Application of ghosmlp1 protein and its coding gene in improving cotton fiber quality

Abstract

The application discloses application of a GhOSMLP1 protein or a coding gene thereof in improving cotton fiber quality. An amino acid sequence of the GhOSMLP1 protein is shown as SEQ ID NO: 2. Through expression analysis, subcellular localization, overexpression and gene editing function verification, it is found that GhOSMLP1 The GhOSMLP1 protein has a negative regulation on cotton fiber quality. Mutagenesis or knockout of a coding gene of the GhOSMLP1 protein can reduce the function of the GhOSMLP1 protein or make the function of the GhOSMLP1 protein lost, so that the length of cotton fibers is increased, the breaking strength of the cotton fibers is improved and / or the micronaire value of the cotton fibers is reduced. GhOSMLP1 The application provides a new molecular target and technical approach for cotton fiber quality improvement and high-quality cotton germplasm creation.

Description

Technical Field

[0001] This invention belongs to the field of plant molecular biology and crop genetics and breeding technology, specifically involving the application of GhOSMLP1 protein and its encoding gene in improving cotton fiber quality. Background Technology

[0002] cotton( Gossypium hirsutum Cotton (L.) is an important natural fiber crop and economic crop. Cotton fiber originates from single-celled processes of seed epidermal cells, and its quality directly affects the quality and economic value of raw materials for the textile industry. Fiber length, cotton fiber breaking strength, and micronaire value are important indicators for evaluating cotton fiber quality. Therefore, elucidating the molecular regulatory mechanisms of cotton fiber development and identifying key genes regulating fiber quality formation is of great significance for breeding high-quality cotton varieties.

[0003] Cotton fiber development is a complex and highly coordinated biological process, typically including stages such as fiber initiation, elongation, secondary cell wall thickening, and maturation. In recent years, with the development of cotton genome sequencing and molecular biology techniques, a large number of genes involved in the regulation of fiber development have been identified and reported. These reported genes mainly involve pathways such as plant hormone signal transduction, cell wall synthesis and remodeling, dynamic changes in the cytoskeleton, and transcriptional regulatory networks, all of which collectively influence fiber growth and development. However, the molecular regulatory mechanisms underlying cotton fiber quality formation remain incomplete, necessitating the discovery of new targets for fiber quality regulation to provide new genetic resources for cotton fiber quality improvement and molecular breeding.

[0004] Osmotin-like protein (OSMLP) belongs to the PR-5 family of pathogenesis-related proteins (PR) and is widely found in higher plants. Previous studies have shown that OSMLP1-like proteins are involved in various abiotic responses in plants, including pathogen infection, salt stress, drought stress, and low-temperature stress, and are closely related to plant growth and development. However, GhOSMLP1 Whether it participates in the process of cotton fiber development and fiber quality formation, especially its specific regulatory role in the formation of cotton fiber length, cotton fiber breaking strength and micronaire value, still lacks clear functional verification.

[0005] While existing technologies have reported that some PR-5 proteins are associated with plant disease resistance, stress resistance, or developmental processes, no definitive reports have been found. GhOSMLP1 The negative regulatory effect of cotton fiber length, breaking strength, and micronaire value has not yet been observed through [the following]: GhOSMLP1 Technical solutions for improving cotton fiber quality by mutating or knocking out coding genes.

[0006] Therefore, it is necessary to clarify the function of GhOSMLP1 protein or its encoding gene in the regulation of cotton fiber quality and to develop and utilize it. GhOSMLP1 Molecular breeding methods as targets for improving fiber quality. Summary of the Invention

[0007] The purpose of this invention is to provide the application of the GhOSMLP1 protein or its encoding gene in improving cotton fiber quality. Through research on... GhOSMLP1 By analyzing the expression patterns, subcellular localization, and genetic functions of [the substance], this invention discovered... GhOSMLP1 It has a negative regulatory effect on cotton fiber quality; by reducing the receptor cotton GhOSMLP1 The expression of the encoding gene, the reduction of GhOSMLP1 protein function, or the loss of GhOSMLP1 protein function can increase cotton fiber length, improve cotton fiber breaking strength, and / or reduce cotton fiber micronaire value.

[0008] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides the application of GhOSMLP1 protein or its encoding gene in improving the quality of cotton fibers.

