Highly active salt-tolerant protein glutaminase and preparation method thereof

Abstract

The application relates to the technical field of enzyme engineering, and discloses a high-activity salt-tolerant protein glutamine enzyme and a preparation method thereof. In the sequence of a wild-type protein glutamine enzyme, the 25th glycine is mutated into aspartic acid, the 32nd lysine is mutated into glutamic acid, the 66th leucine is mutated into serine, the 81st glutamine is mutated into isoleucine, the 128th glutamic acid is mutated into arginine, the 207th serine is mutated into aspartic acid, the 67th threonine is mutated into aspartic acid, and / or the 98th isoleucine is mutated into glutamic acid. The high-activity salt-tolerant protein glutamine enzyme mutant provided by the application has a qualitative leap in catalytic activity, salt tolerance and application effect compared with the wild-type enzyme, provides an efficient enzyme preparation solution for the fields of plant protein modification and high-salt fermented condiment quality improvement, and has a wide industrial application prospect and significant economic value.

Description

Technical Field

[0001] This invention relates to the field of enzyme engineering technology, specifically to a highly active salt-tolerant protein glutaminase and its preparation method. Background Technology

[0002] Protein glutaminase is an amidase that specifically catalyzes the hydrolysis of the amide bonds in the side chains of glutamine residues in proteins or polypeptide chains. It converts glutamine to glutamate and releases ammonia without causing hydrolysis of the protein backbone. After enzymatic action, the negative charge on the protein molecule surface increases, and the hydration layer thickens, significantly improving the protein's solubility, emulsifying properties, foaming properties, and gelling characteristics. It has significant application value in the food industry, including plant protein modification, meat processing, and dairy product improvement. Currently, protein glutaminase has obtained GRAS (Generally Recognized As Safe) certification from the US FDA, becoming one of the core enzyme preparations for food protein modification.

[0003] Existing commercially available protein glutaminases are mainly derived from *Lactobacillus glutamate*, but these natural enzymes have significant performance limitations. First, the wild-type enzyme exhibits low catalytic activity, requiring large amounts of enzyme and long reaction times when processing plant proteins, thus increasing the cost of industrial applications. Second, the enzyme has poor salt tolerance; its activity begins to decline significantly when NaCl concentration exceeds 5%, and the residual activity is less than 30% when the salt concentration reaches 15%, severely limiting its application in high-salt food processing systems. For example, the salt concentration in soy sauce brewing is typically maintained at 15-20%, and the separation process between cured meat products and high-salt plant proteins also involves high-salt environments. Existing protein glutaminases have extremely low catalytic efficiency under such conditions and cannot effectively perform deamidation modification.

[0004] Current research on molecular modification of protein glutaminase mainly focuses on improving thermal stability and specific activity, such as optimizing the catalytic center microenvironment through site-directed mutagenesis and enhancing structural rigidity. However, there are few reports on systematic modifications to improve salt tolerance. Existing conventional strategies for improving enzyme salt tolerance include surface charge engineering, introduction of amphiphilic short peptides, and glycosylation modification. However, no technical solutions have been reported for targeted salt tolerance modification of specific structures of protein glutaminase while simultaneously maintaining high catalytic activity. Therefore, developing a protein glutaminase with both high activity and excellent salt tolerance is of significant practical importance for expanding its application in the processing of high-salt foods. Summary of the Invention

[0005] (a) Technical problems to be solved

[0006] To address the shortcomings of existing technologies, this invention provides a highly active salt-tolerant protein glutaminase and its preparation method.

[0007] (II) Technical Solution

[0008] To achieve the above objectives, the present invention provides the following technical solution:

[0009] In a first aspect, there is a highly active salt-tolerant protein glutaminase, the amino acid sequence of which is formed by the following combination of mutations in the wild-type protein glutaminase sequence shown in SEQ ID NO:1: glycine at position 25 is mutated to aspartic acid, lysine at position 32 is mutated to glutamic acid, leucine at position 66 is mutated to serine, glutamine at position 81 is mutated to isoleucine, glutamic acid at position 128 is mutated to arginine, and serine at position 207 is mutated to aspartic acid.

[0010] Preferably, its amino acid sequence further includes mutations in which threonine at position 67 is changed to aspartic acid and / or isoleucine at position 98 is changed to glutamic acid.

[0011] Preferably, the nucleic acid gene encoding a highly active salt-tolerant protein, glutaminase.

[0012] Preferred, a recombinant expression vector containing nucleic acid genes.

[0013] Preferably, the expression vector is pHT43, pMA0911, or pWB980.

[0014] Preferably, the host bacterium is Bacillus subtilis.

[0015] Preferably, the Bacillus subtilis strain is WB600, WB800, or 168.

[0016] A second aspect of the present invention provides a method for preparing a highly active salt-tolerant protein glutaminase, comprising the following steps:

[0017] S1. The mutant enzyme encoding the synthetic codon optimized was cloned into the Bacillus subtilis expression vector to construct a recombinant expression plasmid.

[0018] S2. Transform the recombinant expression plasmid into Bacillus subtilis competent cells and screen to obtain recombinant engineered bacteria;

[0019] S3. Inoculate the recombinant engineered bacteria into the fermentation medium, induce fermentation, and collect the fermentation supernatant to obtain crude enzyme solution.

[0020] S4. Separate and purify the crude enzyme solution to obtain purified highly active salt-tolerant protein glutaminase.

[0021] Preferably, in the fermentation medium of step S3, the fermentation inducer is lactose, with a final concentration of 0.5-1% (w / v), an induction temperature of 28-32℃, and an induction time of 24-36h.

