Application of a chilo suppressalis abcf1 truncated protein in preparation of insect abcf subfamily protein crystal structure

Abstract

The application discloses application of a Chilo suppressalis ABCF1 truncated protein in preparation of an insect ABCF subfamily protein crystal structure, and an amino acid sequence of the truncated protein is shown as SEQ ID NO. 13. The truncated protein disclosed by the application can be used for crystallization of a nucleotide binding domain of the Chilo suppressalis ABCF1 protein, and the crystal retains ATP binding ability and hydrolysis ability of the Chilo suppressalis ABCF1 protein, can be used for researching a mechanism of action of the Chilo suppressalis ABCF1 protein in protein translation regulation, understanding a relationship between a structure and a function, and providing a basis for in-depth research on the crystal structure and the function of the insect ABCF subfamily protein.

Description

Technical Field

[0001] This invention relates to the application of a truncated ABCF1 protein from the rice stem borer in the preparation of crystal structures of insect ABCF subfamily proteins, belonging to the field of biotechnology. Background Technology

[0002] ATP-binding cassette (ABC) proteins are an important family of proteins widely distributed in organisms, participating in various life processes such as substance transport, energy metabolism, and signal regulation. The eukaryotic ABC transporter family includes several subfamilies, from ABCA to ABCG. Members of the ABCF subfamily are characterized by the presence of two nucleotide-binding domains (NBDs). Therefore, unlike typical ABC transporters, they primarily participate in intracellular regulatory processes. Existing research indicates that ABCF proteins play important roles in protein translation regulation, cellular stress responses, and growth and development. In insects, ABCF proteins are considered closely related to insect growth and development, environmental adaptation, and responses to exogenous chemicals, and may play a regulatory role in the formation of insecticide resistance.

[0003] However, current research on insect ABCF proteins mainly focuses on gene level or expression analysis, and their three-dimensional structures have not yet been resolved. This lack of three-dimensional structural information severely restricts a deeper understanding of the mechanisms of action of insect ABCF proteins and also limits the development of structure-based targeted regulatory molecules and novel agricultural pest control agents.

[0004] Therefore, there is an urgent need to provide a method for manipulating the three-dimensional structure of insect ABCF proteins in order to reveal their biological functions based on their structure and to provide new molecular targets and technical means for the control of agricultural pests. Summary of the Invention

[0005] Purpose of the invention: The purpose of this invention is to provide an application of the truncated ABCF1 protein of rice stem borer in the preparation of crystal structures of insect ABCF subfamily proteins, as well as a specific crystallization method.

[0006] Technical solution: The application of the truncated ABCF1 protein of rice stem borer described in this invention in the preparation of crystal structures of insect ABCF subfamily proteins, wherein the amino acid sequence of the truncated protein is shown in SEQ ID NO.13.

[0007] SEQ ID NO. 13: TVSQAQKSAGQMAALENAVDIKVENFSISAKGKDLFVNANLLVANGRRYGLVGPNGHGKTTLLRHLAQRAFPLPPHIDILLCEQEVTATDMSAVDTLLESDVKRTELLNECKKLEAEIENGSLNKQDRLNEVYAELKAIGADSAEPRARRILAGLGFSKEMQDRATKNFSGGWRMRVSLARALYIEPTLLLLDEPTNHLDLNAVIWLDNYLQGWKKTLLIVSHDQSFLDNVCNEIIHLDQQKLFYYKGNYSMFKKMYAQKRKEMIKEYEKQEKRLKDLKAHGQSKKQAEKKQKEALTRKQEKNRKSQRDENEEDSQPVALLQKPKEYVVKFSFPDPPPLQPPILGLHNVDFNFTGQLPLFKGVDFGIDLSSRIAIVGPNGVGKSTFLKLLVGELSPIRGELIRNHRLRIGRFDQHSGEHLTAEESPVEYLQRLFGLQYEKARKALGTFGLASHAHTIKMKDLSGGQKARVALAELTLMAPDVVILDEPTNNLDIESIDALADAINDYKGGVVIVSHDERLIRETDCALYVIEDQTINEVDGDFDDYRKELLESLGETINSPSIIANAAVLQ

[0008] Further, the nucleotide sequence of the encoding gene of said protein is shown in SEQ ID NO. 14.

[0009]

[0010] Furthermore, the truncated ABCF1 protein of the rice stem borer is obtained by the following method: the gene encoding the truncated ABCF1 protein of the rice stem borer is constructed in a prokaryotic expression vector to obtain a recombinant expression vector, and then the recombinant expression vector is transferred into a host cell to express the truncated ABCF1 protein of the rice stem borer; the gene sequence encoding the truncated ABCF1 protein of the rice stem borer is shown in SEQ ID NO. 14.

[0011] Furthermore, the prokaryotic expression is performed using the pET28a-sumo vector.

[0012] Furthermore, the method for constructing the recombinant expression vector is as follows: linearizing the pET28a-sumo vector, ligating the gene sequence encoding the truncated protein of rice stem borer ABCF1 with homologous arms, and then transforming the ligation product into... Trans 1-T1 competent cells.

[0013] Furthermore, the nucleotide sequences of the primers used for linearizing the pET28a-sumo vector are shown in SEQ ID NO.5 and SEQ ID NO.6.

