overnight at 4°C or for 2 hours at 37°C.

[0175] (2.2) Blocking: Invert the ELISA plate containing the protein onto a clean paper towel, shake it vigorously to remove any residual solution, add 400uL of blocking buffer, and incubate at room temperature for 1 hour;

[0176] (2.3) Cleaning: Invert the ELISA plate containing the blocking solution onto a clean paper towel, shake it vigorously to remove the residual solution, and then quickly wash the plate with 200uL of 0.01M PBST buffer (after each addition of PBST, shake it manually to ensure that the bottom and edges of the wells are washed), discard the buffer, invert the plate onto a clean paper towel, shake it vigorously to remove the residual solution, and repeat 3 times;

[0177] (2.4) Coating the pre-prepared peptide library stock solution: Take 90uL of 0.01M PBS buffer and 10uL of peptide library stock solution, mix well, add to the cleaned wells, and shake for 1h at room temperature on an ELISA plate shaker.

[0178] (2.5) Washing: Use a pipette to remove the liquid in the wells of the ELISA plate containing the coated peptide library stock solution and transfer it to a 1.5 mL centrifuge tube (sterilized beforehand). Invert the ELISA plate on a clean paper towel and shake it vigorously to remove any residual solution. Then, quickly wash the plate with 200 μL of 0.01 M PBST buffer (shake manually after each addition of PBST to ensure that the bottom and edges of the wells are washed). Discard the buffer and invert the plate on a clean paper towel (change the paper towel each time to prevent cross-contamination). Shake it vigorously to remove any residual solution. Repeat 5 times.

[0179] (2.6) Elution products: Add 200 μL of elution buffer (pH 3.0 Tris-HCl) to the wells of the eluted microplate, shake at room temperature for 10 min on a microplate shaker, transfer the elution buffer to a 1.5 mL centrifuge tube, add 15 μL of pH 8.0 Tris-HCl to neutralize the elution buffer, which is the first round of elution products, and store at 4 °C.

[0180] (3) Phage titer detection

[0181] (3.1) Take 10 mL centrifuge tubes and pour 3 mL of low-salt LB medium into each tube. Inoculate one tube with 2738 single clones and use the other tube as a blank control. Incubate at 37℃ and 250 rpm until the logarithmic phase (OD600 = 0.4-0.6).

[0182] (3.2) Phage dilution: Take 10 uL of the phage liquid to be tested, dilute it 10 times with LB medium, take 200 uL of the appropriate dilution sample and add it to 200 uL of 2738 cells in the logarithmic growth phase, mix well, and incubate at 37℃ for 1.5 h.

[0183] (3.3) Plate pouring: Add 3-4 mL of low-salt LB upper gel containing IPTG and X-gal to the infected bacterial culture, mix well, pour onto a preheated LB lower gel plate, and incubate overnight at 37°C.

[0184] (3.4) Count plaques and calculate titers.

[0185] (4) Phage particle concentration and purification

[0186] (4.1) Activation of 2738: Take two 10mL centrifuge tubes, pour in 3mL of LB liquid medium, add 3uL of 100mg / mL tetracycline, add a single colony picked from the 2738 plate to one tube, and use the other tube as a blank control. Incubate at 37℃ and 210rpm for 4h in a shaker.

[0187] (4.2) Infection: Take a 10mL centrifuge tube, add 200uL of activated 2738 and 20uL of the first round of elution product, and place at 37℃ for 1.5h;

[0188] (4.3) Add the infected bacterial solution to a 200 mL Erlenmeyer flask containing about 30 mL of LB liquid medium and incubate at 37 °C and 250 rpm for 4.5 h (when foam appears and does not dissipate in a short period of time);

[0189] (4.4) Remove the culture medium and transfer it to a 50 mL (sterile) centrifuge tube. Centrifuge at 6000 rpm for 10 min. Transfer the supernatant to another 50 mL centrifuge tube.