[0009] Furthermore, the amino acid sequence of the GhOSMLP1 protein is shown in SEQ ID NO: 2.

[0010] Furthermore, the improved cotton fiber quality is achieved by reducing the amount of [unclear - possibly referring to a specific component or element] in the recipient cotton. GhOSMLP1 Expression of coding genes, reduction GhOSMLP1 The loss of function of the GhOSMLP1 protein may be achieved by impairing its function.

[0011] Furthermore, the improvement in cotton fiber quality is achieved by reducing or eliminating the function of the GhOSMLP1 protein.

[0012] Furthermore, the reduction or loss of GhOSMLP1 protein function is achieved by causing... GhOSMLP1 This is achieved through mutation or knockout of the coding gene.

[0013] Furthermore, the mutation or knockout increases cotton fiber length, improves fiber breaking strength, and / or reduces micronaire value.

[0014] Furthermore, the mutation or knockout is achieved using the CRISPR / Cas9 gene editing system.

[0015] Furthermore, the CRISPR / Cas9 gene editing system includes targeted... GhOSMLP1The sgRNA1 and sgRNA2 encode genes; the target sequence of sgRNA1 is shown in SEQ ID NO: 3, and the target sequence of sgRNA2 is shown in SEQ ID NO: 4.

[0016] Furthermore, the CRISPR / Cas9 gene editing system contains a target... GhOSMLP1 Recombinant gene editing vectors encoding sgRNA expression cassettes of genes.

[0017] Furthermore, the aforementioned GhOSMLP1 The coding sequence of the gene is shown in SEQ ID NO: 1.

[0018] Furthermore, the cotton in question is upland cotton.

[0019] In a second aspect, the present invention provides a method for improving the quality of cotton fibers, comprising the steps of reducing the function of GhOSMLP1 protein in recipient cotton, causing loss of GhOSMLP1 protein function, or reducing / blocking the expression of GhOSMLP1 encoding gene; the amino acid sequence of the GhOSMLP1 protein is shown in SEQ ID NO: 2.

[0020] Furthermore, the reduction of GhOSMLP1 protein function in receptor cotton, the loss of GhOSMLP1 protein function, or the reduction / blocking of GhOSMLP1 protein function... GhOSMLP1 Encoding gene expression, through the CRISPR / Cas9 gene editing system GhOSMLP1 The CRISPR / Cas9 gene editing system is achieved through mutation or knockout of the coding gene; it includes targeted gene editing. GhOSMLP1 The gene encodes sgRNA1 and sgRNA2, wherein the target sequence of sgRNA1 is shown in SEQ ID NO: 3, and the target sequence of sgRNA2 is shown in SEQ ID NO: 4. Further, the... GhOSMLP1 The coding sequence of the gene is shown in SEQ ID NO: 1.

[0021] Furthermore, the cotton in question is upland cotton.

[0022] Compared with the prior art, the present invention has the following beneficial effects: (1) This invention clarifies the negative regulatory role of GhOSMLP1 protein or its encoding gene in the formation of cotton fiber quality, and provides a new molecular target that can be used to improve the quality of cotton fiber.

[0023] (2) This invention has verified the efficacy of overexpression and gene editing materials. GhOSMLP1 Its regulatory function on cotton fiber quality. Overexpression GhOSMLP1Subsequently, cotton fiber length and fiber breaking strength decreased, while micronaire value increased; thus... GhOSMLP1 When the coding gene is mutated or knocked out, the cotton fiber length increases, the fiber breaking strength increases, and the micronaire value decreases or shows a decreasing trend.

[0024] (3) This invention provides a method for using the CRISPR / Cas9 gene editing system to enable... GhOSMLP1 The method of modifying or knocking out the coding gene to reduce or eliminate the function of the GhOSMLP1 protein in order to improve the quality of cotton fibers provides a new technical path for the creation of high-quality cotton germplasm and molecular breeding. Attached Figure Description

[0025] Figure 1 for GhOSMLP1 An analysis of expression patterns at different developmental stages of cotton fibers.