[0014] Furthermore, the nucleotide sequences of the primers used to insert homologous arms into the gene sequence encoding the truncated protein of rice stem borer ABCF1 are shown in SEQ ID NO.24 and SEQ ID NO.8.

[0015] Furthermore, the host cell is Escherichia coli BL21(DE3) competent cells.

[0016] The method for crystallizing the nucleotide-binding domain of the rice stem borer ABCF1 protein according to the present invention includes the following steps: (1) concentrating the purified rice stem borer ABCF1 truncated protein to 10 mg / mL in 20 mM Hepes, 150 mM NaCl, 5 mM MgCl2, 2 mM TCEP and 5% Glycerol at pH 8.0; the amino acid sequence of the truncated protein is shown in SEQ ID NO.13; (2) adding ATP at a molar ratio of 1:3, incubating on ice for 0.5 h, and then incubating the rice stem borer ABCF1 truncated protein solution in a droplet of pooling solution; the pooling solution consists of 15%-27% PEG 3350, 100 mM Bis-Tris propane / Hydrochloricacid at pH 6.0-7.0, and 200 mM Sodium fluoride, and the concentration of the rice stem borer ABCF1 truncated protein solution is 8-11 mg / mL. mg / mL, incubation temperature 4℃.

[0017] Furthermore, the composition of the pool solution is as follows: 17-19% PEG 3350, 100 mM Bis-Trispropane / Hydrochloricacid at pH 6.5, 200 mM Sodium fluoride, and a truncated protein solution of rice stem borer ABCF1 with a concentration of 10 mg / mL, and the incubation temperature is 4℃.

[0018] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: The present invention designs four truncated proteins based on retaining the Uup domain of the rice stem borer ABCF1 protein, and obtains a truncated protein that can be used to prepare the crystal structure of insect ABCF subfamily proteins through a large number of creative experiments. The crystals prepared retain the ATP binding and hydrolytic ability of the rice stem borer ABCF1 protein, and can be used to study the role mechanism of the rice stem borer ABCF1 protein in protein translation regulation and understand the relationship between its structure and function. Attached Figure Description

[0019] Figure 1 Cs The purification results of ABCF1-FL recombinant protein expression; where A represents the purification results of 4 L recombinant protein nickel column, lanes SE represent supernatant, precipitate, flow-through, wash (W1 and W2 refer to 30 and 50 mM imidazole eluted samples, respectively), and 300 mM imidazole eluted samples; B represents ion exchange column results and SDS-PAGE results; C represents gel filtration chromatography results and SDS-PAGE results; Sumo- Cs ABCF1-FL indicates products with the Sumo label. Cs ABCF1-FL recombinant protein; Figure 2 Cs ABCF1 305-920aa Recombinant protein expression and purification results; where A represents the purification results of a 4 L recombinant protein nickel column, lanes SE represent supernatant, precipitate, flow-through, and wash samples (W1 represents 30 mM imidazole eluted sample, W2 represents 50 mM imidazole eluted sample), and 300 mM imidazole eluted sample, respectively; B represents the purification results after TEV digestion, lanes F-W4 represent flow-through, 10, 20, 30, and 300 mM imidazole eluted samples, respectively, and lane Sumo-305-920 represents samples tagged with Sumo. Cs ABCF1 305-920aa Recombinant protein, lanes 305-920 indicate the protein after the Sumo tag has been removed. Cs ABCF1 305-920aa Recombinant protein; C indicates ion exchange column and SDS-PAGE results; D indicates gel filtration chromatography and SDS-PAGE results; Figure 3 Cs ABCF1 340-920aa Recombinant protein expression and purification results; where A represents the purification results of a 4 L recombinant protein nickel column, and lanes SE represent supernatant, precipitate, flow-through, and wash samples (W represents 30 mM imidazole eluted sample) and 300 mM imidazole eluted sample, respectively; B represents the purification results after TEV digestion, and lanes F-W4 represent flow-through, 10, 20, 30, and 300 mM imidazole eluted samples, respectively; lanes 340-920 represent samples after Sumo tag removal. Cs ABCF1 340-920aa Recombinant protein; C indicates ion exchange column and SDS-PAGE results; D indicates gel filtration chromatography and SDS-PAGE results; Figure 4 Cs ABCF1 350-920aa Recombinant protein expression and purification results; where A represents the purification results of a 4 L nickel column for recombinant protein, and lanes SE represent supernatant, precipitate, flow-through, and washed samples (W represents 30 mM imidazole eluted sample) and 300 mM imidazole eluted sample, respectively; B represents the purification results after TEV digestion, and lanes F-W4 represent flow-through, 10, 20, 30, and 300 mM imidazole eluted samples, respectively; lane Sumo-350-920 represents samples tagged with Sumo. Cs ABCF1 350-920aa Recombinant protein, lanes 350-920 indicate the protein after the Sumo tag has been removed. Cs ABCF1 350-920aa Recombinant protein; C indicates ion exchange column and SDS-PAGE results; D indicates gel filtration chromatography and SDS-PAGE results; Figure 5 Cs ABCF1 360-910aa Recombinant protein expression and purification results; where A represents the purification results of a 4 L recombinant protein nickel column, and lanes SE represent supernatant, precipitate, flow-through, and washed samples (W represents 30 mM imidazole eluted sample) and 300 mM imidazole eluted sample, respectively; B represents the purification results after TEV digestion, and lanes F-W4 represent flow-through, 10, 20, 30, and 300 mM imidazole eluted samples, respectively; lanes 360-910 represent samples after Sumo tag removal. Cs ABCF1 360-910aa Recombinant protein; C indicates ion exchange column and SDS-PAGE results; D indicates gel filtration chromatography and SDS-PAGE results; Figure 6Preliminary screening results of four truncated recombinant protein crystals; where A and B represent... Cs ABCF1 305-920aa Crystals of the recombinant protein grown in Index 49-96 No. 34 and No. 35; C and D represent Cs ABCF1 340-920aa Crystals of the recombinant protein grown in Index 1-48 No. 20 and No. 21; E and F indicate Cs ABCF1 350-920aa Crystals of the recombinant protein grown in Wizard Classic 4 No. 28 and Index 49-96 No. 20; G and H indicate Cs ABCF1 360-910aa Crystals of the recombinant protein grown in Index 49-96 No. 19 and Crystal Screen I No. 18; Figure 7 Cs ABCF1 305-920 aa Results of recombinant protein crystal optimization; where A is the crystal grown after optimization, and B is the diffraction pattern of crystal data collection; Figure 8 Cs ABCF1 350-920aa Diffraction pattern of data collected from crystals grown from recombinant protein in Wizard Classic 4 No. 28; Figure 9 Cs ABCF1 350-920aa Results of recombinant protein crystal optimization; where A, B, and C represent crystals grown after optimizing the precipitant concentrations to 17%, 18%, and 19% PEG 3350, respectively. Figure 10 Cs ABCF1 350-920aa Diffraction patterns of recombinant protein crystals after optimization; Figure 11 Cs ABCF1 360-910 aa Results of recombinant protein crystal optimization; where A is the crystal grown after optimization, and B is the diffraction pattern of crystal data collection; Figure 12 Cs ABCF1 350-920aa The three-dimensional structure of the recombinant protein and its ATP binding site, where the blue dashed lines in the figure represent hydrogen bonds; Figure 13 Cs ABCF1 350-920aaConcentration-dependent nature of recombinant protein ATPase activity. Detailed Implementation

