Brassica napus drought tolerance gene BnA03.SAP5 and application thereof
Patent Information
- Application Number
- CN202610848937.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-06-12
- Publication Date
- 2026-08-28
AI Technical Summary
[0005]然而,目前尚无甘蓝型油菜SAP5基因的任何报道,其序列特征、进化关系、表达模式、亚细胞定位、生物学功能及抗旱机制均为未知
[0018] The beneficial effects of this invention are as follows: This invention is the first to complete a systematic analysis of the SAP5 family of six Brassica species, including Chinese cabbage, black mustard, kale, Ethiopian mustard, mustard-type rapeseed, and kale-type rapeseed, clarifying evolutionary patterns, conserved characteristics, and chromosome distribution, providing a theoretical basis for the study of stress-resistance genes in Brassica plants. This invention is the first to isolate the drought-resistance gene BnA03.SAP5 from kale-type rapeseed and verify its positive regulation of plant drought resistance. Overexpression of this gene in plants can significantly improve the growth capacity and survival rate of plants under drought, high salinity, and osmotic stress, with stable drought resistance effects; it fills the research gap of this gene in kale-type rapeseed and provides a new key gene resource for rapeseed drought-resistance breeding. The kale-type rapeseed drought-resistance gene BnA03.SAP5 disclosed in this invention can be applied to improving plant drought resistance and in breeding for improved plant drought resistance, and has broad application prospects.
Smart Images

Figure CN122648437A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant genetic engineering technology, specifically to the drought-resistant gene BnA03.SAP5 in Brassica napus and its applications. Background Technology
[0002] Rapeseed (Brassica napus L.) is an important oilseed crop in my country, with the Yangtze River basin being the main production area. Affected by seasonal droughts and frequent autumn droughts, rapeseed seedlings, during their developmental stages, and at maturity often suffer from drought stress, leading to stunted growth, reduced yields, and deteriorated quality, severely restricting the development of the rapeseed industry. Developing drought-resistant new rapeseed varieties is the fundamental way to solve drought stress, and identifying and utilizing key drought-resistant genes is the core of molecular breeding.
[0003] The plant stress-associated protein (SAP) family contains the A20 / AN1 zinc finger domain and is widely involved in abiotic stress responses. Among them, the SAP5 gene has been shown to have drought resistance, salt tolerance, and heat tolerance in plants such as rice, wheat, soybean, and cucumber. Its encoded protein has E3 ubiquitin ligase activity and enhances plant stress resistance by regulating the expression of downstream stress resistance genes, regulating the accumulation of osmotic substances, and enhancing antioxidant capacity.
[0004] AtSAP5 is an ortholog of OsSAP1 in Arabidopsis thaliana and is the most studied member of the SAP family to date. AtSAP5 expression is induced by ABA, salt stress, drought stress, and low and high temperatures. Expression of AtSAP5 in plants such as Arabidopsis thaliana and tobacco can improve plant tolerance to drought stress or low and high temperatures. AtSAP5 contains one A20 and one AN1 zinc finger domain; its full-length protein or the AN1 zinc finger domain possesses E3 ubiquitin ligase activity, while the A20 zinc finger domain alone only exhibits self-ubiquitination activity. AtSAP5 can recognize AtMBP-1 and mediate its degradation via the 26S protease system, relieving AtMBP-1's inhibition of AtSTZ / ZAT10 expression and thus activating abiotic stress responses. Furthermore, AtSAP5 can also interact with another Arabidopsis thaliana nuclear localization protein, multi-protein binding factor 1c. The mutants of AtSAP5 and AtMBF1c exhibit similar heat-sensitive phenotypes, and co-expression of AtSAP5 and AtMBF1c under high-temperature conditions results in higher levels of upwelling target gene expression compared to expression of AtSAP5 or AtMBF1c alone. TaSAP5 in wheat is also an ortholog of OsSAP1 and possesses E3 ubiquitin ligase activity. The expression of its encoded gene is induced by drought stress, and expression of TaSAP5 in both Arabidopsis and wheat enhances plant tolerance to drought stress.
[0005] However, there are currently no reports on the SAP5 gene in Brassica napus, and its sequence characteristics, evolutionary relationships, expression patterns, subcellular localization, biological functions, and drought resistance mechanisms are all unknown. Therefore, exploring the SAP5 gene in Brassica napus and elucidating its drought resistance function and regulatory mechanisms are of great significance for breeding new drought-resistant rapeseed varieties. Summary of the Invention
[0006] In view of this, the purpose of this invention is to provide a drought-resistant gene BnA03.SAP5 for Brassica napus and its application.