[0026] Figure 2 This is a subcellular localization analysis diagram of the GhOSMLP1 protein. In the diagram, A represents GhOSMLP1 and GhOSMLP1... Δsp Protein structure diagram; B represents GhOSMLP1-eGFP and GhOSMLP1 Δsp Subcellular localization results of -eGFP in leaves of Nicotiana benthamiana, scale bar 50 μm.

[0027] Figure 3 for GhOSMLP1 Startup driver GUS Schematic diagram of GUS staining patterns in different tissues of transgenic Arabidopsis thaliana. A shows GUS staining results in seedlings; B shows GUS staining results in stems and epidermal hairs; C shows GUS staining results in flowers; and D shows GUS staining results in pods. Scale bar: 1 mm.

[0028] Figure 4 for GhOSMLP1 A diagram illustrating the impact of [the product / method] on cotton fiber development and quality. In this diagram, A represents [the product / method]. GhOSMLP1 Overexpression in cotton lines GhOSMLP1 The level of expression; B is GhOSMLP1 The editing types in the sgRNA1 and sgRNA2 target regions of different gene-edited cotton lines; C represents... GhOSMLP1 Comparison of fiber length at different developmental stages of overexpression lines, wild-type lines, and gene-edited lines. Scale bar: 1 cm; D represents... GhOSMLP1 Statistical analysis of fiber length at different developmental stages in overexpression lines, wild-type lines, and gene-edited lines. Detailed Implementation

[0029] The present invention will be further described below with reference to embodiments. These embodiments are for illustrative purposes only and should not be construed as limiting the scope of protection of the present invention. Conventional substitutions, adjustments, or improvements made to the present invention by those skilled in the art without departing from the inventive concept should all fall within the scope of protection of the present invention.

[0030] Experimental materials The seeds of upland cotton varieties CCRI24 and Jin668, Arabidopsis thaliana seeds, and Nicotiana benthamiana seeds used in this embodiment were materials preserved in the laboratory.

[0031] The pCAMBIA2300 vector is a laboratory-preserved material. The p7N vector is a conventional gene-editing vector in this field and can be constructed using conventional methods. Agrobacterium GV3101 was used for transient expression and Arabidopsis transformation, and Agrobacterium LB4404 was used for cotton genetic transformation.

[0032] Experimental reagents and consumables FastPure Plant Total RNA Isolation Kit was purchased from Vazyme; Evo M-MLV Reverse Transcription Premix Kit was purchased from Accurate Biology; Perfectstart SYBR Green qPCR master mix kit was used for quantitative real-time PCR detection; Thermo Scientific GeneJET Gel Extraction Kit was used for gel extraction; Thermo Scientific GeneJET Plasmid Mini-Prep Kit was used for plasmid extraction; Clon Express II OneStep Cloning Kit was purchased from Vazyme; Taq Master Mix was purchased from Vazyme; GUS staining kit and cotton ovule in vitro culture medium were purchased from Coolaber.

[0033] BamH I , Sac I , Sbf I , Bsa I Restriction endonucleases were purchased from New England Biolabs. Kanamycin, acetylsuccinone, MES, MgCl2, mannitol, sucrose, surfactant L-77, and other reagents were all commercially available and commonly used in this field.

[0034] Culture medium and solution LB liquid medium, LB solid medium, MS medium, 1 / 2MS solid medium, MSB medium, co-culture medium, differentiation medium, rooting medium, and cotton ovule in vitro medium were all prepared according to conventional methods in this field.

[0035] In the subcellular localization experiment, the Agrobacterium resuspension included MES 10 mM, AS 200 μM, MgCl2 10 mM, and pH 5.8.

[0036] The resuspended solution for Arabidopsis flower-dipping transformation contained MS 2.37 g / L, sucrose 50 g / L, surfactant L-77 200 μL / L, and pH 5.8.

[0037] Example 1 GhOSMLP1 Expression analysis at different developmental stages of cotton fibers Fibers from upland cotton (CCRI24) at 5, 10, 15, 20, 25, and 30 DPA after flowering were collected and stored at -80℃ for later use. The fibers at each stage were ground into powder in liquid nitrogen and immediately extracted with total RNA using the FastPure Plant Total RNA Isolation Kit (Vazyme, China). The RNA concentration of the samples was measured and recorded using a micro-ultraviolet spectrophotometer (ThermoScientific, Nanodrop 2000). The extracted RNA was used directly in downstream experiments or stored at -80℃ for later use.