[0020] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0021] Example 1

[0022] 1. Borer borer Cs Preparation of full-length ABCF1 protein (1) Cloning of the target gene According to the rice stem borer Cs ABCF1 total length ( Cs Primers were designed for the ABCF1-FL protein (amino acid sequence shown in SEQ ID NO.1, nucleotide sequence shown in SEQ ID NO.2), and PCR technology was used to amplify the target fragment from the cDNA of *Taxodium difficile* larvae in an indoor sensitive strain (a strain continuously raised in this laboratory for many years without exposure to any insecticides during the rearing period). The primer sequences are as follows: Cs ABCF1-F (SEQ ID NO.3): 5'-ATGTCGAAAAAGAAAGGCACAAAG-3'; Cs ABCF1-R (SEQ ID NO. 4): 5'- CCAACGCTGCAGTTCTACAATAG-3'.

[0023] use FastPfu Full-length amplification was performed using Fly rapid high-fidelity DNA polymerase (Beijing TransGen Biotech Co., Ltd., AP231). The reaction volume (25 μL, same below) was: 2× FastPfu Fly Mix, 12.5 μL; forward primer, 0.5 μL; reverse primer, 0.5 μL; cDNA template, 1.0 μL; double-distilled water, 10.5 μL. Reaction program: 98℃, 1 min; 98℃, 10 s; 58℃, 5 s; 72℃, 15 s; 72℃, 1 min; 12℃, 5 min.

[0024] (2) Construction of expression carrier Linearized pET28a-sumo vector (provided by the Multidisciplinary Research Center of the Institute of High Energy Physics, Chinese Academy of Sciences) was obtained by PCR. The linearized vector was amplified using Fly Mix with the following reaction program: 98℃, 1 min; 98℃, 10 s; 61℃, 5 s; 72℃, 60 s; 72℃, 1 min; 12℃, 5 min. Simultaneously, homologous arms of the insert fragment (i.e., full-length) were added using Fly Mix with the following reaction program: 98℃, 1 min; 98℃, 10 s; 58℃, 5 s; 72℃, 15 s; 72℃, 1 min; 12℃, 5 min.

[0025] The primer sequences for the linearized vector primers and the homologous arms of the insert fragment are as follows, with the underlined parts representing the homologous arm sequences: pET28a-sumo-F (SEQ ID NO.5): 5'-CTCGAGCACCACCACCAC-3'; pET28a-sumo-R (SEQ ID NO.6): 5'-GGATCCTCCCTGAAAATACAGGT-3'; Cs ABCF1-TF (SEQ ID NO.7): 5'- TATTTTCAGGGAGGATCC ATGTCGAAAAAGAAAGGCACAAAG -3'; Cs ABCF1-TR (SEQ ID NO.8): 5'- GGTGGTGGTGCTCGAG CTATTGTAGAACTGCAGCGTTGGC-3'.