[0022] Preferred application of highly active salt-tolerant protein glutaminase in high-salt food processing.

[0023] (iii) Beneficial technical effects

[0024] This invention introduces a combination of mutations into the wild-type sequence shown in SEQ ID NO:1: glycine at position 25 is mutated to aspartic acid, lysine at position 32 is mutated to glutamic acid, leucine at position 66 is mutated to serine, glutamine at position 81 is leucine, glutamic acid at position 128 is arginine, and serine at position 207 is mutated to aspartic acid. Further additional mutations can be added, such as threonine at position 67 being mutated to aspartic acid and / or isoleucine at position 98 being glutamic acid. The resulting mutant exhibits improved specific activity and high salt tolerance, making it directly applicable to high-salt food manufacturing systems such as soy sauce brewing, fish sauce fermentation, and oyster sauce processing. It can still efficiently catalyze protein deamidation reactions under high-salt conditions, overcoming the long-standing bottleneck of low catalytic efficiency of wild-type enzymes in high-salt environments. Simultaneously, the protein recovery rate of the mutant is higher than that of the wild-type group, and the glutamic acid content is increased. The treated soy sauce product has a richer flavor and more prominent umami, resulting in a significant improvement in overall quality. Furthermore, this invention utilizes a Bacillus subtilis secretory expression system combined with lactose-induced fermentation to achieve highly efficient extracellular secretory expression of the mutant active protein. The purification process is simple and easy to perform, eliminating the need for complex steps such as inclusion body refolding, which is beneficial for industrial-scale production. The highly active salt-tolerant protein glutaminase mutant provided by this invention represents a qualitative leap compared to the wild-type enzyme in terms of catalytic activity, salt tolerance, and application effects. It offers an efficient enzyme preparation solution for plant protein modification and quality improvement of high-salt fermented condiments, possessing broad industrial application prospects and significant economic value. Detailed Implementation

[0025] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0026] Example 1: Preparation of mutant PG-M2a

[0027] 1. Synthesis of mutant genes and construction of expression vectors

[0028] Based on the wild-type protein glutaminase sequence shown in SEQ ID NO:1, the following mutations were designed and introduced: glycine at position 25 was mutated to aspartic acid, lysine at position 32 was mutated to glutamic acid, leucine at position 66 was mutated to serine, glutamine at position 81 was mutated to isoleucine, glutamic acid at position 128 was mutated to arginine, serine at position 207 was mutated to aspartic acid, and threonine at position 67 was mutated to aspartic acid. The entire genome was optimized according to the codon bias of Bacillus subtilis, and the gene encoding the mutant was artificially synthesized (nucleotide sequence shown in SEQ ID NO:4). BamHI and XbaI restriction sites were introduced upstream and downstream of the gene, respectively. The synthesized gene and expression vector pHT43 were double-digested with BamHI / XbaI, ligated overnight at 16°C using T4 DNA ligase, transformed into E. coli DH5α competent cells, plated on LB agar plates containing 100 μg / mL ampicillin, and incubated overnight at 37°C. Single colonies were picked and inoculated into LB liquid medium. After shaking culture at 37°C, plasmids were extracted, identified by enzyme digestion and sequenced to obtain the recombinant expression plasmid pHT43-PG-M2a.

[0029] 2. Transformation and screening of Bacillus subtilis strains with high expression

[0030] The recombinant expression plasmid pHT43-PG-M2a was transformed into Bacillus subtilis WB800 competent cells using a chemical transformation method. Specific procedures: 100 μL of WB800 competent cells were added to 1 μg of the recombinant plasmid, gently mixed, and cultured at 37°C with shaking at 200 rpm for 30 min. The mixture was then plated onto LB agar plates containing 5 μg / mL chloramphenicol and incubated upside down at 37°C for 16-20 h. Single colonies were picked and inoculated into LB liquid medium containing 5 μg / mL chloramphenicol, and cultured at 37°C with 220 rpm for 12 h. Genomic DNA was extracted for PCR verification. Verified positive clones were inoculated into 50 mL of LB medium containing 5 μg / mL chloramphenicol and cultured at 37°C with 220 rpm until OD600 = 0.8. Lactose was added to a final concentration of 1.0% (w / v), and the culture was cooled to 30°C for another 30 h of induction. The fermentation broth was centrifuged at 4℃ and 8000 rpm for 20 min, and the supernatant was collected. The protein glutaminase activity was determined using Cbz-Gln-Gly as a substrate, and the transformant with the highest enzyme activity was selected as the production strain WB800-PG-M2a.

[0031] 3. High-density fermentation

[0032] The strain WB800-PG-M2a was inoculated into a 250 mL shake flask containing 50 mL of LB medium (containing 5 μg / mL chloramphenicol) and cultured at 37°C and 220 rpm for 12 h as the primary seed culture. 2% of this seed culture was then transferred to a 1 L shake flask containing 200 mL of LB medium and cultured at 37°C and 220 rpm until OD600 = 1.5, serving as the secondary seed culture. 5% of this seed culture was then inoculated into a 5 L fermenter containing 3 L of fermentation medium (formulation: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, 5 g / L glucose, 2 g / L KH2PO4, 0.5 g / L MgSO4·7H2O, 0.1% antifoaming agent). The pH was controlled at 7.0, temperature at 37°C, stirring speed at 400-800 rpm, aeration rate at 2 vvm, and dissolved oxygen >30%. When the culture reaches OD600=9, lactose is added to a final concentration of 1.0% (w / v), the temperature is lowered to 30℃, and induction culture is continued for 32h. After being placed in a container, the fermentation broth is centrifuged at 4℃ and 8000rpm for 20min, and the supernatant is collected. The protein glutaminase activity reaches 410U / mL.

