Use and method of masbp gene in improving production and virulence of metarhizium anisopliae dmds

Abstract

The application belongs to the technical field of microbial genetic engineering and green agricultural biological control, and specifically discloses application and method of MaSBP gene in improving production and virulence of Metarhizium anisopliae DMDS. The production and virulence of Metarhizium anisopliae can be improved after overexpression of MaSBP gene. The application also successfully constructs a Metarhizium anisopliae MaSBP gene expression cassette without foreign genes, which includes a fusion fragment composed of four DNA sequences of PgpdM, MaSUR, Ptef1M and MaSBP. The engineering bacteria obtained by introducing the expression cassette into the recipient Metarhizium anisopliae not only improve the production of dimethyl disulfide and nematocidal activity, but also expand the biocontrol range of Metarhizium anisopliae, and eliminate the biological safety hazard due to the absence of foreign genes. The application has extremely broad application value and extremely far-reaching green biocontrol guiding significance in the field of agricultural production, and provides core technical support for green prevention and control of plant parasitic nematodes.

Description

Technical Field

[0001] This invention belongs to the field of microbial genetic engineering and green agricultural biological control technology, specifically involving the application of the MaSBP gene in improving the yield and virulence of Metarhizium anisopliae DMDS, and a method for constructing an environmentally friendly nematicide overexpressing MaSBP gene-engineered bacterium without exogenous cross-species DNA insertion. Background Technology

[0002] Plant parasitic nematodes are among the most damaging soil-borne pathogens in global agriculture. Their host range covers the vast majority of cultivated plants, including grains, vegetables, fruit trees, and cash crops. They infect crop roots, disrupt nutrient and water transport, leading to weakened plant growth, reduced yields, and even crop failure. According to literature, plant parasitic nematodes cause direct economic losses of up to US$157 billion annually to global agriculture, becoming a key issue restricting stable agricultural production and income growth, and threatening global food security.

[0003] Currently, nematicides remain the primary means of nematode control, and can be broadly classified into contact nematodes and fumigants based on their mode of action. Contact nematodes require direct contact with nematodes to be effective, making it difficult to reach deep soil layers. They are also generally highly toxic or extremely toxic, posing poor safety to humans, animals, and non-target organisms. Long-term use leads to increasing nematode resistance, and they easily leave residues in soil and agricultural products, posing risks to food safety and environmental pollution. Fumigants, on the other hand, have volatile diffusion characteristics, allowing them to penetrate soil pores and distribute evenly around the root system. Their effective range is wider, making them particularly suitable for controlling deep-seated nematodes. However, fumigants rely on a one-time, large-scale "chemical bombardment" approach, which is not only costly but also prone to environmental residues and damage to the soil microecology, failing to meet green environmental protection requirements. Overall, existing chemical nematicides suffer from multiple drawbacks, including high toxicity, resistance, residual pollution, and ecological damage.

[0004] Dimethyl disulfide (DMDS), chemical formula CH3-SS-CH3, is a fumigant recommended by the United Nations as an alternative to methyl bromide. It exhibits excellent control effects against various plant parasitic nematodes, including root-knot nematodes and cyst nematodes. Literature reports that DMDS fumigation for 48 hours can kill the southern root-knot nematode (Meloidogyne incognita) J2 at a dosage as low as 0.086 mg / L, demonstrating extremely high fumigation activity with a very low required dosage. It has been reported that some biocontrol microorganisms can produce DMDS through endogenous metabolic pathways, thus combining the safety of biological control with the broad-spectrum effectiveness of fumigants. If the DMDS production of these microorganisms can be increased through genetic modification, enabling them to continuously and in low quantities produce DMDS, then the broad-spectrum effectiveness of fumigants and the environmental sustainability of biological control can be achieved, avoiding the drawbacks of large-scale, one-time application of chemical fumigants. However, wild-type nematicidal microorganisms generally have low DMDS yields, making it difficult to meet the needs of large-scale agricultural pest control. Improving DMDS yield by genetically modifying the expression of key genes regulating DMDS yield in microorganisms, especially biocontrol bacteria, could significantly enhance the scope and effectiveness of biocontrol, including increasing nematicidal activity. However, the key genes regulating DMDS yield in microorganisms have not yet been identified.