[0026] The bonding products are transferred via thermal shock. Trans In 1-T1 competent cells (Beijing TransGen Biotech Co., Ltd., CD501), a method was constructed... Cs The ABCF1-FL-pET28a-sumo recombinant expression plasmid was used to identify positive clones by bacterial culture PCR.

[0027] (3) Extraction of recombinant expression plasmids The positive clone bacterial culture was sent for sequencing (Sangon Biotech (Shanghai) Co., Ltd.). After the sequencing was successful, the plasmid was extracted using a plasmid miniprep kit (Beijing TransGen Biotech Co., Ltd., EM101).

[0028] (4) Expression and purification of recombinant proteins Transformation: Cs The recombinant plasmid ABCF1-FL-pET28a-sumo was transformed into E. coli using the heat shock method. Transetta(DE3) competent cells (Beijing TransGen Biotech Co., Ltd., CD801) were cultured on LB solid medium plates at 37°C for 12–16 h.

[0029] Expression: Single colonies were picked and incubated overnight in a shaker at 37°C, then transferred to 1 L LB liquid medium and incubated in a shaker at 37°C until OD (Organic Growth Rate) was reached. 600 =0.6-0.8, cool to 16℃, add IPTG to a final concentration of 0.2 mM and incubate for 16-20 h.

[0030] Cell collection and disruption: Cells were transferred to centrifuge flasks and centrifuged at 5000 g for 10 min. The supernatant was discarded, and the collected cell pellet was resuspended in PBS (pH 7.4). Cell disruption was performed using a high-pressure homogenizer at low temperature. The cell disruption buffer was then centrifuged at 24000 g for 60 min in a cryogenic centrifuge.

[0031] Purification: The supernatant was collected, and initial purification was performed by nickel column affinity chromatography. Further purification was achieved by ion exchange chromatography and size exclusion chromatography to obtain a high-concentration target protein with a uniform polymerization state. The specific experimental steps for protein purification are as follows: 1) Affinity chromatography: Proteins were purified by nickel column affinity chromatography using a manually packed gravity column. The nickel column was equilibrated with PBS buffer before purification. The cell lysis supernatant and nickel column packing were incubated together at 4°C for 30-60 min until natural flow-through was achieved. Contaminating proteins were then washed sequentially with wash buffers containing different concentrations of imidazole (400 mM NaCl; 20 mM Hepes (pH 8.0); 10 mM MgCl2; 2 mM TCEP; 5% Glycerol; 30 mM / 50 mM imidazole). Finally, elution was performed with elution buffer containing a high concentration of imidazole (400 mM NaCl; 20 mM Hepes (pH 8.0); 10 mM MgCl2; 2 mM TCEP; 5% Glycerol; 300 mM imidazole). Samples from each step were then analyzed by SDS-PAGE electrophoresis (see [link to SDS-PAGE analysis]). Figure 1 A).

[0032] 2) Ion Exchange Chromatography: Prepare the necessary buffers (Buffer A and Buffer B) for ion exchange chromatography in advance. Filter the solutions through a 0.22 μm filter membrane and sonicate to remove air bubbles. Buffer A: 0 mM NaCl; 20 mM Hepes (pH 8.0); 10 mM MgCl2; 2 mM TCEP; 5% Glycerol; Buffer B: 1000 mM NaCl; 20 mM Hepes (pH 8.0); 10 mM MgCl2; 2 mM TCEP; 5% Glycerol. Rinse pumps A1 and B1 with Buffer A and Buffer B respectively, then equilibrate the ion exchange column with Buffer A. Use Buffer A to dilute the salt concentration of the de-labeled protein solution to approximately 80 mM. Filter the diluted sample to precipitate and load it. Then wash with Buffer A for 3-5 column volumes. Finally, set up a salt concentration gradient elution and collect the protein sample. Finally, wash with Buffer B for 3-5 column volumes. All collected protein samples were analyzed by SDS-PAGE (see [link]). Figure 1 (B), after detection and confirmation, the target protein solutions were combined and concentrated using an ultrafiltration tube.

[0033] 3) Gel filtration chromatography: Prepare Buffer C (150 mM NaCl; 20 mM Hepes (pH 8.0); 5 mM MgCl2; 2 mM TCEP; 5% Glycerol) for gel filtration chromatography in advance, and filter and sonicate it. Then, equilibrate Superdex 200 with the prepared Buffer C. Centrifuge the concentrated protein from the previous step, load it onto the sample, and set up separate tubes for sample collection. Perform SDS-PAGE analysis on the protein samples in each collection tube (see [link to SDS-PAGE analysis]). Figure 1 After confirming the C), the target protein solution was combined and concentrated to 10 mg / mL for later use.