[0007] To achieve the above objectives, the present invention provides the following technical solution:
[0008] This invention provides the drought-resistant gene BnA03.SAP5 for Brassica napus, the CDS sequence of which is shown in SEQ ID No. 1.
[0009] The present invention also provides a protein encoded by the above-mentioned drought-resistant gene BnA03.SAP5 of Brassica napus, the amino acid sequence of which is shown in SEQ ID No.2.
[0010] The present invention also provides an expression vector containing the above-mentioned cabbage drought-resistant gene BnA03.SAP5.
[0011] The present invention also provides a host bacterium containing the above-mentioned drought-resistant gene BnA03.SAP5 from Brassica napus.
[0012] This invention also provides the application of the above-mentioned drought-resistant gene BnA03.SAP5 from Brassica napus in enhancing plant drought resistance. The plants include, but are not limited to, rapeseed, Arabidopsis thaliana, rice, wheat, and soybean, with rapeseed being the preferred species, and Brassica napus being the most preferred.
[0013] This invention also provides a method for enhancing plant drought resistance, the method comprising overexpressing the drought-resistant gene BnA03.SAP5 in rapeseed using genetic engineering techniques to enhance the plant's drought resistance. The plants include, but are not limited to, rapeseed, Arabidopsis thaliana, rice, wheat, and soybean, with rapeseed being the preferred variety, and rapeseed being the most preferred.
[0014] This invention also provides a method for creating drought-resistant plants, the method comprising introducing the above-mentioned drought-resistant gene BnA03.SAP5 of Brassica napus, or the above-mentioned expression vector, or the above-mentioned host bacteria into plants, and screening to obtain transgenic plants with enhanced drought resistance. The plants include, but are not limited to, rapeseed, Arabidopsis thaliana, rice, wheat, and soybean, preferably rapeseed, and most preferably Brassica napus.
[0015] This invention also provides the application of the above-mentioned drought-resistant gene BnA03.SAP5 in rapeseed in the breeding of plants to improve drought resistance.
[0016] Furthermore, the application includes introducing the aforementioned drought-resistant gene BnA03.SAP5 from Brassica napus into plants, and improving the plant's tolerance to drought, high salinity, and osmotic stress through overexpression, for use in molecular breeding of drought-resistant crops. The plants include, but are not limited to, rapeseed, Arabidopsis thaliana, rice, wheat, and soybean, with rapeseed being the preferred species, and Brassica napus being the most preferred.
[0017] This invention also provides a method for identifying or screening drought-resistant plants. The method includes detecting the expression level or content of the BnA03.SAP5 gene as described in claim 1 or the protein as described in claim 2 in the plant to be tested. If the expression level or content is higher than the control, the plant is identified or screened as a drought-resistant plant or its candidate material. The plants include, but are not limited to, rapeseed, Arabidopsis thaliana, rice, wheat, and soybean, with rapeseed being the preferred species, and most preferably Brassica napus.
[0018] The beneficial effects of this invention are as follows: This invention is the first to complete a systematic analysis of the SAP5 family of six Brassica species, including Chinese cabbage, black mustard, kale, Ethiopian mustard, mustard-type rapeseed, and kale-type rapeseed, clarifying evolutionary patterns, conserved characteristics, and chromosome distribution, providing a theoretical basis for the study of stress-resistance genes in Brassica plants. This invention is the first to isolate the drought-resistance gene BnA03.SAP5 from kale-type rapeseed and verify its positive regulation of plant drought resistance. Overexpression of this gene in plants can significantly improve the growth capacity and survival rate of plants under drought, high salinity, and osmotic stress, with stable drought resistance effects; it fills the research gap of this gene in kale-type rapeseed and provides a new key gene resource for rapeseed drought-resistance breeding. The kale-type rapeseed drought-resistance gene BnA03.SAP5 disclosed in this invention can be applied to improving plant drought resistance and in breeding for improved plant drought resistance, and has broad application prospects. Attached Figure Description
[0019] Figure 1 Phylogenetic tree of SAP5 gene members in Arabidopsis thaliana and 6 Brassica species.
[0020] Figure 2 The results of the comparison of SAP5 family proteins in Arabidopsis thaliana and six Brassica species.