[0005] Current microbial genetic modification technologies typically rely on exogenous plasmid vectors, requiring the introduction of exogenous selection markers such as antibiotic or herbicide resistance. Furthermore, the vector backbone sequence easily integrates into the host genome along with the target gene. These exogenous DNA fragments cannot be eliminated in subsequent screening, leading to biosafety risks of exogenous gene diffusion in engineered bacteria, making it difficult to pass field safety assessments. In addition, traditional homologous recombination-based site-directed integration is cumbersome and inefficient. It is noteworthy that internationally, genetically modified organisms using only endogenous gene elements from the recipient organism without exogenous cross-species DNA insertion generally adopt regulatory policies different from those for traditional transgenic organisms. EU Directive 2009 / 41 / EC explicitly includes "self-cloning" in the list of genetically modified microorganisms exempt from regulatory oversight, defining it as: removing and re-inserting nucleic acid sequences from the same or related species, resulting in microorganisms that "are unlikely to cause disease in humans, animals, or plants." Article 3 of my country's "Regulations on the Safety Management of Agricultural Genetically Modified Organisms" (2017 revised edition, State Council Decree No. 687) defines "agricultural genetically modified organisms" as organisms whose genome composition has been altered using genetic engineering technology, with "genetically modified" referring to the "introduction of foreign genes." The "Guidelines for Safety Evaluation of Gene-Edited Plants for Agricultural Use (Trial)" issued by the Ministry of Agriculture and Rural Affairs in 2022 and the "Review Rules" in 2023 clearly state that as long as the final product does not contain foreign genes, it can be exempted from the strict safety evaluation required for traditional genetically modified products.

[0006] In summary, identifying key genes for DMDS production in microorganisms and establishing a simple modification method that avoids exogenous cross-species DNA insertion, utilizes endogenous gene elements throughout the process, and expands the biocontrol range of biocontrol bacteria, enhances nematicidal activity, and eliminates biosafety hazards has extremely broad application value and profound guiding significance in the field of agricultural production. At the same time, it provides core technical support for the green control of plant parasitic nematodes. Summary of the Invention

[0007] In view of this, one of the objectives of the present invention is to provide the application of the MaSBP gene in increasing the dimethyl disulfide yield of Metarhizium anisopliae, wherein the nucleotide sequence of the MaSBP gene is as shown in SEQ ID NO.4, or the encoded amino acid sequence is as shown in SEQ ID NO.5.

[0008] The second objective of this invention is to provide the application of the MaSBP gene in enhancing the virulence of Metarhizium anisopliae, wherein the nucleotide sequence of the MaSBP gene is as shown in SEQ ID NO.4, or the encoded amino acid sequence is as shown in SEQ ID NO.5.

[0009] A third objective of this invention is to provide a method for cultivating engineered Metarhizium anisopliae strains with increased dimethyl disulfide production or enhanced virulence, comprising the step of increasing the expression level and / or activity of the MaSBP gene mRNA or protein in the recipient Metarhizium anisopliae strain to obtain transgenic Metarhizium anisopliae strains; wherein the nucleotide sequence of the MaSBP gene is as shown in SEQ ID NO.4, or the encoded amino acid sequence is as shown in SEQ ID NO.5.

[0010] Preferably, the method for increasing the expression level and / or activity of the MaSBP gene mRNA or protein in the recipient *Metarhizium anisopliae* is achieved by introducing a MaSBP gene expression cassette into the recipient *Metarhizium anisopliae*. The MaSBP gene expression cassette contains no exogenous gene and is a fusion fragment consisting of four DNA sequences: PgpdM, MaSUR, Ptef1M, and MaSBP. The nucleotide sequence of PgpdM is as shown in SEQ ID NO.1, the nucleotide sequence of MaSUR is as shown in SEQ ID NO.2, the nucleotide sequence of Ptef1M is as shown in SEQ ID NO.3, and the nucleotide sequence of MaSBP is as shown in SEQ ID NO.4. PgpdM originates from the upstream region of the ATG start codon of the glyceraldehyde-3-phosphate dehydrogenase gene (gpd) and is an endogenous strong promoter; MaSUR is the endogenous acetolactate synthase gene (SUR), which can confer resistance to chlorimuron; Ptef1M originates from the upstream region of the ATG start codon of the translation elongation factor 1α gene (tef1) and is also an endogenous strong promoter; MaSBP is the endogenous selenium-binding protein gene, which can increase the production and virulence of dimethyl disulfide in strains; PgpdM initiates the expression of MaSUR, and Ptef1M initiates the expression of MaSBP.