[0038] cDNA synthesis was performed using the Evo M-MLV reverse transcription premix kit (Accurate Biology, China). The reverse transcription system is shown in Table 1.

[0039] Table 1 Reverse transcription system

[0040] The prepared system was placed in a PCR instrument and reacted at 37°C for 15 min, then at 85°C for 5 s. The obtained cDNA was stored in a -40°C freezer.

[0041] Quantitative PCR was performed using the Perfectstart SYBR Green qPCR master mix kit. GhUBQ7 As an internal reference gene, using 2 -△△CT Method calculation GhOSMLP1 The relative expression level. The primers used for amplification are as follows: qGhOSMLP1-F:CATACCCTCACCCACCGTTC, as shown in SEQ ID NO: 5; qGhOSMLP1-R:CAGGAGAAATGCCCGTTGGA, as shown in SEQ ID NO: 6; The fluorescence quantitative PCR system is shown in Table 2, and the reaction procedure is shown in Table 3. Table 2 RT-qPCR system

[0042] Table 3 RT-qPCR reaction procedure

[0043] RT-qPCR results showed that GhOSMLP1 It showed high expression levels during the fiber development and elongation phases (5 DPA and 10 DPA) and the secondary wall thickening phase (30 DPA). Figure 1 The results show that... GhOSMLP1 It may participate in the elongation of cotton fibers and the thickening of secondary walls.

[0044] Example 2 Subcellular localization of GhOSMLP1 protein Signal peptide prediction of the GhOSMLP1 protein using SignalP showed that the GhOSMLP1 protein contains a signal peptide sequence at its N-terminus, such as... Figure 2 As shown in A. To further clarify the subcellular localization of the GhOSMLP1 protein and the effect of its signal peptide on subcellular localization, cDNA was amplified from upland cotton CCRI24 leaves. GhOSMLP1 Coding sequence and removal of signal peptide coding region GhOSMLP1 Δsp Encode the sequences and construct them respectively. GhOSMLP1-eGFP and GhOSMLP1 Δsp -eGFP Fusion expression vector. The primers used for amplification are as follows: GhOSMLP1-F:acgggggactcttgaggatccATGGCTTCTTCTTTGTTAGTTTTAG, as shown in SEQ IDNO: 7; GhOSMLP1-R:gcccttgctcaccatgagctcGTGACAGAAGATAACTTTTAGCTCACG, as shown in SEQ IDNO: 8; GhOSMLP1 Δsp -F: acgggggactcttgaggatccAGTCATCCTGGTCTCATTTTAACAGT, as shown in SEQ IDNO: 9; GhOSMLP1 Δsp The -R sequence is identical to GhOSMLP1-R, as shown in SEQ ID NO: 8.

[0045] The PCR amplification system is shown in Table 4, and the PCR reaction procedure is shown in Table 5.

[0046] Table 4 PCR amplification system

[0047] Table 5 PCR reaction procedure

[0048] After the PCR program, a 1% agarose gel was prepared for electrophoresis to separate the target fragment, and the gel containing the target fragment was cut and recovered. The gel recovery procedure was performed according to the Thermo Scientific GeneJET Gel Extraction Kit (Thermo Fisher Scientific, America) instruction manual. After gel recovery, the concentration of the target fragment was determined using an ultra-micro UV spectrophotometer for subsequent experiments.

[0049] The plasmid extraction procedure was performed according to the instructions of the Thermo Scientific GeneJET Plasmid Mini-Prep Kit (ThermoFisher Scientific, America). The pCAMBIA2300 vector was digested using two restriction enzymes, BamHI and SacI. The digestion system is shown in Table 6.

[0050] Table 6 Enzyme digestion system

[0051] The digested vector was subjected to agarose gel electrophoresis and the linear vector was obtained for subsequent experiments. The target gene fragment and the vector were ligated using the Clon Express II One Step Cloning Kit (Vazyme, China). The recombinant plasmid was transformed into Trans-T1 (Transgen biotech, China) competent E. coli cells, following the instructions for use. Single colonies were picked and cultured in centrifuge tubes containing 500 μL of LB liquid medium at 37°C and 200 rpm for 3 h. After culture, colony PCR was performed using Taq Master Mix (Vazyme, China), with primers identical to those used for the target gene amplification.