[0034] 2. Borer borer Cs Preparation of ABCF1 truncated protein (1) Due to the low expression level of the full-length protein and its difficulty in crystallization, based on the predicted structure of AlphaFold2, and ensuring the integrity of the functional domains, a method for designing the rice stem borer was developed. Cs ABCF1 truncated body Cs ABCF1 305-920aa (The amino acid sequence of the protein is shown in SEQ ID NO. 9, and the nucleotide sequence of the gene is shown in SEQ ID NO. 10.) Cs ABCF1 340-920aa(The amino acid sequence of the protein is shown in SEQ ID NO.11, and the nucleotide sequence of the gene is shown in SEQ ID NO.12.) Cs ABCF1 350-920aa (The amino acid sequence of the protein is shown in SEQ ID NO.13, and the nucleotide sequence of the gene is shown in SEQ ID NO.14) and Cs ABCF1 360-910aa (The amino acid sequence of the protein is shown in SEQ ID NO.15, and the nucleotide sequence of the gene is shown in SEQ ID NO.16). The target fragment was also amplified from the cDNA of the indoor sensitive strain of the rice stem borer larvae using PCR technology, with the primer sequences as follows: Cs ABCF1 305-920aa -F (SEQ ID NO. 17): 5'-TCTGCTGAGCCAGCTGAG-3'; Cs ABCF1 340-920aa -F (SEQ ID NO.18): 5'-CAGGCCATAGCGAGTTG-3'; Cs ABCF1 350-920aa -F (SEQ ID NO. 19): 5'-ACTGTCAGCCAGGCTCAG-3'; Cs ABCF1 360-910aa -F (SEQ ID NO.20): 5'-CAAATGGCTGCCCTCGAAAC-3'; Cs ABCF1 360-910aa -R (SEQ ID NO. 21): 5'-TGGCGAGTTGATCGTCTCG-3'; Cs ABCF1 305-920aa , Cs ABCF1 340-920aa and Cs ABCF1 350-920aa The reverse primer and Cs ABCF1-FL shared Cs ABCF1-R (SEQ ID NO.4).

[0035] Four truncated variants were amplified using Fly Mix with the following reaction programs: 98℃, 1 min; 98℃, 10 s; 58℃, 5 s; 72℃, 10 s; 72℃, 1 min; 12℃, 5 min.

[0036] (2) Construction of expression carrier Linearized pET28a-sumo vector was obtained by PCR. The linearized vector was amplified using Fly Mix, with homologous arms of the insert fragments (i.e., four truncated variants) added simultaneously. The amplification times were 98℃ for 1 min; 98℃ for 10 s; 58℃ for 5 s; 72℃ for 10 s; 72℃ for 1 min; and 12℃ for 5 min.

[0037] The primer sequences for the homologous arms of the inserted fragment are as follows, with the underlined parts representing the homologous arm sequences: Cs ABCF1 305-920aa -TF (SEQ ID NO.22): 5'- GTATTTTCAGGGAGGATCC TCTGCTGAGCCAGCTGAG-3'; Cs ABCF1 340-920aa -TF (SEQ ID NO.23): 5'- TTTTCAGGGAGGATCC CAGGGCCATAGCGAGTTG-3'; Cs ABCF1 350-920aa -TF (SEQ ID NO.24): 5'- TTTTCAGGGAGGATCC ACTGTCAGCCAGGCTCAG-3'; Cs ABCF1 360-910aa -TF (SEQ ID NO.25): 5'- TTTTCAGGGAGGATCC CAAATGGCTGCCCTCGAAAAC-3'; Cs ABCF1 360-910aa -TR (SEQ ID NO.26): 5' -GGTGGTGCTCGAG CTATGGCGAGTTGATCGTCTCG-3'; Cs ABCF1 305-920aa , Cs ABCF1 340-920aa and Cs ABCF1 350-920aa The reverse primer and Cs ABCF1-FL shared Cs ABCF1-TR (SEQ ID NO.8).

[0038] The insert fragment with homologous arms was ligated to the corresponding linearized vector via homologous recombination using Assembly Mix enzyme (Beijing TransGen Biotech Co., Ltd., CU101). The ligation product was then transferred into the vector via heat shock. TransIn 1-T1 competent cells, construct respectively Cs ABCF1 305-920aa -pET28a-sumo、 Cs ABCF1 340-920aa -pET28a-sumo、 Cs ABCF1 350-920aa -pET28a-sumo and Cs ABCF1 360-910aa The recombinant expression plasmid pET28a-sumo was used to identify positive clones by bacterial PCR.

[0039] (3) Extraction of recombinant expression plasmids Plasmid extraction similar to that of full-length proteins.

[0040] (4) Expression and purification of recombinant proteins Transformation: The recombinant plasmid was transformed into Escherichia coli BL21(DE3) competent cells (Beijing TransGen Biotech Co., Ltd., CD901) by heat shock and cultured on LB solid medium plates at 37°C for 12-16 h.

[0041] Expression, cell collection, lysis, and purification are the same as for full-length proteins. The difference lies in the purification process: 1) During affinity chromatography, the imidazole concentration in the washbuffer is adjusted... Cs ABCF1 305-920aa Except for the recombinant proteins which are 30mM and 50mM, the remaining truncated proteins are only 30mM; 2) The steps for adding TEV enzyme to digest the tag and removing the tag after affinity chromatography are as follows: After confirming the yield and purity of the target protein in the eluent by SDS-PAGE, the tag was digested with TEV enzyme at a ratio of 50:1 (V / V) in the protein solution. The protein solution was then placed in a dialysis bag with a 10 kDa cutoff and dialyzed overnight at 4°C in dialysis buffer (400 mM NaCl; 20 mM Hepes (pH 8.0); 10 mM MgCl2; 2 mM TCEP; 5% Glycerol). After dialysis, the tag was removed again using a nickel column (with the imidazole concentration in the wash buffer changed to 10 mM / 20 mM / 30 mM). Protein samples from each step were collected, and the tag removal results were analyzed by SDS-PAGE.