[0011] The fourth objective of this invention is to provide an engineered strain of Metarhizium anisopliae with increased dimethyl disulfide production or virulence, wherein the expression level and / or activity of the MaSBP gene mRNA or protein in the engineered strain are increased.

[0012] Preferably, the expression level and / or activity of the MaSBP gene mRNA or protein in the engineered bacteria are increased by introducing a MaSBP gene expression cassette into the engineered bacteria. The MaSBP gene expression cassette contains no exogenous gene and is a fusion fragment consisting of four DNA sequences: PgpdM, MaSUR, Ptef1M, and MaSBP. The nucleotide sequence of PgpdM is as shown in SEQ ID NO.1, the nucleotide sequence of MaSUR is as shown in SEQ ID NO.2, the nucleotide sequence of Ptef1M is as shown in SEQ ID NO.3, and the nucleotide sequence of MaSBP is as shown in SEQ ID NO.4.

[0013] The fifth objective of this invention is to provide a nematicide fungicide, the active ingredient of which is the aforementioned engineered strain of Metarhizium anisopliae.

[0014] The sixth objective of this invention is to provide a foreign gene-free Metarhizium anisopliae MaSBP gene expression cassette, wherein the expression cassette comprises a fusion fragment consisting of four DNA sequences: PgpdM, MaSUR, Ptef1M, and MaSBP. The nucleotide sequence of PgpdM is shown in SEQ ID NO.1, the nucleotide sequence of MaSUR is shown in SEQ ID NO.2, the nucleotide sequence of Ptef1M is shown in SEQ ID NO.3, and the nucleotide sequence of MaSBP is shown in SEQ ID NO.4.

[0015] Overexpression of the MaSBP gene in this invention can increase the dimethyl disulfide yield and toxicity of *Metarhizium anisopliae*. This invention also successfully constructed a *Metarhizium anisopliae* MaSBP gene expression cassette without exogenous genes, comprising a fusion fragment consisting of four DNA sequences: PgpdM, MaSUR, Ptef1M, and MaSBP. Introducing this expression cassette into engineered bacteria obtained from the recipient *Metarhizium anisopliae* not only increased dimethyl disulfide yield and nematicidal activity, expanding the biocontrol range of *Metarhizium anisopliae*, but also eliminated biosafety risks due to the absence of exogenous genes. This invention has extremely broad application value and profound guiding significance for green biocontrol in agricultural production, providing core technical support for the green control of plant parasitic nematodes. Attached Figure Description

[0016] Figure 1 This is a structural diagram of the Metarhizium anisopliae tandem expression cassette (MaSBP gene expression cassette) constructed by fusion PCR according to the present invention;

[0017] Figure 2 This is a screening diagram of the Metarhizium anisopliae strain with high MaSBP expression in this invention;

[0018] Figure 3 The chromatogram for detecting DMDS produced by CQMa421 of the present invention after fermentation in Martin medium is compared with DMDS standard.

[0019] Figure 4 The content of DMDS produced by Metarhizium anisopliae and its engineered strains in this invention;

[0020] Figure 5 The invention relates to the neutrophilic half-lethal time of Metarhizium anisopliae and its engineered strains in killing nematodes. Detailed Implementation

[0021] The present invention will be described in detail below with reference to embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of application of the present invention. The present invention is not limited to the following embodiments or examples. Any modifications and variations made without departing from the spirit of the present invention should be included within the scope of the present invention. Unless otherwise specified, the experimental materials or reagents used in the following embodiments are all conventional commercially available products.