[0190] Add 1 / 5 volume of PEG6000+NaCl to the container, seal it in a bag, and let it precipitate overnight at 4°C.

[0191] (4.5) Remove the centrifuge tube from 4℃ and centrifuge at 6000 rpm for 20 min; discard the supernatant (pour the supernatant into the discarded tube and seal it), and dissolve the precipitate in 1 mL of PBS;

[0192] (4.6) Centrifuge at 12000 rpm for 5 min, transfer the supernatant to another 1.5 mL centrifuge tube, add 1 / 5 volume of PEG6000+NaCl, seal the tube and put it in a bag, precipitate at 4℃ for 1 h (or precipitate overnight, but at least precipitate for 1 h).

[0193] (4.7) Centrifuge at 12000 rpm for 10 min, discard the supernatant (pour the supernatant into a discarded tube and seal it), and dissolve the precipitate in 200 uL PBS;

[0194] (4.8) Centrifuge at 12000 rpm for 10 min, transfer the supernatant to another 1.5 mL centrifuge tube, which is the amplified phage / first round enrichment product, and store at 4℃.

[0195] (5) Determination of titer of phage particle concentration products

[0196] (5.1) Activation of 2738: Take two 10mL centrifuge tubes, pour in 3mL of LB liquid medium, add 3uL of 50mg / mL tetracycline, add a single colony picked from the 2738 streak plate (to be used within one week after streak) to one tube, and use the other tube as a blank control. Incubate at 37℃ and 250rpm in a shaker until OD600=0.3-0.4;

[0197] (5.2) Dilution of enriched product: Take a sterile 1.5 mL centrifuge tube and add 180 μL of low-salt LB liquid medium to each tube. Add 20 μL of enriched product to the first tube and mix well. Take 20 μL from the first tube and add it to the second tube, mix well, then take 20 μL from the second tube and add it to the third tube, mix well, and so on, until the desired dilution is achieved.

[0198] (5.3) Infection: The lower gel was placed at 37°C and preheated in the dark. Take 10 mL sterile centrifuge tubes and add 200 μL of 2738 bacterial suspension with LOD600 = 0.3-0.4 and 200 μL of diluted elution product (one tube per dilution). Infect for 1.5 h at 37°C and 150 rpm in a shaker.

[0199] (5.4) Plate pouring (in the dark): Following the preparation method of the upper gel, dissolve the low-salt LB solid medium (prepared with agarose), cool it to 60°C, add X-gal to a final concentration of 40ug / mL and IPTG to a final concentration of 1mM and mix well. At the same time, take a beaker or glass jar and add an appropriate amount of hot water. When the upper gel cools to about 37°C and the hot water cools to about 45°C, pour 3-4mL of upper gel into the bacterial suspension in a 10mL tube, quickly tap the bottom of the tube on the table to mix well, and insert it into 45°C warm water. You can mix a maximum of 6 tubes at a time (if you mix more, the upper gel will easily solidify in the centrifuge tubes due to the lower temperature). Tap the bottom of the tube on the table again to mix well, quickly pour it onto the lower gel plate, in the dark for 10min, then invert it and place it in a 37°C incubator for overnight in the dark.

[0200] (5.5) Observe the next day to see if blue spots appear.

[0201] (5.6) Repeat steps 4.2-4.5 to complete the subsequent experiments: second round of elution → second round of elution product titration → second round of enrichment → second round of enrichment product titration → third round of elution → third round of elution product titration.

[0202] (6) Sequencing

[0203] 96Ⅲ sequencing primers: CCCTCATAGTTAGCGTAACG (primer sequence (5'-3') (SEQ ID NO.4).

[0204] (7) Experimental Results

[0205] SNAP25 protein (designated PTP1) was used as the antigen for screening specific peptide sequences. During the screening process, the enrichment effect was assessed by detecting the phage titer in each round of elution. Results are as follows: Figure 7 , 8 As shown in 9 and Table 1.