[0042] Cs ABCF1 305-920aa -pET28a-sumo、 Cs ABCF1 340-920aa -pET28a-sumo、 Cs ABCF1 350-920aa -pET28a-sumo and Cs ABCF1 360-910aa The affinity chromatography results of the -pET28a-sumo recombinant protein are shown in [the table below]. Figures 2-5 Figure A shows the results of TEV digestion. Figures 2-5 Figure B shows the results of ion exchange chromatography. Figures 2-5 Figure C shows the results of gel filtration chromatography. Figures 2-5 The D diagram.

[0043] 3. Crystal growth and structure analysis (1) Crystal growth This study used the hanging drop method for initial screening of protein crystals. The kit used was Hampton's CrystalScreen, Index, Salt, Wizard Classic, and PEG Rx, containing 576 crystallization conditions, which were aliquoted into 48-well crystal culture plates as pooling solutions. Two sets of each crystallization condition were prepared. Then, 1.1 μL of protein solution (ATP was added to the protein solution at a molar ratio of 1:3 and incubated on ice for 0.5 h) and an equal volume of pooling solution were added to the sample wells sequentially. After sealing, crystal growth was carried out under isothermal conditions of 4℃ and 20℃, respectively. Crystal growth was observed under a microscope every two days. Crystals only grew at 4℃. After approximately one week of growth of the recombinant protein, four truncated protein crystals showed the best state under the following conditions: Cs ABCF1 305-920aa : Index 49-96 No.34 (0.2 M Magnesium chloridehexahydrate, 0.1 M Bis-Tris (pH 5.5), 25% PEG 3350) ( Figure 6 A) and Index 49-96 No.35 (0.2 M Magnesium chloride hexahydrate, 0.1 M Bis-Tris (pH 6.5), 25% PEG 3350) ( Figure 6 B). Cs ABCF1 340-920aa : Index 1-48 No.20 (0.1 M Hepes (pH 7.5), 1.4 M Sodiumcitrate tribasic dihydrate) ( Figure 6 (C) and Index 1-48 No.21 (1.8 M Ammonium citratetribasic pH 7.0) Figure 6 D). Cs ABCF1 350-920aa:Wizard Classic 4 No.28 (20% PEG 3350, 100 mM Bis-Tris propane / Hydrochloricacid (pH 6.5), 200 mM Sodium fluoride) ( Figure 6 E) and Index 49-96 No.20 (0.2 M Ammonium sulfate, 0.1 M Hepes (pH 7.0), 25% PEG3350) Figure 6 (F). Cs ABCF1 360-910aa : Index 49-96 No.19 (0.2 M Ammonium sulfate, 0.1 MBis-Tris (pH 6.5), 25% PEG 3350) ( Figure 6 G) and Crystal screen I No.18 (0.2 M Magnesium acetate tetrahydrate, 0.1 M Sodium cacodylate trihydrate (pH 6.6), 20% PEG 8000) ( Figure 6 H).

[0044] The crystal growth of four truncated protein types is compared below: Cs ABCF1 305-920aa Crystallization: Initial screening results showed that protein crystals grew under three different pool conditions, accounting for 0.52% of all effective screening conditions. The initial screening crystals were small in size, with indistinct crystal faces and edges. Further optimization using the optimal initial screening condition (Index 49-96 No. 35) resulted in a slightly larger crystal size, but the crystals remained irregularly spindle-shaped. Figure 7 A, under the conditions of 0.2 M Magnesium chloride hexahydrate, 0.1 M Bis-Tris (pH 6.5), and 20% PEG 3350, showed cracks on the crystal surface and a diffraction resolution of 6-8 Å. Figure 7 (B), the diffraction data are insufficient to support the reliable construction and structural resolution of a fine three-dimensional structural model of the protein.

[0045] Cs ABCF1 340-920aaCrystallization status: Initial crystal screening results showed that protein crystals grew under 5 different pool conditions, accounting for 0.87% of all effective screening conditions. The initial screening crystals were small, nearly rhomboid or rod-shaped crystals, which were still difficult to pick out as single crystals and perform conventional X-ray diffraction tests even after multiple rounds of optimization.

[0046] Cs ABCF1 350-920aa Crystallization: Preliminary screening results showed that protein crystals grew under 30 different pool conditions, accounting for 5.21% of all effective screening conditions. The preliminary screening crystals exhibited characteristics of regular shape, high transparency, and suitable size. Figure 6 The initial screening yielded rod-shaped, plate-shaped, needle-shaped, and clustered crystals. Rod-shaped and plate-shaped crystals from the initial screening, selected under Wizard Classic 4 No. 28 conditions, were subjected to X-ray diffraction, with diffraction resolution at 5-8 Å (E and F). Figure 8 ).