[0033] 4. Isolation and purification of mutants

[0034] The fermentation supernatant was concentrated 6-fold using an ultrafiltration membrane with a molecular weight cutoff of 10 kDa, and dialyzed overnight with 20 mM Tris-HCl buffer (pH 8.0). The dialysate was loaded onto a DEAE Sepharose FF anion exchange chromatography column (2.6 × 20 cm) equilibrated with the same buffer, and eluted linearly with a gradient of 20 mM Tris-HCl buffer (pH 8.0) containing 0–0.5 M NaCl (total gradient volume 500 mL) at a flow rate of 3 mL / min. The active fraction was collected. Solid ammonium sulfate was added to the active fraction to a final concentration of 1.0 M, and the sample was loaded onto a Butyl Sepharose HP hydrophobic chromatography column (1.6 × 15 cm) equilibrated with 20 mM Tris-HCl buffer (pH 8.0) containing 1.0 M ammonium sulfate. The sample was eluted linearly with a gradient of 20 mM Tris-HCl buffer (pH 8.0) containing 1.0–0 M ammonium sulfate (total gradient volume 200 mL) at a flow rate of 2 mL / min. The active peak was collected. The active component was desalted by dialyzing with 20 mM Tris-HCl buffer (pH 8.0), and then freeze-dried to obtain electrophoretically pure mutant protein glutaminase (amino acid sequence as shown in SEQ ID NO: 3).

[0035] Example 2: Preparation of mutant PG-M2b

[0036] 1. Synthesis of mutant genes and construction of expression vectors

[0037] Based on the wild-type protein glutaminase sequence shown in SEQ ID NO:1, the following mutations were designed and introduced: glycine at position 25 was mutated to aspartic acid, lysine at position 32 was mutated to glutamic acid, leucine at position 66 was mutated to serine, glutamine at position 81 was mutated to isoleucine, glutamic acid at position 128 was mutated to arginine, serine at position 207 was mutated to aspartic acid, and isoleucine at position 98 was mutated to glutamic acid. The entire genome was optimized according to the codon preference of Bacillus subtilis, and the gene encoding the mutant PG-M2b was artificially synthesized (nucleotide sequence shown in SEQ ID NO:6). BamHI and XbaI restriction sites were introduced upstream and downstream of the gene, respectively. The synthesized gene and expression vector pHT43 were double-digested with BamHI / XbaI, ligated overnight at 16°C using T4 DNA ligase, transformed into E. coli DH5α competent cells, plated on LB agar plates containing 100 μg / mL ampicillin, and incubated overnight at 37°C. Single colonies were picked and inoculated into LB liquid medium. After shaking culture at 37°C, plasmids were extracted, identified by enzyme digestion and sequenced to obtain the recombinant expression plasmid pHT43-PG-M2b.

[0038] 2. Transformation and screening of Bacillus subtilis strains with high expression

[0039] The recombinant expression plasmid pHT43-PG-M2b was transformed into competent Bacillus subtilis 168 cells via electroporation. Specific procedures: 80 μL of competent 168 cells were mixed with 0.5 μg of the recombinant plasmid and transferred to a pre-chilled electroporation cuvette (2 mm spacing). Electroporation conditions were 2.0 kV, 25 μF, and 200 Ω. Immediately after electroporation, 1 mL of LB medium containing 0.5 M sorbitol was added, and the cells were incubated at 37°C and 150 rpm for 2 h. The cells were then plated on LB agar plates containing 5 μg / mL chloramphenicol and incubated at 37°C for 16-20 h. Genomic DNA was extracted for PCR verification. Positive clones were inoculated into 50 mL of LB medium containing 5 μg / mL chloramphenicol and incubated at 37°C and 220 rpm until OD600 = 0.8. Lactose was added to a final concentration of 1.0% (w / v), and the culture was cooled to 30°C for another 30 h of induction. The fermentation broth was centrifuged at 4℃ and 8000 rpm for 20 min, and the supernatant was collected. The protein glutaminase activity was determined using Cbz-Gln-Gly as a substrate, and the production strain was named 168 / PG-M2b.

[0040] 3. High-density fermentation

[0041] Strain 168 / PG-M2b was inoculated into a 250 mL shake flask containing 50 mL LB medium (containing 5 μg / mL chloramphenicol) and cultured at 37°C and 220 rpm for 12 h as the primary seed culture. 2% of this seed culture was then transferred to a 1 L shake flask containing 200 mL LB medium and cultured at 37°C and 220 rpm until OD600 = 1.5, serving as the secondary seed culture. 5% of this seed culture was then inoculated into a 5 L fermenter containing 3 L of fermentation medium (formulation: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, 5 g / L glucose, 2 g / L KH2PO4, 0.5 g / L MgSO4·7H2O, 0.1% antifoaming agent). The pH was controlled at 7.0, temperature at 37°C, stirring speed at 400-800 rpm, aeration rate at 2 vvm, and dissolved oxygen >30%. When the culture reaches OD600=9, lactose is added to a final concentration of 0.8% (w / v), the temperature is lowered to 30℃, and induction culture is continued for 30h. After being placed in a container, the fermentation broth is centrifuged at 4℃ and 8000rpm for 20min, and the supernatant is collected. The protein glutaminase activity reaches 385U / mL.