[0206] Table 1 Results of Cyclic Heptapeptide Library Screening

[0207]

[0208] Thirty-five single clones were selected from the plates after three rounds of screening and sent to Qingke for sequencing. The sequencing primers were 96III reverse primers, and a total of seven specific sequences were obtained. The results are shown in Table 2.

[0209] Table 2 Information on 7 specific sequences

[0210]

[0211]

[0212] Example 7. Peptide Synthesis

[0213] The selected amino acid sequences and the control (acetyl hexapeptide-8) amino acid sequence were sent to Genscript Biotech for peptide synthesis.

[0214] Table 3. Peptide synthesis sequence information

[0215] polypeptide name amino acid sequence G070101 YRVDLRPDQMGY(SEQ ID NO.5) G070102 VGTREVTTVWAK (SEQ ID NO.6) G070103 LVNHWDWSLNQF (SEQ ID NO.7) G070104 SICPLNSCPSHL (SEQ ID NO.8) G070105 WNSWPFPMASFE (SEQ ID NO.9) G070106 SICPLNPCPSHQ (SEQ ID NO.10) G070107 QAHLSYKPAPYN (SEQ ID NO.11) Acetyl hexapeptide-8 EEMQRR (SEQ ID NO.12)

[0216] Example 8. Affinity Detection

[0217] Biotinylation of SNAP25 protein: Add biotinylation reagent at a molar ratio of 1.5 to the antibody and react at room temperature for 1 hour; remove excess biotinylation reagent from the biotinylated protein using a gravity desalting column.

[0218] Eight peptides (acetyl hexapeptide-8, G070101, G070102, G070103, G070104, G070105, G070106, and G070107) were dissolved in their respective reconstitution buffers to a concentration of 5 mM, and then diluted with PBST buffer to a concentration of 1 mM. Biotinylated SNAP25 protein was specifically captured using an SA chip, and binding to the peptides occurred after signal saturation.

[0219] The interaction signals between the solidified proteins and peptides were higher than those of the unsolidified blank chip, indicating that SNAP25 interacts with eight peptides. After data alignment, the affinity results are as follows: Figure 10 As shown in Table 4.

[0220] Table 4. Affinity results of SNAP25 with peptides

[0221]

[0222] in conclusion:

[0223] SNAP25 binds to acetyl hexapeptide-8 with an affinity of 3.30E-05;

[0224] SNAP25 binds to G070101 with an affinity of 6.15E-04;

[0225] SNAP25 binds to G070102 with an affinity of 7.02E-03;

[0226] SNAP25 binds to G070103 with an affinity of 4.28E-04;

[0227] SNAP25 binds to G070104 with an affinity of 2.34E-04;

[0228] SNAP25 binds to G070105 with an affinity of 8.89E-03;

[0229] SNAP25 binds to G070106 with an affinity of 9.54E-04;

[0230] SNAP25 binds to G070107 with an affinity of 1.03E-03;

[0231] Select G070101, G070103, G070104, and G070106, which have high affinity, for subsequent functional verification.

[0232] Example 9. Cell efficacy

[0233] 1. Detection of acetylcholine content

[0234] Cell seeding: After cell resuscitation, when the cell plating rate reaches approximately 60%, cells are seeded into 6-well plates and incubated overnight in a CO2 incubator (37℃, 5% CO2). Based on the previous affinity test results, acetyl hexapeptide-8, G070101, G070103, G070104, and G070106 peptides were selected as sample groups. Working solutions for the test substances were prepared according to the test groups (Table 5).

[0235] Table 5 Test Groups

[0236]

[0237] Note: BC are blank controls for samples acetyl hexapeptide-8, G070101, G070104, and G070106; SC is the solvent control for sample G070103.