[0047] The crystallization conditions were further optimized, specifically the protein concentration (8, 9, 10, and 11 mg / mL), pH value, and precipitant concentration in the crystal growth conditions. Cs ABCF1 350-920aa The initial crystallization conditions for protein screening were as follows: maintaining a constant sodium fluoride concentration, a pH range of 6.0-7.0 (in increments of 0.1%), and a PEG 3350 concentration range of 15%-27% (in increments of 1%). Subsequent crystallization procedures were the same as for the initial screening. After one week of growth, the crystals grown at PEG 3350 concentrations of 17%, 18%, and 19% were of the optimal size for diffraction (…). Figure 9 (A, B, C). The optimal crystallization conditions finally selected were: protein concentration 10 mg / mL, pool solution composition: 18% PEG 3350, 100 mM Bis-Trispropane / Hydrochloricacid (pH 6.5), 200 mM Sodium fluoride. The X-ray diffraction quality was significantly improved, with a diffraction resolution of 3.5 Å. Figure 10 They successfully completed the analysis and refinement of the protein's crystal structure.

[0048] Cs ABCF1 360-910aa Crystallization: Initial screening results showed that protein crystals grew under 30 different pool conditions, accounting for 5.21% of all effective screening conditions. The initial screening crystals were rod-shaped, needle-like bundles, and clusters, making single-crystal picking and conventional X-ray diffraction testing difficult. The pool condition with regular crystal shapes (Crystal screen I No. 18) was selected for further optimization, resulting in rhomboid crystals. Figure 11For A, under the conditions of 0.2 M Magnesium acetate tetrahydrate, 0.1 M Sodium cacodylate trihydrate (pH 6.6), and 18% PEG 8000, the diffraction resolution was concentrated in the 6-8 Å range. Figure 11 (B), the diffraction data are insufficient to support the reliable construction and structural resolution of a fine three-dimensional structural model of the protein.

[0049] The results show that although all four truncated proteins retained the complete Uup domain (amino acids 372-897), only... Cs ABCF1 350-920aa It can be used to prepare crystals that meet the requirements of academic research. Therefore, based on the above results, it is selected... Cs ABCF1 350-920aa The protein crystal structure was determined by crystals generated under the following conditions: protein concentration of 10 mg / mL, pool solution composition: 18% PEG 3350, 100 mM Bis-Trispropane / Hydrochloricacid (pH 6.5), and 200 mM Sodium fluoride.

[0050] (2) Protein crystal structure analysis Crystal data collection: After obtaining the crystals, single crystal particles were retrieved under a microscope using a appropriately sized loop ring. After treatment with a cryoprotectant, they were rapidly frozen into liquid nitrogen. The cryoprotectant typically consisted of crystallization pool solution with glycerol added to a final concentration of 20% (v / v). Data collection was conducted at the High Energy Synchrotron Radiation Facility in Huairou District, Beijing, with a diffraction wavelength of 1.00392 Å. One diffraction pattern was collected for every degree of crystal rotation, for a total of 360 diffraction patterns.

[0051] Diffraction data processing: After collecting the data, the data is indexed, intensity integrated and normalized to obtain the intensity and coordinate information of the diffraction points, and the space group of the crystal is determined.

[0052] Crystal structure analysis and model correction: This study employed molecular substitution to resolve the phase. Crystal diffraction data were integrated using an HKL-2000. Then, using the 3D structure of the human ABCF1 protein as a template, molecular substitution was performed using the Phaser function in Phenix software. Structure correction was then performed using Phenix.refine, followed by manual correction using Coot software based on electron clouds. After manual correction in Coot software, the structure was further refined using Phenix.refine, and R-values ​​were monitored during the correction process. work and R free The process of decreasing the value is iterated until the structural correction is completed.

[0053] The first insect ABCF1 protein structure obtained was determined. The crystal has a C2221 spatial arrangement, with two molecules per asymmetric unit cell. The unit cell parameters are a = 105.010 Å, b = 190.010 Å, c = 140.730 Å, α = β = γ = 90° (see Table 1). (The three-dimensional structure is shown in...) Figure 12 (Left image). The crystal has two nucleotide-binding domains, NBD1 and NBD2. NBD2 binds to one ATP. The amino acid residues involved in the interaction include Asn728, Gly729, Val730, Gly731, Ser733, and Thr734. Figure 12 (See the right figure). The details of this crystal structure can be used to understand the mechanism by which the insect ABCF1 protein participates in the regulation of protein translation.

[0054] Table 1. Statistics of Crystallographic Data Collection and Structure Correction Data

[0055] 3. Cs ABCF1 enzyme activity assay Malachite green phosphate assay kit (Shanghai Beyotime Biotechnology Co., Ltd., S0196M) was used to detect truncated somatic protein. Cs ABCF1 350-920aa The ATPase activity was measured using the method described in the article "A cardioviral 2C-ATP complex structure reveals the essential role of a conserved arginine in regulation of cardioviral 2C activity" published by He Qingyi et al. in the Journal of Virology in 2024. This study optimized this method.