[0042] 4. Isolation and purification of mutants

[0043] The fermentation supernatant was concentrated 6-fold using an ultrafiltration membrane with a molecular weight cutoff of 10 kDa and dialyzed overnight with 20 mM Tris-HCl buffer (pH 8.0). The dialysate was loaded onto a DEAE Sepharose FF anion exchange chromatography column (2.6 × 20 cm) equilibrated with the same buffer and eluted linearly with a gradient of 20 mM Tris-HCl buffer (pH 8.0) containing 0–0.5 M NaCl (total gradient volume 500 mL) at a flow rate of 3 mL / min. The active fraction was collected. Solid ammonium sulfate was added to the active fraction to a final concentration of 1.0 M and loaded onto a Butyl Sepharose HP hydrophobic chromatography column (1.6 × 15 cm) equilibrated with 20 mM Tris-HCl buffer (pH 8.0) containing 1.0 M ammonium sulfate. The active peak was collected linearly with a gradient of 20 mM Tris-HCl buffer (pH 8.0) containing 1.0–0 M ammonium sulfate (total gradient volume 200 mL) at a flow rate of 2 mL / min. The active component was desalted by dialyzing with 20 mM Tris-HCl buffer (pH 8.0), and then freeze-dried to obtain electrophoretically pure mutant protein glutaminase (amino acid sequence as shown in SEQ ID NO: 5).

[0044] Example 3: Preparation of mutant PG-M2c

[0045] 1. Synthesis of mutant genes and construction of expression vectors

[0046] Based on the wild-type protein glutaminase sequence shown in SEQ ID NO:1, the following mutations were designed and introduced: glycine at position 25 was mutated to aspartic acid, lysine at position 32 was mutated to glutamic acid, leucine at position 66 was mutated to serine, glutamine at position 81 was mutated to isoleucine, glutamic acid at position 128 was mutated to arginine, serine at position 207 was mutated to aspartic acid, threonine at position 67 was mutated to aspartic acid, and isoleucine at position 98 was mutated to glutamic acid. The entire genome was optimized according to the codon preference of Bacillus subtilis, and the gene encoding the mutant PG-M2c (nucleotide sequence shown in SEQ ID NO:8) was artificially synthesized. BamHI and XbaI restriction sites were introduced upstream and downstream of the gene, respectively. The synthesized gene and expression vector pHT43 were double-digested with BamHI / XbaI, ligated overnight at 16°C using T4 DNA ligase, and transformed into *E. coli* DH5α competent cells. The cells were plated on LB agar plates containing 100 μg / mL ampicillin and incubated overnight at 37°C. Single colonies were picked and inoculated into LB liquid medium, cultured with shaking at 37°C, and the plasmid was extracted. Enzyme digestion and sequencing verification were performed to obtain the recombinant expression plasmid pHT43-PG-M2c.

[0047] 2. Transformation and screening of Bacillus subtilis strains with high expression

[0048] The recombinant expression plasmid pHT43-PG-M2c was transformed into Bacillus subtilis WB600 competent cells. Specific procedures: 100 μL of WB600 competent cells were added to 1 μg of the recombinant plasmid, gently mixed, and cultured at 37°C with shaking at 200 rpm for 30 min. The mixture was then plated onto LB agar plates containing 5 μg / mL chloramphenicol and incubated upside down at 37°C for 16-20 h. Single colonies were picked and inoculated into LB liquid medium containing 5 μg / mL chloramphenicol, and cultured at 37°C with shaking at 220 rpm for 12 h. Genomic DNA was extracted for PCR verification. Verified positive clones were inoculated into 50 mL of LB medium containing 5 μg / mL chloramphenicol and cultured at 37°C with shaking at 220 rpm until OD600 = 0.8. Lactose was added to a final concentration of 1.0% (w / v), and the culture was cooled to 30°C for another 30 h of induction. The fermentation broth was centrifuged at 4℃ and 8000 rpm for 20 min, and the supernatant was collected. The protein glutaminase activity was determined using Cbz-Gln-Gly as a substrate, and the transformant with the highest enzyme activity was selected as the production strain WB600 / PG-M2c.

[0049] 3. High-density fermentation

[0050] The strain WB600 / PG-M2c was inoculated into a 250 mL shake flask containing 50 mL LB medium (containing 5 μg / mL chloramphenicol) and cultured at 37°C and 220 rpm for 12 h as the primary seed culture. 2% of this seed culture was then transferred to a 1 L shake flask containing 200 mL LB medium and cultured at 37°C and 220 rpm until OD600 = 1.5, serving as the secondary seed culture. 5% of this seed culture was then inoculated into a 5 L fermenter containing 3 L of fermentation medium (formulation: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, 5 g / L glucose, 2 g / L KH2PO4, 0.5 g / L MgSO4·7H2O, 0.1% antifoaming agent). The pH was controlled at 7.0, temperature at 37°C, stirring speed at 400-800 rpm, aeration rate at 2 vvm, and dissolved oxygen >30%. When the culture reaches OD600=9, lactose is added to a final concentration of 1.0% (w / v), the temperature is lowered to 28℃, and induction culture is continued for 36 hours. After being placed in a container, the fermentation broth is centrifuged at 4℃ and 8000rpm for 20 minutes, and the supernatant is collected. The protein glutaminase activity reaches 450U / mL.