[0238] According to the test groups, when the cell seeding rate in the 6-well plates reached 40%–60%, the drugs were administered to each group at a dose of 2 mL, with 3 replicates per group. The cells were incubated in a CO2 incubator (37℃, 5% CO2) for 24 h. The cell culture supernatant was collected and analyzed according to the acetylcholine assay kit instructions. GraphPad Prism was used for plotting, and the results are expressed as Mean ± SD. t-tests were used for comparisons between groups. All statistical analyses were two-tailed. P < 0.05 was considered statistically significant, and P < 0.01 was considered highly statistically significant. The inhibition rate (%) was calculated as (blank control group - sample group) / blank control group × 100%.

[0239] Table 6 Summary of Test Results

[0240]

[0241] Note: When performing statistical analysis using the one-way ANOVA method, significance compared to the BC group is indicated by *; significance compared to the SC group is indicated by #; and significance compared to the acetyl hexapeptide-8-50ppm group is indicated by ▲.

[0242] The results are as follows Figure 11 As shown in Table 6, compared with BC, the acetylcholine content of samples acetyl hexapeptide-8-50ppm, G070101-50ppm, G070104-50ppm, and G070106-50ppm decreased significantly, with inhibition rates of 34.28%, 42.26%, 20.74%, and 20.36%, respectively.

[0243] Compared with SC, the acetylcholine content in sample G070103-50ppm was significantly reduced, with an inhibition rate of 20.78%.

[0244] Compared with sample acetyl hexapeptide-8-50ppm, the acetylcholine content of sample G070101-50ppm decreased significantly; while the acetylcholine content of samples G070104-50ppm and G070106-50ppm increased significantly.

[0245] Therefore, among the firming and anti-wrinkle active peptides screened from the SNAP25 target protein, G070101 (amino acid sequence: YRVDLRPDQMGY) showed the best effect. Following closely were G070103 (amino acid sequence: LVNHWDWSLNQF), G070104 (amino acid sequence: SICPLNSCPSHL), and G070106 (amino acid sequence: SICPLNPCPSHQ).

[0246] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

Claims

1. An isolated polypeptide or a pharmaceutically acceptable salt thereof that binds to SNAP25 protein, characterized in that, The polypeptide or a pharmaceutically acceptable salt thereof has an amino acid sequence as shown in any of SEQ ID NO. 5-11, and the polypeptide has the effect of inhibiting the release of acetylcholine.

2. The polypeptide according to claim 1, characterized in that, The polypeptide was obtained by screening a polypeptide library using SNAP25 protein, which was induced to be expressed in vitro, as an antigen.

3. The polypeptide according to claim 2, characterized in that, The optimized nucleotide sequence of the in vitro induced SNAP25 protein is shown in SEQ ID NO.

2.

4. The polypeptide according to claim 1, characterized in that, The polypeptide specifically binds to the SNAP25 protein, thereby inhibiting the SNAP25 protein from participating in the formation of vesicle complexes.

5. A fusion protein, characterized in that, The fusion protein includes: (a) the polypeptide of claim 1 or a pharmaceutically acceptable salt thereof; (b) A peptide fused with the polypeptide of claim 1 or a pharmaceutically acceptable salt thereof.

6. An isolated nucleic acid, characterized in that, The nucleic acid encodes the polypeptide as described in claim 1 or a pharmaceutically acceptable salt thereof and / or the fusion protein as described in claim 5.

7. A carrier, characterized in that, The vector contains the nucleic acid as described in claim 6.

8. A host cell, characterized in that, The host cell contains the vector as described in claim 7 or its genome integrated with exogenous nucleic acid as described in claim 6.

9. A composition, characterized in that, The composition comprises: (a) the polypeptide of claim 1 or a pharmaceutically acceptable salt thereof; and (b) A pharmaceutically acceptable carrier or a cosmetically acceptable excipient.

10. A method for firming and reducing wrinkles on the skin, characterized in that, The method includes the following steps: Apply an effective amount of the polypeptide of claim 1, the fusion protein of claim 5, the nucleic acid of claim 6, the vector of claim 7, the host cell of claim 8, or the composition of claim 9 to the desired object.

Images