[0056] The specific experimental steps are as follows: Each reaction has a total volume of 200 µL, including: 50 µL of freshly purified protein, 100 µL of reaction solution (40 mM Hepes (pH=8.0), 100 mM NaCl, 5 mM MgCl2, 1 mM TCEP), and 50 µL of ATP solution (given that ATP undergoes non-enzymatic hydrolysis at room temperature, the working concentration was confirmed to be 1 mM through preliminary experiments). In all reactions, enzyme concentration gradients were set (based on enzyme activity). Cs ABCF1 350-920aaConcentration gradient: 1-15 μM, with each 1 μM increment representing a concentration gradient. Simultaneously, a reaction solution control group, a protein control group, and an ATP control group (ATP non-enzymatic hydrolysis group) were set up, each containing three replicates.

[0057] The above 200 µL reaction system was incubated at room temperature for 30 min. After the reaction, 70 µL of malachite green phosphorus detection reagent was added to each 200 µL sample. After mixing, the mixture was incubated at room temperature for another 30 min. The absorbance was read at 630 nm using a microplate reader. Each value represents the absorbance measured in three independent replicates, with background values ​​from the ATP control group removed. Data were processed using GraphPad Prism 11.

[0058] The results of the ATPase activity assay showed that the truncated protein Cs ABCF1 350-920aa It has the ability to bind and hydrolyze ATP. Figure 13 The experimental results indicate that the truncated body Cs ABCF1 350-920aa Rice stem borer was preserved Cs The ATP-binding and hydrolytic abilities of the ABCF1 protein can be used in rice stem borers. Cs Research on the ABCF1 protein.

Claims

1. The application of a truncated ABCF1 protein from the rice stem borer in the preparation of crystal structures of insect ABCF subfamily proteins, characterized in that, The amino acid sequence of the truncated protein is shown in SEQ ID NO.

13.

2. The application of the truncated ABCF1 protein of the rice stem borer according to claim 1 in the preparation of crystal structures of insect ABCF subfamily proteins, characterized in that, The nucleotide sequence of the gene encoding the protein is shown in SEQ ID NO.

14.

3. The application of the truncated ABCF1 protein of the rice stem borer according to claim 1 in the preparation of crystal structures of insect ABCF subfamily proteins, characterized in that, The truncated ABCF1 protein of the rice stem borer was obtained by the following method: the gene encoding the truncated ABCF1 protein of the rice stem borer was constructed in a prokaryotic expression vector to obtain a recombinant expression vector, and then the recombinant expression vector was transferred into a host cell to express the truncated ABCF1 protein of the rice stem borer; the gene sequence encoding the truncated ABCF1 protein of the rice stem borer is shown in SEQ ID NO.

14.

4. The application of the truncated ABCF1 protein of the rice stem borer according to claim 3 in the preparation of crystal structures of insect ABCF subfamily proteins, characterized in that, The prokaryotic expression was performed using the pET28a-sumo vector.

5. The application of the truncated ABCF1 protein of the rice stem borer according to claim 4 in the preparation of crystal structures of insect ABCF subfamily proteins, characterized in that, The recombinant expression vector is constructed as follows: the pET28a-sumo vector is linearized, the gene sequence encoding the truncated protein of rice stem borer ABCF1 with homologous arms is ligated, and then the ligation product is transformed into... Trans 1-T1 competent cells.

6. The application of the truncated ABCF1 protein of the rice stem borer according to claim 5 in the preparation of crystal structures of insect ABCF subfamily proteins, characterized in that, The nucleotide sequences of the primers used for linearizing the pET28a-sumo vector are shown in SEQ ID NO. 5 and SEQ ID NO.

6.

7. The application of the truncated ABCF1 protein of the rice stem borer according to claim 5 in the preparation of crystal structures of insect ABCF subfamily proteins, characterized in that, The nucleotide sequences of the primers used to insert homologous arms into the gene sequence encoding the truncated protein of rice stem borer ABCF1 are shown in SEQ ID NO.24 and SEQ ID NO.

8.

8. The application of the truncated ABCF1 protein of the rice stem borer according to claim 3 in the preparation of crystal structures of insect ABCF subfamily proteins, characterized in that, The host cell is Escherichia coli BL21(DE3) competent cells.

9. A method for preparing the crystal structure of an insect ABCF subfamily protein, characterized in that, Includes the following steps: (1) The purified rice stem borer ABCF1 truncated protein was concentrated to 10 mg / mL in 20 mM Hepes, 150 mM NaCl, 5 mM MgCl2, 2 mM MTCEP and 5% Glycerol at pH 8.0; the amino acid sequence of the truncated protein is shown in SEQ ID NO.13; (2) ATP was added at a molar ratio of 1:3, and the mixture was incubated on ice for 0.5 h. The rice stem borer ABCF1 truncated protein solution was then placed in a droplet of the pooling solution for incubation; the pooling solution consisted of 15%-27% PEG 3350, 100 mM Mbis-Tris propane / Hydrochloricacid at pH 6.0-7.0, and 200 mM Sodium fluoride. The concentration of the rice stem borer ABCF1 truncated protein solution was 8-11 mg / mL, and the incubation temperature was 4℃.

10. The method for preparing the crystal structure of an insect ABCF subfamily protein according to claim 9, characterized in that, The composition of the pool solution was: 17-19% PEG 3350, 100 mM Bis-Tris propane / Hydrochloricacid at pH 6.5, 200 mM Sodium fluoride, and a truncated protein solution of rice stem borer ABCF1 with a concentration of 10 mg / mL. The incubation temperature was 4℃.

Images