[0051] 4. Isolation and purification of mutants

[0052] The fermentation supernatant was concentrated 6-fold using an ultrafiltration membrane with a molecular weight cutoff of 10 kDa and dialyzed overnight with 20 mM Tris-HCl buffer (pH 8.0). The dialysate was loaded onto a DEAE Sepharose FF anion exchange chromatography column (2.6 × 20 cm) equilibrated with the same buffer and eluted linearly with a gradient of 20 mM Tris-HCl buffer (pH 8.0) containing 0–0.5 M NaCl (total gradient volume 500 mL) at a flow rate of 3 mL / min. The active fraction was collected. Solid ammonium sulfate was added to the active fraction to a final concentration of 1.0 M and loaded onto a Butyl Sepharose HP hydrophobic chromatography column (1.6 × 15 cm) equilibrated with 20 mM Tris-HCl buffer (pH 8.0) containing 1.0 M ammonium sulfate. The active peak was collected linearly with a gradient of 20 mM Tris-HCl buffer (pH 8.0) containing 1.0–0 M ammonium sulfate (total gradient volume 200 mL) at a flow rate of 2 mL / min. The active component was desalted by dialyzing with 20 mM Tris-HCl buffer (pH 8.0), and then freeze-dried to obtain electrophoretically pure mutant protein glutaminase (amino acid sequence as shown in SEQ ID NO: 7).

[0053] Comparative Example 1: Preparation of Wild-Type Protein Glutaminase 1. Synthesis of wild-type genes and construction of expression vectors Based on the amino acid sequence of the wild-type protein glutaminase shown in SEQ ID NO:1, the entire genome was optimized according to the codon preference of Bacillus subtilis, and a gene encoding the wild-type protein glutaminase (nucleotide sequence shown in SEQ ID NO:2) was artificially synthesized. BamHI and XbaI restriction sites were introduced upstream and downstream of the gene, respectively. The synthesized gene and expression vector pHT43 were double-digested with BamHI / XbaI, ligated overnight at 16°C using T4 DNA ligase, transformed into E. coli DH5α competent cells, plated on LB agar plates containing 100 μg / mL ampicillin, and incubated overnight at 37°C. Single colonies were picked and inoculated into LB liquid medium, cultured with shaking at 37°C, and the plasmid was extracted, identified by restriction enzyme digestion, and sequenced for verification, yielding the recombinant expression plasmid pHT43-PG-WT.

[0054] 2. Transformation and screening of Bacillus subtilis strains with high expression The recombinant expression plasmid pHT43-PG-WT was transformed into Bacillus subtilis WB800 competent cells using a chemical transformation method. Specific procedures: 100 μL of WB800 competent cells were added to 1 μg of the recombinant plasmid, gently mixed, and cultured at 37°C with shaking at 200 rpm for 30 min. The mixture was then plated onto LB agar plates containing 5 μg / mL chloramphenicol and incubated upside down at 37°C for 20 h. Single colonies were picked and inoculated into LB liquid medium containing 5 μg / mL chloramphenicol, and cultured at 37°C with 220 rpm for 12 h. Genomic DNA was extracted for PCR verification. Verified positive clones were inoculated into 50 mL of LB medium containing 5 μg / mL chloramphenicol and cultured at 37°C with 220 rpm until OD600 = 0.8. Lactose was added to a final concentration of 1.0% (w / v), and the culture was cooled to 30°C and induced for another 30 h. The fermentation broth was centrifuged at 4℃ and 8000 rpm for 20 min, and the supernatant was collected. The protein glutaminase activity was determined using Cbz-Gln-Gly as a substrate. The transformant with the highest enzyme activity was selected as the production strain and named WB800 / PG-WT.

[0055] 3. High-density fermentation The strain WB800 / PG-WT was inoculated into a 250 mL shake flask containing 50 mL of LB medium (containing 5 μg / mL chloramphenicol) and cultured at 37°C and 220 rpm for 12 h as the primary seed culture. 2% of this seed culture was then transferred to a 1 L shake flask containing 200 mL of LB medium and cultured at 37°C and 220 rpm until OD600 = 1.5, serving as the secondary seed culture. 5% of this seed culture was then inoculated into a 5 L fermenter containing 3 L of fermentation medium (formulation: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, 5 g / L glucose, 2 g / L KH2PO4, 0.5 g / L MgSO4·7H2O, 0.1% antifoaming agent). The pH was controlled at 7.0, temperature at 37°C, stirring speed at 400 rpm, aeration rate at 2 vvm, and dissolved oxygen >30%. When the culture reaches OD600=9, lactose is added to a final concentration of 1.0% (w / v), the temperature is lowered to 30℃, and induction culture is continued for 32h. After being placed in a container, the fermentation broth is centrifuged at 4℃ and 8000rpm for 20min, and the supernatant is collected. The protein glutaminase activity is 152U / mL.

[0056] 4. Isolation and purification of wild-type enzymes The fermentation supernatant was concentrated 6-fold using an ultrafiltration membrane with a molecular weight cutoff of 10 kDa, and dialyzed overnight with 20 mM Tris-HCl buffer (pH 8.0). The dialysate was loaded onto a DEAE Sepharose FF anion exchange chromatography column (2.6 × 20 cm) equilibrated with the same buffer, and eluted linearly with a gradient of 20 mM Tris-HCl buffer (pH 8.0) containing 0–0.5 M NaCl (total gradient volume 500 mL) at a flow rate of 3 mL / min. The active fraction was collected. Solid ammonium sulfate was added to the active fraction to a final concentration of 1.0 M, and the sample was loaded onto a Butyl Sepharose HP hydrophobic chromatography column (1.6 × 15 cm) equilibrated with 20 mM Tris-HCl buffer (pH 8.0) containing 1.0 M ammonium sulfate. The sample was eluted linearly with a gradient of 20 mM Tris-HCl buffer (pH 8.0) containing 1.0–0 M ammonium sulfate (total gradient volume 200 mL) at a flow rate of 2 mL / min. The active peak was collected. The active component was desalted by dialyzing with 20 mM Tris-HCl buffer (pH 8.0), and then freeze-dried to obtain electrophoretically pure wild-type protein glutaminase (amino acid sequence as shown in SEQ ID NO: 1).