[0021] Figure 3 Gene structure and conserved motif analysis of Arabidopsis thaliana and six Brassica species of the SAP5 family; results; where A: phylogenetic tree; B: conserved motif; C: conserved domain; D: gene structure.
[0022] Figure 4 To locate the SAP5 family chromosomes of Arabidopsis thaliana and six Brassica species.
[0023] Figure 5 This is a structural diagram of the overexpression vector.
[0024] Figure 6 To obtain transgenic Arabidopsis thaliana overexpressing BnA03.SAP5; where A: amplification of the coding sequence of BnA03.SAP5; B: detection of the expression level of BnA03.SAP5 in transgenic Arabidopsis thaliana, *** P < 0.001 significantly different at the expression level.
[0025] Figure 7 The phenotype of Arabidopsis thaliana overexpressing BnA03.SAP5 under drought treatment.
[0026] Figure 8 Different stress treatments were used to overexpress BnA03.SAP5 Arabidopsis thaliana; where A: phenotypic observation; B: root length statistics, *P < 0.05 was statistically significant.
[0027] Figure 9 To determine the content of indicators in Arabidopsis seedlings overexpressing BnA03.SAP5 under drought treatment, ***P < 0.001 showed significant differences at different levels. Detailed Implementation
[0028] The technical solution of the present invention will be further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are merely illustrative and explanatory of the present invention and should not be construed as limiting the scope of protection of the present invention. All technologies implemented based on the above content of the present invention are covered within the scope of protection intended by the present invention. It should be noted that the experimental materials whose source is not specified in the embodiments of the present invention are all commercially available, and the experimental methods whose specific conditions are not specified in the embodiments of the present invention are generally performed according to conventional experimental methods or according to the methods recommended by the experimental material manufacturers.
[0029] Example 1: Genome Identification and Bioinformatics Analysis of the SAP5 Family of Brassicae
[0030] (1) Sequence acquisition and family member identification
[0031] Sequence acquisition: The AtSAP5 protein sequence of Arabidopsis thaliana was obtained from the TAIR database; the genome, protein sequences and annotation information of Chinese cabbage, black mustard, cabbage, Ethiopian mustard, mustard-type rapeseed, and rapeseed type rapeseed were obtained from the Brassica napus information resource database BnIR.
[0032] Family member identification: Using the AtSAP5 protein sequence as a probe, bidirectional BLAST was performed using TB tools to screen candidate SAP5 genes in the genomes of Chinese cabbage, black mustard, cabbage, Ethiopian mustard, rapeseed, and rapeseed. Conserved domains were verified using the CDD database, and 29 SAP5 family members containing the complete A20 / AN1 zinc finger domain were obtained.
[0033] (2) Gene structure and evolutionary analysis of the SAP5 gene family
[0034] To further investigate the phylogenetic relationships of SAP5, multiple sequence alignment was performed on 29 SAP5 protein sequences from Arabidopsis thaliana, Brassica napus, Brassica oleracea, Brassica rapa, Brassica oleracea, and Brassica oleracea using MEGA11. A phylogenetic tree was constructed using the neighbor-joining method (1000 bootstrap iterations), and visualization was optimized using iTOL. Figure 1 , Figure 3 A). Based on the clustering results, all SAP5 members can be divided into 6 main evolutionary branches, with gene members within each branch exhibiting obvious species specificity and homology characteristics. From the clustering pattern, the SAP5 genes of Brassica napus do not form independent clusters, but rather closely cluster with homologous genes from Chinese cabbage and Brassica oleracea, respectively. This indicates that the SAP5 family retained orthologous genes from the two diploid parents during the polyploidization of Brassica oleracea, and that no large-scale gene loss or rearrangement occurred.
[0035] To elucidate the functional conservation of SAP5 family proteins, multiple alignment analysis was performed on the SAP5 protein sequences of Arabidopsis thaliana and six Brassica species. Figure 2 The results showed that the SAP5 protein exhibited significant sequence differences at the N-terminus and C-terminus, while the central structure was highly conserved. These conserved sites mainly correspond to the A20 and AN1 zinc finger domains. The A20 domain is responsible for E3 ubiquitin ligase activity, while the AN1 domain participates in protein-protein interactions; together, they constitute the core functional modules of the SAP5 protein in stress responses. In summary, the high conservation of the core functional domains of the SAP5 family proteins ensures their fundamental functions in plant stress responses.