[0022] Example 1: Construction of an engineered strain of *Metarhizium anisopliae* overexpressing the MaSBP gene

[0023] 1. Amplification of intrinsic components

[0024] Using genomic DNA from the wild-type strain of *Metarhizium anisopliae* CQMa421 (provided by the Gene Engineering Research Center of Chongqing University) as a template, specific PCR primers were designed. Four endogenous DNA fragments were amplified:

[0025] The PgpdM fragment is an endogenous strong promoter 1, derived from the upstream region of the ATG start codon of the glyceraldehyde-3-phosphate dehydrogenase gene (gpd). Its nucleotide sequence is shown in SEQ ID NO.1. The amplification primers are:

[0026] PgpdM-F:

[0027] GCACACTGGTGGAGACGATTTCATGGATGGCAAGACT

[0028] PgpdM-R:

[0029] GAGCTGGAGCTTGGACGTCAGCACGGGAGTCT

[0030] MaSUR fragment: This is the endogenous acetolactate synthase gene (SUR), conferring resistance to chlorimuron-methyl. Its nucleotide sequence is shown in SEQ ID NO.2. The amplification primers are:

[0031] MaSUR-F:

[0032] ATGCCTGTACAAGAGTTGCAACCACATGGCGATCCTAG

[0033] MaSUR-R:

[0034] TCATGATTCCGCCTCGAGATCGGCATCCTTTTCGAGC

[0035] The Ptef1M fragment is an endogenous strong promoter 2, derived from the upstream region of the ATG start codon of the translation elongation factor 1α gene (tef1). Its nucleotide sequence is shown in SEQ ID NO.3. The amplification primers are:

[0036] Ptef1M-F:

[0037] GGCAACTTGAGATGCAGGTGTTTGGTGTCCCAGAC

[0038] Ptef1M-R:

[0039] TGAGATTTGCAGTGTGTCCTAACGGAAAGTGTCTTGTC

[0040] MaSBP fragment: This is the gene for an endogenous selenium-binding protein, with the nucleotide sequence shown in SEQ ID NO.4. The amplification primers are:

[0041] MaSBP-F:

[0042] ATGAGACGCAGCTTCCACTCTCTCCTGCTGCTC

[0043] MaSBP-R:

[0044] TTAGTAGTATTTCGGGTTCGTCGGGTCGGTCAGATC

[0045] 2. Constructing a tandem expression cassette (MaSBP gene expression cassette) using fusion PCR.

[0046] Using fusion PCR technology, the four fragments were fused and ligated in the order of "PgpdM-MaSUR-Ptef1M-MaSBP". Figure 1 The first round of fusion involved mixing the PgpdM and MaSUR fragments with the PgpdM-MaSUR homologous arm fragment for overlap extension PCR. The second round of fusion involved mixing the Ptef1M and MaSBP fragments with the Ptef1M-MaSBP homologous arm fragment for overlap extension PCR. The third round of fusion involved mixing the fusion products from the first two rounds with the MaSUR-Ptef1M homologous arm fragment for overlap extension PCR to obtain a linear tandem expression cassette (MaSBP gene expression cassette). This expression cassette consists solely of the Metarhizium anisopliae's own DNA sequence and contains no exogenous vector backbone or cross-species DNA sequence.

[0047] The DNA fragment sequence of the homologous recombination adapter is as follows:

[0048] PgpdM-MaSUR homologous arm sequence:

[0049] AGCTTCCCAGACTCCCGTGCTGACGTCCAAGCTCCAGCTCATGCCTGTACAAGAGTTGCAACCACATGGCGATCCTAGCT

[0050] Ptef1M-MaSBP homologous arm sequence:

[0051] TTGACAAGACACTTTCCGTTAGGACACACTGCAAATCTCAATGAGACGCAGCTTCCACTCTCTCCTGCTGCTCGCAGGAG

[0052] MaSUR-Ptef1M homologous arm sequence:

[0053] GCTGCTCGAAAAGGATGCCGATCTCGAGGCGGAATCATGAGGCAACTTGAGATGCAGGTGTTTGGTGTCCCAGACAACCA

[0054] 3. Competent state preparation and electroconversion

[0055] Conidia of *Metarhizium anisopliae* CQMa421 were collected and inoculated into liquid SDY medium. The medium was incubated at 28 °C with shaking for 2 days until the spore germination rate exceeded 80%. Germinating hyphae were collected, and the cell walls were digested with lysozyme. Competent cells were prepared by washing with STC solution (1 M sorbitol, 50 mM Tris-HCl pH 8.0, 50 mM CaCl2) and adjusting the concentration to approximately 1 × 10⁻⁶. 8 Cells / mL. Take 200 μL of competent cells, add 1 μg of the above tandem expression cassette DNA fragment, mix well, incubate on ice for 15 min, transfer to an electroporation cuvette, and set the parameters as follows: voltage 2 kV, resistance 600 Ω, capacitance 50 μF for electroporation. Immediately after electroporation, add 0.2 mL of pre-cooled SDY medium and incubate at 28 ℃ and 100 rpm for 3-4 h.

[0056] 4. Transformant screening

[0057] The revived transformation mixture bacterial suspension was spread on a selective medium plate containing chlorimuron (100 μg / mL) and incubated at 28 ℃ for 5-7 days. Well-grown colonies were picked and subcultured on plates containing the same selection agent to obtain positive transformants.

[0058] 5. Screening of overexpression strains

[0059] Total RNA was extracted from candidate transformants and wild-type strains (WT) and reverse transcribed into cDNA. MaSBP gene-specific qPCR primers were designed, and real-time quantitative PCR was performed using the housekeeping gene Magpd as an internal control. The relative expression level of the MaSBP gene was calculated. Overexpression transformants (OEs) with significantly higher relative MaSBP expression levels than wild-type (p < 0.05) were screened. Figure 2 The following are qPCR primers:

[0060] q-MaSBP-F: TCTGGTTGGAGGCGGATTGC

[0061] q-MaSBP-R:GCTCGGATCTCGTCAGTGATGG

[0062] q-Magpd-F: AAGAAGGTCGTCATTCTCTG

[0063] q-Magpd-R:GGTGAACTTGTCGTGGAT

[0064] Example 2: Nematicidal activity of MaSBP-overexpressed Metarhizium anisopliae

[0065] 1. DMDS production measurement

[0066] Spore suspensions of WT and OE strains were inoculated into 100 mL of Martin liquid medium, with a final spore concentration of 1 × 10⁻⁶. 6 1 spore / mL, cultured at 28 ℃ with shaking for 7 days, with three biological replicates per treatment. 5 mL of fermentation broth was used to determine the dimethyl disulfide (DMDS) content using headspace solid-phase microextraction-gas chromatography-mass spectrometry (HS-SPME-GC-MS). A series of standard solutions were prepared using DMDS standards to establish a peak area-concentration standard curve. The DMDS detection chromatogram is shown below. Figure 3 As shown, the DMDS content in the sample was calculated based on the standard curve. The results show ( Figure 4 The DMDS yield of the WT strain was 1.42 mg / L. The DMDS yields of the three overexpression engineered strains OE-2, OE-5, and OE-8 were 1.94 mg / L, 2.86 mg / L, and 2.38 mg / L, respectively, representing increases of approximately 1.4-fold, 2.0-fold, and 1.7-fold compared to the wild type. Statistical analysis showed that the differences between each OE strain and the WT strain were statistically significant (p < 0.05).

[0067] 2. Nematicidal activity assay

[0068] The tested nematode was *Meloidogyne incognita* J2, isolated from infected tomato roots. The nematicidal activity of the fermentation broth for each strain was determined using a 20 mm glass-bottomed petri dish fumigation method: 200 μL of the test fermentation broth was evenly added to the inner wall of the petri dish, and 40 μL of nematode suspension (containing approximately 100 nematodes) was dropped into the center of the dish, which was then quickly covered. Each treatment was performed in triplicate, with sterile Martin liquid medium as a negative control (preliminary experiments showed no nematicidal activity, eliminating negative interference). The petri dishes were placed in a 20 ℃ incubator, and removed at 15, 30, 45, 60, 75, and 90 min. Dead nematodes were counted under a microscope (rigidity was considered death), and the corrected mortality rate at each time point was calculated. The median lethal time (LT) was calculated using probability regression analysis. 50 The result showed (i.e., the time required for 50% of the nematodes to die). Figure 5 ), wild-type strain WT LT 50 The time was 37.55 min. The LT of the overexpressing strain OE-2 was... 50 The LT (Longest Length) of each OE strain was 32.33 min; OE-5 was 14.56 min; and OE-8 was 21.41 min. 50 All values ​​were significantly lower than those of the wild type (p < 0.05). This indicates that overexpression of the MaSBP gene increases DMDS production, which can significantly shorten the fumigation time for nematode control and enhance the nematode-killing effect.