[0057] Enzymatic property determination: 1. Specific activity determination method Using 10 mM Cbz-Gln-Gly as a substrate, the reaction was carried out in 50 mM Tris-HCl buffer (pH 7.0) at 37°C for 30 min, and the amount of ammonia released was determined by the indophenol blue colorimetric method. Enzyme activity units (U) are defined as the amount of enzyme required to catalyze the production of 1 μmol of ammonia per minute under the above conditions. The specific activities of Examples 1-3 and Comparative Example 1 were determined in a standard reaction system without NaCl addition (50 mM Tris-HCl, pH 7.0, 37°C).

[0058] 2. Salt tolerance test Different concentrations of NaCl (2.0 M and 3.0 M) were added to the standard reaction system, and the enzyme activity of each enzyme at the corresponding salt concentration was measured. The relative enzyme activity was calculated with the enzyme activity under the 0 M NaCl condition as 100%.

[0059] 3. Application test of soy sauce simulation system Defatted soybean meal was mixed with 18% (w / v) saline solution at a ratio of 1:2 (w / v), and wild-type and mutant protein glutaminase (2000 U / g soybean meal) were added respectively. The mixture was then subjected to enzymatic hydrolysis at 45°C for 24 h. After the reaction, the protein recovery rate and glutamate content were measured.

[0060] Table 1 Example 1 38.5 96 68 Example 2 36.2 93 62 Example 3 42.8 98 72 Comparative Example 1 15.8 18 8 Table 2 Example 1 82.5 18.7 Example 2 79.8 17.5 Example 3 85.3 20.1 Comparative Example 1 61.3 11.2 As shown in Table 1, the specific activities of Examples 1-3 (36.2-42.8 U / mg) were significantly higher than those of Comparative Example 1 (15.8 U / mg). Under 2.0 M NaCl conditions, the relative enzyme activity of Comparative Example 1 was 18%, while the relative enzyme activity of Examples 1-3 remained above 93%. Under 3.0 M NaCl conditions, the relative enzyme activity of Comparative Example 1 was 8%, while Examples 1-3 still retained 62-72% of their enzyme activity. This indicates that the combined mutation of the present invention significantly improved the structural stability and catalytic activity of the enzyme protein under high salt conditions. As shown in Table 2, the protein recovery rate of Examples 1-3 was 79.8-85.3%, and the glutamic acid content was 17.5-20.1 mg / g soybean meal, both higher than that of Comparative Example 1.