[0036] (3) Physicochemical properties and subcellular localization of SAP5 gene family proteins
[0037] To further investigate the physicochemical properties of SAP5, the protein sequences of 29 SAP genes from Arabidopsis thaliana, Brassica napus, Brassica oleracea, Brassica rapa, Brassica oleracea, and Brassica oleracea were analyzed using the Expasy database (Table 1). The results showed that the amino acid count of the 29 SAP5 genes ranged from 155 aa to 193 aa; the molecular weight ranged from 12915.57 Da to 21350.76 Da; and the predicted theoretical isoelectric point ranged from 9.12 to 9.52.
[0038] The SAP5 protein sequences were submitted to the WoLF PSORT website for subcellular localization prediction. The results showed that 18 proteins were located in the nucleus, 7 in the cytoplasm, 14 in chloroplasts, and 15 in chloroplasts. This result indicates that different members of the SAP5 family exhibit significant heterogeneity in subcellular localization, suggesting that they may participate in the regulation of diverse biological functions by distributing themselves in different cellular components such as the cytoplasm, nucleus, and chloroplasts.
[0039] Table 1. Genetic information of each protein in the SAP5 family.
[0040] AtSAP5 160 9.46 17657.89 Chloroplast BnaC05T0476600ZS 159 9.38 17437.69 Chloroplast BnaC01T0456800ZS 155 9.38 17153.56 Chloroplast BnaA05T0424600ZS 159 9.38 17441.63 Chloroplasts, cell nucleus, cytoplasm BnaA03T0329000ZS 159 9.4 17683.79 cytoplasm BnaC03T0395100ZS 155 9.38 17203.48 cell nucleus BnaA01T0366100ZS 116 9.8 12915.57 Chloroplast BjuB006962 156 9.6 17126.48 Chloroplast BjuA006094 156 9.38 17284.62 cell nucleus, cytoplasm BjuA020368 159 9.38 17427.62 Chloroplasts, cell nucleus, cytoplasm BjuB008595 160 9.38 17710.77 cell nucleus BjuA012117 159 9.4 17682.77 cytoplasm BcaC05g29253 159 9.38 17497.7 cell nucleus BcaB04g21049 166 9.43 18290.03 cell nucleus BcaB06g25528 161 9.38 17739.78 Chloroplasts, cell nucleus BcaB04g18711 160 9.38 17710.77 cell nucleus BcaC01g04023 155 9.38 17203.48 cell nucleus BcaC05g24347 159 9.12 17798.59 cell nucleus BraA01g040570.4C.2 157 9.38 17254.61 Chloroplasts, cell nucleus BraA01g040570.4C.1 157 9.38 17254.61 Chloroplasts, cell nucleus BraA05g036840.4C.1 160 9.38 17427.62 Chloroplasts, cell nucleus, cytoplasm BraA06g002830.4C.4 169 7.5 17782.65 Chloroplast BolC5t34197H 160 9.38 17497.7 cell nucleus BolC1t05193H 156 9.28 17110.52 Chloroplast BolC4t22198H 160 9.22 17730.58 cell nucleus BolC3t16852H 156 9.38 17273.52 cytoplasm BniB01g052450.2N.1 193 9.42 21350.76 Chloroplast BniB07g026190.2N.1 161 9.38 17710.77 cell nucleus BniB07g056200.2N.1 160 9.52 17475.61 cell nucleus
[0041] (3) Conserved domains and motif analysis of the SAP5 gene family
[0042] Conserved motifs and domains of the SAP5 protein were predicted using TBtools software, and a total of 10 conserved motifs were identified. Figure 3 B). Most SAP5 proteins contain the core motifs Motif 1 and Motif 2, which correspond to the A20 and AN1 zinc finger domains and are key functional regions for the SAP family proteins to perform E3 ubiquitin ligase activity. This coexistence of motif conservation and diversity suggests that the SAP5 family, while maintaining its core function, has also adapted to the specific needs of different species through motif variations. (Annotations of conserved domains of SAP5 proteins are provided.) Figure 3 C), the results showed that all members contained typical A20 and AN1 zinc finger superfamily domains (ZnF_A20 and ZnF_AN1), and some members also contained auxiliary domains such as the CUE1 superfamily. Analysis of gene structure ( Figure 3 (D) Most SAP5 genes contain only one exon and no introns, while a few genes contain a small number of introns. Furthermore, the high similarity in gene structure within the same evolutionary branch further confirms the clustering results of the phylogenetic tree, indicating a close relationship between gene structure evolution and functional differentiation.