[0069] The conventional techniques and solutions not described in detail in the above embodiments are all well known in the art, and therefore will not be elaborated upon here. The above embodiments and / or experimental examples describe the preferred embodiments of the present invention in detail. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solutions of the present invention, and these simple modifications all fall within the protection scope of the present invention.

Claims

1. Application of the MaSBP gene in increasing the dimethyl disulfide yield of Metarhizium anisopliae, wherein the nucleotide sequence of the MaSBP gene is as shown in SEQ ID NO.4, or the encoded amino acid sequence is as shown in SEQ ID NO.

5.

2. Application of the MaSBP gene in enhancing the virulence of Metarhizium anisopliae, wherein the nucleotide sequence of the MaSBP gene is as shown in SEQ ID NO.4, or the encoded amino acid sequence is as shown in SEQ ID NO.

5.

3. A method for cultivating engineered strains of *Metarhizium anisopliae* with increased dimethyl disulfide production or enhanced virulence, characterized in that, The method includes the step of increasing the expression level and / or activity of the MaSBP gene mRNA or protein in the recipient Metarhizium anisopliae to obtain transgenic Metarhizium anisopliae; wherein the nucleotide sequence of the MaSBP gene is as shown in SEQ ID NO.4, or the encoded amino acid sequence is as shown in SEQ ID NO.

5.

4. The method as described in claim 3, characterized in that, The method for increasing the expression level and / or activity of the MaSBP gene mRNA or protein in the recipient beetle *Metarhizium anisopliae* is achieved by introducing a MaSBP gene expression cassette into the recipient beetle *Metarhizium anisopliae*. The MaSBP gene expression cassette contains no exogenous gene and is a fusion fragment consisting of four DNA sequences: PgpdM, MaSUR, Ptef1M, and MaSBP. The nucleotide sequence of PgpdM is shown in SEQ ID NO.1, the nucleotide sequence of MaSUR is shown in SEQ ID NO.2, the nucleotide sequence of Ptef1M is shown in SEQ ID NO.3, and the nucleotide sequence of MaSBP is shown in SEQ ID NO.

4.

5. An engineered strain of *Metarhizium anisopliae* with increased dimethyl disulfide production or virulence, characterized in that... The expression level and / or activity of the MaSBP gene mRNA or protein in the engineered bacteria are increased.

6. The engineered strain of *Metarhizium anisopliae* as described in claim 5, characterized in that, The increased expression level and / or activity of the MaSBP gene mRNA or protein in the engineered bacteria is achieved by introducing a MaSBP gene expression cassette into the engineered bacteria. The MaSBP gene expression cassette contains no exogenous gene and is a fusion fragment consisting of four DNA sequences: PgpdM, MaSUR, Ptef1M, and MaSBP. The nucleotide sequence of PgpdM is shown in SEQ ID NO.1, the nucleotide sequence of MaSUR is shown in SEQ ID NO.2, the nucleotide sequence of Ptef1M is shown in SEQ ID NO.3, and the nucleotide sequence of MaSBP is shown in SEQ ID NO.

4.

7. A nematicide fungicide, characterized in that, The active ingredient is the engineered strain of Metarhizium anisopliae as described in any one of claims 3-6.

8. A foreign gene-free Metarhizium anisopliae MaSBP gene expression cassette, characterized in that, The expression cassette includes a fusion fragment composed of four DNA sequences: PgpdM, MaSUR, Ptef1M, and MaSBP. The nucleotide sequence of PgpdM is shown in SEQ ID NO.1, the nucleotide sequence of MaSUR is shown in SEQ ID NO.2, the nucleotide sequence of Ptef1M is shown in SEQ ID NO.3, and the nucleotide sequence of MaSBP is shown in SEQ ID NO.4.

Images