[0061] SEQ ID NO:1: Wild-type protein glutaminase sequence MKNLFLSMMAFVTVLTFNSCADSNGNQEINGKEKLSVNDSKLKDFGKTVPVGIDEENGMIKVSFMLTAQFYEIKPTKENEQYIGMLRQAVKNESPVHIFLKPNSNEIGKVESASPEDVRYFKTILTKEVKGQTNKLASVIPDVATLNSLFNQIKNQSCGTSTASSPCITFRYPVDGCYARAHKMRQILMNNGYDCEKQFVYGNLKASTGTCCVAWSYHVAILVSYKNASGVTEKRIIDPSLFSSGPVTDTAWRNACVNTSCGSASVSSYANTAGNVYYRSPSNSYLYDNNLINTNCVLTKFSLLSGCSPSPAPDVSSCGF SEQ ID NO: 2: Wild-type protein glutaminase gene sequence ATGATGAAAAATTTATTTTTATCTATGATGGCTTTTGTTACTGTTTTAACTTTTAATTCTTGTGCTGATTCTAATGGTAATCAAGAAATTAATGGTAAAGAAAAATTATCTGTTaatGATTCTAAATTAAAAGATTTTGGTAAAACTGTTCCTGTTGGTATTGATGAAGAAAATGGTATGATTAAAGTTTCTTTTATGTTAACTGCTCAATTTTATGAAATTAAACCTACTAAAGAAAATGAACAATATATTGGTATGTTACGTCAAGCTGTTAAAAATGAATCTCCTGTTCATATTTTTTTAAAACCTAATTCTAATGAAATTGGTAAAGTTGAATCTGCTTCTCCTGAAGATGTTCGTTATTTTAAAACTATTTTAACTAAAGAAGTTAAAGGTCAAACTAATAAATTAGCTTCTGTTATTCCTGATGTTGCTACTTTAAAATTCTTTATTTAAATCAAATTAAAAATCAATCTTGTGGTACT TCTACTGCTTCTTCTCCTTGTATTACTTTTCGTTATCCTGTTGATGGTTGTTATGCTCGTGCTCATAAAATGCGTCAAATTTTAATGAATAATGGTTATGATTGTGAAAAACAATTTGTTTATGGTAATTTAAAAGCTTCTACTGGTACTTGTTGTGTTGCTTGGTCTTATCATGTTGCTATTTTAGTTTCTTATAAAAATGCTTCTGGTGTTACTGAAAAACGTATTATTGATCCTTCTTTATTTTCTTCTGGTCCTGTTACTGATACTGCTTGGCGTAATGCTTGTGTTAATACTTCTTGTGGTTCTGCTTCTGTTTCTTCTTATGCTAATACTGCTGGTAATGTTTATTATCGTTCTCCTTCTAATTCTTATTTATATGATAATAATTTAATTAATACTAATTGTGTTTTAACTAAAATTTTCTTTATTATCTGGTTGTTCTCCTTCTCCTGCTCCTGATGTTTCTTCTTGTGGTTTTTAA SEQ ID NO: 3: Sequence of mutant PG-M2a MKNLFLSMMAFVTVLTFNSCADSNDNQEINGEEKLSVNDSKLKDFGKTVPVGIDEENGMIKVSFMSDAQFYEIKPTKENEIYIGMLRQAVKNESPVHIFLKPNSNEIGKVESASPEDVRYFKTILTKRVKGQTNKLASVIPDVATLNSLFNQIKNQSCGTSTASSPCITFRYPVDGCYARAHKMRQILMNNGYDCEKQFVYGNLKADTGTCCVAWSYHVAILVSYKNASGVTEKRIIDPSLFSSGPVTDTAWRNACVNTSCGSASVSSYANTAGNVYYRSPSNSYLYDNNLINTNCVLTKFSLLSGCSPSPAPDVSSCGF SEQ ID NO: 4: Gene sequence of mutant PG-M2a ATGATGAAAAATTTATTTTTATCTATGATGGCTTTTGTTACTGTTTTAACTTTTAATTCTTGTGCTGATTCTAATGATAATCAAGAAATTAATGGTGAAGAAAAATTATCTGTTAATGATTCTAAATTAAAAGATTTTGGTAAAACTGTTCCTGTTGGTATTGATGAAGAAAATGGTATGATTAAAGTTTCTTTTATGTCTGATGCTCAATTTTATGAAATTAAACCTACTAAAGAAAATGAAATTTATATTGGTATGTTACGTCAAGCTGTTAAAAATGAATCTCCTGTTCATATTTTTTTAAAACCTAATTCTAATGAAATTGGTAAAGTTGAATCTGCTTCTCCTGAAGATGTTCGTTATTTTAAAACTATTTTAACTAAACGTGTTAAAGGTCAAACTAATAAATTAGCTTCTGTTATTCCTGATGTTGCTACTTTAAAATTCTTTATTTAAATCAAATTAAAAATCAATCTTGTGGTACT TCTACTGCTTCTTCTCCTTGTATTACTTTTCGTTATCCTGTTGATGGTTGTTATGCTCGTGCTCATAAAATGCGTCAAATTTTAATGAATAATGGTTATGATTGTGAAAAACAATTTGTTTATGGTAATTTAAAAGCTGATACTGGTACTTGTTGTGTTGCTTGGTCTTATCATGTTGCTATTTTAGTTTCTTATAAAAATGCTTCTGGTGTTACTGAAAAACGTATTATTGATCCTTCTTTATTTTCTTCTGGTCCTGTTACTGATACTGCTTGGCGTAATGCTTGTGTTAATACTTCTTGTGGTTCTGCTTCTGTTTCTTCTTATGCTAATACTGCTGGTAATGTTTATTATCGTTCTCCTTCTAATTCTTATTTATATGATAATAATTTAATTAATACTAATTGTGTTTTAACTAAAATTTTCTTTATTATCTGGTTGTTCTCCTTCTCCTGCTCCTGATGTTTCTTCTTGTGGTTTTTAA SEQ ID NO: 5: Sequence of mutant PG-M2b MKNLFLSMMAFVTVLTFNSCADSNDNQEINGEEKLSVNDSKLKDFGKTVPVGIDEENGMIKVSFMSTAQFYEIKPTKENEIYIGMLRQAVKNESPVHEFLKPNSNEIGKVESASPEDVRYFKTILTKRVKGQTNKLASVIPDVATLNSLFNQIKNQSCGTSTASSPCITFRYPVDGCYARAHKMRQILMNNGYDCEKQFVYGNLKADTGTCCVAWSYHVAILVSYKNASGVTEKRIIDPSLFSSGPVTDTAWRNACVNTSCGSASVSSYANTAGNVYYRSPSNSYLYDNNLINTNCVLTKFSLLSGCSPSPAPDVSSCGF SEQ ID NO: 6: Gene sequence of mutant PG-M2b ATGATGAAAAATTTATTTTTATCTATGATGGCTTTTGTTACTGTTTTAACTTTTAATTCTTGTGCTGATTCTAATGATAATCAAGAAATTAATGGTGAAGAAAAATTATCTGTTAATGATTCTAAATTAAAAGATTTTGGTAAAACTGTTCCTGTTGGTATTGATGAAGAAAATGGTATGATTAAAGTTTCTTTTATGTCTACTGCTCAATTTTATGAAATTAAACCTACTAAAGAAAATGAAATTTATATTGGTATGTTACGTCAAGCTGTTAAAAATGAATCTCCTGTTCATGAATTTTTAAAACCTAATTCTAATGAAATTGGTAAAGTTGAATCTGCTTCTCCTGAAGATGTTCGTTATTTTAAAACTATTTTAACTAAACGTGTTAAAGGTCAAACTAATAAATTAGCTTCTGTTATTCCTGATGTTGCTACTTTAAAATTCTTTATTTAAATCAAATTAAAAATCAATCTTGTGGTACT TCTACTGCTTCTTCTCCTTGTATTACTTTTCGTTATCCTGTTGATGGTTGTTATGCTCGTGCTCATAAAATGCGTCAAATTTTAATGAATAATGGTTATGATTGTGAAAAACAATTTGTTTATGGTAATTTAAAAGCTGATACTGGTACTTGTTGTGTTGCTTGGTCTTATCATGTTGCTATTTTAGTTTCTTATAAAAATGCTTCTGGTGTTACTGAAAAACGTATTATTGATCCTTCTTTATTTTCTTCTGGTCCTGTTACTGATACTGCTTGGCGTAATGCTTGTGTTAATACTTCTTGTGGTTCTGCTTCTGTTTCTTCTTATGCTAATACTGCTGGTAATGTTTATTATCGTTCTCCTTCTAATTCTTATTTATATGATAATAATTTAATTAATACTAATTGTGTTTTAACTAAAATTTTCTTTATTATCTGGTTGTTCTCCTTCTCCTGCTCCTGATGTTTCTTCTTGTGGTTTTTAA SEQ ID NO: 7: Sequence of mutant PG-M2c MKNLFLSMMAFVTVLTFNSCADSNDNQEINGEEKLSVNDSKLKDFGKTVPVGIDEENGMIKVSFMSDAQFYEIKPTKENEIYIGMLRQAVKNESPVHEFLKPNSNEIGKVESASPEDVRYFKTILTKRVKGQTNKLASVIPDVATLNSLFNQIKNQSCGTSTASSPCITFRYPVDGCYARAHKMRQILMNNGYDCEKQFVYGNLKADTGTCCVAWSYHVAILVSYKNASGVTEKRIIDPSLFSSGPVTDTAWRNACVNTSCGSASVSSYANTAGNVYYRSPSNSYLYDNNLINTNCVLTKFSLLSGCSPSPAPDVSSCGF SEQ ID NO: 8: Gene sequence of mutant PG-M2c ATGATGAAAAATTTATTTTTATCTATGATGGCTTTTGTTACTGTTTTAACTTTTAATTCTTGTGCTGATTCTAATGATAATCAAGAAATTAATGGTGAAGAAAAATTATCTGTTAATGATTCTAAATTAAAAGATTTTGGTAAAACTGTTCCTGTTGGTATTGATGAAGAAAATGGTATGATTAAAGTTTCTTTTATGTCTGATGCTCAATTTTATGAAATTAAACCTACTAAAGAAAATGAAATTTATATTGGTATGTTACGTCAAGCTGTTAAAAATGAATCTCCTGTTCATGAATTTTTAAAACCTAATTCTAATGAAATTGGTAAAGTTGAATCTGCTTCTCCTGAAGATGTTCGTTATTTTAAAACTATTTTAACTAAACGTGTTAAAGGTCAAACTAATAAATTAGCTTCTGTTATTCCTGATGTTGCTACTTTAAAATTCTTTATTTAAATCAAATTAAAAATCAATCTTGTGGTACT TCTACTGCTTCTTCTCCTTGTATTACTTTTCGTTATCCTGTTGATGGTTGTTATGCTCGTGCTCATAAAATGCGTCAAATTTTAATGAATAATGGTTATGATTGTGAAAAACAATTTGTTTATGGTAATTTAAAAGCTGATACTGGTACTTGTTGTGTTGCTTGGTCTTATCATGTTGCTATTTTAGTTTCTTATAAAAATGCTTCTGGTGTTACTGAAAAACGTATTATTGATCCTTCTTTATTTTCTTCTGGTCCTGTTACTGATACTGCTTGGCGTAATGCTTGTGTTAATACTTCTTGTGGTTCTGCTTCTGTTTCTTCTTATGCTAATACTGCTGGTAATGTTTATTATCGTTCTCCTTCTAATTCTTATTTATATGATAATAATTTAATTAATACTAATTGTGTTTTAACTAAAATTTTCTTTATTATCTGGTTGTTCTCCTTCTCCTGCTCCTGATGTTTCTTCTTGTGGTTTTTAA Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