[0043] (4) Chromosomal localization of the SAP5 gene family
[0044] To clarify the distribution characteristics of SAP5 genes on the chromosomes of Brassica napus and its parent species, chromosomal physical mapping analysis was performed on 29 SAP5 genes. Figure 4 The results showed that in Brassica napus, the SAP5 gene was distributed on multiple chromosomes in both the A and C subgenomes. Its distribution site in the A subgenome highly matched the corresponding chromosome in Chinese cabbage (AA genome), while its distribution in the C subgenome remained consistent with the homologous chromosomes of Brassica napus (CC genome). No large-scale gene translocations or chromosomal rearrangements were observed, fully confirming that Brassica napus completely preserved the SAP5 gene resources from both parental subgenomes during polyploidization. In diploid Brassica species such as Chinese cabbage and Brassica napus, the SAP5 gene was also dispersed across multiple chromosomes, without forming obvious tandem repeat gene clusters. In Arabidopsis thaliana, due to its smaller genome size, SAP5 gene loci were detected only on a few chromosomes.
[0045] Example 2: Cloning and Overexpression Vector Construction of BnA03.SAP5 Gene
[0046] RNA extraction and cDNA synthesis: Total RNA was extracted from leaves of Brassica napus ZS11 and reverse transcribed to synthesize cDNA.
[0047] PCR amplification: Specific primers were designed, including forward primer F: ATGGCGCAGAGAACGGAGAA (SEQ ID No. 3) and reverse primer R: TCAACTCAATTTCACCATCT (SEQ ID No. 4). High-fidelity enzyme amplification of the full-length CDS of BnA03.SAP5 was performed using cDNA as a template. Figure 6 A).
[0048] Vector construction: Using homologous recombination technology, the amplified fragment was ligated into a plant overexpression vector, transformed into E. coli, and sequenced to verify the recombinant plasmid 35S::BnA03.SAP5. Figure 5 ).
[0049] Example 3: Obtaining and Detecting the Expression Level of Transgenic Arabidopsis
[0050] Agrobacterium transformation: The recombinant plasmid was transformed into Agrobacterium GV3101 and infected wild-type Arabidopsis thaliana.
[0051] Screening for homozygous lines: Resistance screening yielded T3 generation homozygous overexpression lines OE-1, OE-2, and OE-3;
[0052] qRT-PCR detection: RNA was extracted from transgenic and wild-type Arabidopsis thaliana, reverse transcribed into cDNA, and BnaActin7 was used as an internal control. The expression level of BnA03.SAP5 was detected using the SsoAdvanced Universal SYBR® Green Supermix kit. The results showed that the expression levels of homozygous lines OE-1 to OE-3 were 28-fold, 17-fold, and 18-fold higher than those of the control, respectively. Figure 6 B).
[0053] Example 4: Identification of drought tolerance phenotypes under drought and osmotic stress
[0054] Drought treatment during seedling stage: Wild-type (WT) and overexpressing Arabidopsis thaliana were planted in nutrient soil and placed in a 30% humidity incubator after 4 weeks of age. A 7-day drought treatment followed by a 2-day rehydration was performed, and phenotypes were observed and photographed. Results showed that after 7 days of drought treatment, both WT and overexpressing Arabidopsis thaliana exhibited varying degrees of wilting, with WT showing more severe wilting than the overexpressing line. After 2 days of rehydration, the overexpressing Arabidopsis thaliana recovered better than the WT line. Figure 7 ).
[0055] Root length stress experiment: After disinfection, seeds were sown in 1 / 2 MS, 120 mM NaCl, 200 mM mannitol, and 300 mM mannitol media. After germination for 1 day, the seeds were transferred and cultured for 5 days. The taproot length was measured and statistically analyzed. The results showed that on 1 / 2 MS medium, the root length and overall growth of wild-type and overexpression lines were basically the same. Under 120 mM NaCl treatment, the growth of WT seedlings was significantly inhibited, with short taproots and sparse lateral roots. The taproot length of the overexpression lines was significantly longer than that of WT, and the lateral roots were more developed, resulting in better overall growth than the wild type. Under osmotic stress simulated by 200 mM and 300 mM mannitol, the growth inhibition of WT seedlings was more significant, with shortened taproots and weak plants. The taproot length and plant vigor of the overexpression lines were significantly better than those of WT, showing stronger tolerance to osmotic stress. Figure 8 AB).