Claims

1. A highly active, salt-tolerant protein glutaminase, characterized in that, Its amino acid sequence is obtained by the following combination of mutations in the wild-type protein glutaminase sequence shown in SEQ ID NO:1: glycine at position 25 is mutated to aspartic acid, lysine at position 32 is mutated to glutamic acid, leucine at position 66 is mutated to serine, glutamine at position 81 is mutated to isoleucine, glutamic acid at position 128 is mutated to arginine, and serine at position 207 is mutated to aspartic acid. Its amino acid sequence also contains mutations such as threonine at position 67 being changed to aspartic acid and / or isoleucine at position 98 being changed to glutamic acid.

2. The gene encoding the highly active salt-tolerant protein glutaminase of claim 1.

3. A recombinant expression vector comprising the encoding gene of claim 2.

4. The recombinant expression vector according to claim 3, characterized in that, The expression vector is pHT43, pMA0911, or pWB980.

5. A genetically engineered host bacterium comprising the recombinant expression vector of claim 4, characterized in that, The host bacterium is Bacillus subtilis.

6. The genetically engineered host bacterium according to claim 5, characterized in that, The Bacillus subtilis strain is WB600, WB800, or 168.

7. A method for preparing a highly active salt-tolerant protein glutaminase as described in claim 1, characterized in that, Includes the following steps: S1. The mutant enzyme encoding the synthetic codon optimized was cloned into the Bacillus subtilis expression vector to construct a recombinant expression plasmid. S2. Transform the recombinant expression plasmid into Bacillus subtilis competent cells and screen to obtain recombinant engineered bacteria; S3. Inoculate the recombinant engineered bacteria into the fermentation medium, induce fermentation, and collect the fermentation supernatant to obtain crude enzyme solution. S4. Separate and purify the crude enzyme solution to obtain purified highly active salt-tolerant protein glutaminase.

8. The preparation method according to claim 7, characterized in that, In the fermentation medium of step S3, the fermentation inducer is lactose, with a final concentration of 0.5-1%, an induction temperature of 28-32℃, and an induction time of 24-36h.

9. The application of the highly active salt-tolerant protein glutaminase according to claim 8 in the processing of high-salt foods.