[0056] Example 5: Measurement of physiological indicators under drought stress
[0057] To further elucidate the physiological mechanism by which BnA03.SAP5 enhances drought tolerance in plants, leaf samples were collected from wild-type and overexpressing Arabidopsis thaliana before and after drought treatment. Following the instructions of the Grace Company kit, the contents of proline (PRO), malondialdehyde (MDA), and peroxidase (POD) were measured. Each sample was tested in triplicate, and statistical analysis was performed to determine significant differences. Results are as follows: Figure 9As shown in the figure. The results showed that under normal growth conditions, there was no significant difference in proline content between WT and the overexpression lines. After drought treatment, the proline content of all lines increased significantly, with the overexpression lines showing a significantly higher proline content than WT. This indicates that overexpression of BnA03.SAP5 can significantly enhance the osmotic regulation capacity of Arabidopsis thaliana under drought stress, maintaining cell osmotic pressure and mitigating damage caused by water deficit by accumulating more proline. Under normal growth conditions, there was no significant difference in MDA content between WT and the overexpression lines. After drought treatment, the MDA content of all lines increased, but the MDA content of WT was significantly higher than that of the overexpression lines. This suggests that overexpression of BnA03.SAP5 can effectively reduce the degree of membrane lipid peroxidation under drought stress, protect the integrity of cell membrane structure, and thus enhance the drought resistance of the plant. Peroxidase is an important antioxidant enzyme that can scavenge reactive oxygen species and alleviate oxidative stress. Under normal growth conditions, there was no significant difference in POD activity between the WT and overexpression lines. After drought treatment, the POD activity of all lines increased significantly, while the POD activity of the overexpression lines was significantly higher than that of the WT lines. This indicates that overexpression of BnA03.SAP5 can significantly improve the antioxidant enzyme activity of Arabidopsis thaliana under drought stress, enhance its ability to scavenge reactive oxygen species, and thus reduce oxidative damage.
[0058] In summary, the experimental results and phenotypic observations corroborate each other, indicating that BnA03.SAP5 positively regulates plant drought tolerance. Overexpression of this gene in plants can significantly improve plant growth capacity and survival rate under drought, high salinity, and osmotic stress, with stable drought tolerance effects. It can serve as an important candidate gene for genetic improvement of crop drought tolerance.
[0059] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. The drought-resistant gene BnA03.SAP5 in Brassica napus is characterized by, The CDS sequence of the gene BnA03.SAP5 is shown in SEQ ID No.
1.
2. The protein encoded by the cabbage-type drought-resistant gene BnA03.SAP5 according to claim 1, characterized in that, The amino acid sequence of the protein is shown in SEQ ID No.
2.
3. An expression vector containing the cabbage-type drought-resistant gene BnA03.SAP5 as described in claim 1.
4. A host bacterium containing the drought-resistant gene BnA03.SAP5 of Brassica napus as described in claim 1.
5. The application of the drought-resistant gene BnA03.SAP5 of Brassica napus as described in claim 1 in enhancing plant drought resistance.
6. A method for enhancing plant drought resistance, characterized in that, The method includes overexpressing the drought-resistant gene BnA03.SAP5 of Brassica napus as described in claim 1 in plants using genetic engineering techniques to enhance the drought resistance of the plants.
7. A method for creating drought-resistant plants, characterized in that, The method includes introducing the cabbage drought-resistant gene BnA03.SAP5 as described in claim 1, the expression vector as described in claim 3, or the host bacterium as described in claim 4 into plants, and screening to obtain transgenic plants with enhanced drought resistance.
8. The application of the drought-resistant gene BnA03.SAP5 of Brassica napus as described in claim 1 in the breeding of plants to improve drought resistance.
9. The application according to claim 8, characterized in that, The application includes introducing the drought-resistant gene BnA03.SAP5 of Brassica napus as described in claim 1 into plants, and improving the plant's tolerance to drought, high salt, and osmotic stress through overexpression, for use in molecular breeding of drought-resistant crops.
10. A method for identifying or screening drought-resistant plants, characterized in that, The method includes detecting the expression level or content of the BnA03.SAP5 gene as described in claim 1 or the protein as described in claim 2 in the plant to be tested. If the expression level or content is higher than that of the control, it is identified or screened as a drought-resistant plant or its candidate material.