[0052] The colony PCR system is shown in Table 7, and the colony PCR reaction procedure is shown in Table 8.

[0053] Table 7 Colony PCR System

[0054] Table 8 Colony PCR Reaction Procedure After colony PCR, agarose gel electrophoresis was performed. Single-clone bacterial cultures containing the target fragment size band were sequenced. Single-clone bacterial cultures with sequencing results identical to the nucleic acid sequence of the inserted fragment were retained for subsequent experiments.

[0055] After successfully sequencing positive monoclonal strains were expanded and recombinant plasmids were extracted. The recombinant plasmids were transformed into Agrobacterium competent cells GV3101 using a heat shock transformation method. Single clones were picked for colony PCR, and positive monoclonal strains were preserved for later use. Agrobacterium GV3101 containing GhOSMLP1-eGFP was cultured in LB broth to the logarithmic growth phase. The bacterial cells were collected and resuspended in resuspending buffer (MES: 10 mM; AS: 200 μM; MgCl2: 10 mM; pH=5.8) until OD500. 600 The value was 1.0. After placing the resuspended bacterial solution in the dark for 3-4 hours, the bacterial solutions of GhOSMLP1-eGFP and AtPIP2A-mCherry were co-injected into 1-month-old tobacco leaves using a 1 mL syringe. Δsp The subcellular localization method for -eGFP and the pCAMBIA2300-eGFP empty vector control is the same as above.

[0056] Subsequently, the tobacco was cultured in the dark for 24 h, followed by culture under light for 24 h. After treatment with 0.8 M mannitol, the injected leaves were observed under a laser scanning confocal microscope.

[0057] The results showed that, Figure 2 As shown in Figure B, the green fluorescence of the GhOSMLP1-eGFP fusion protein is mainly distributed in the cell membrane; while GhOSMLP1 Δsp The green fluorescence of -eGFP and the empty vector control was distributed in the cell membrane and nucleus. Further co-localization analysis using the plasma membrane marker protein AtPIP2A-mCherry showed that GhOSMLP1-eGFP and GhOSMLP1... Δsp The green fluorescence signal of GhOSMLP1-eGFP overlaps with the red fluorescence signal of AtPIP2A-mCherry, indicating that GhOSMLP1-eGFP and GhOSMLP1... Δsp -eGFP is located entirely within the cell membrane. Plasmolysis experiments further validated these results. In summary, GhOSMLP1 protein is primarily located within the cell membrane. After removing the signal peptide, GhOSMLP1Δsp-eGFP, in addition to its location within the cell membrane, also exhibits nuclear fluorescence, indicating that the signal peptide influences the subcellular distribution of GhOSMLP1 protein.

[0058] Example 3 GhOSMLP1 GUS histochemical staining Obtained from the CottonFGD database GhOSMLP1 The promoter sequence 2000 bp upstream of the start codon was used to amplify the promoter fragment using primers designed with Primer Premier 5.0 (proGhOSMLP1-F: cttgcatgcctgcaggtcgacTTTTCTTTTACAAGGTTATTAAGTGGG, SEQ ID NO: 10; proGhOSMLP1-R: gaagactggagatctggatccTTTTGAAACGAATGTAGAGATGGATT, SEQ ID NO: 11), with CCRI24 leaf genomic DNA as a template. Sbf I and BamH I As the restriction site, pro was constructed using the method described in Example 2. GhOSMLP1 :: GUS The vector was then transformed into Agrobacterium GV3101.

[0059] Wild-type Arabidopsis thaliana was infected using the flower-dipping method. When the wild-type Arabidopsis thaliana reached its full flowering stage, the transformed Agrobacterium GV3101 was resuspended in a resuspension solution (MS: 2.37 g / L; sucrose: 50 g / L; surfactant L-77: 200 μL / L; pH=5.8) to OD0.05. 600 The value was 1.0. Arabidopsis inflorescences were immersed in a resuspended bacterial solution for 30 seconds, then protected from light for 24 hours before being cultured under normal growth conditions. A second infection was performed one week later using the same method. Transgenic Arabidopsis T1 generation seeds were obtained after the seeds matured.

[0060] The harvested T1 generation seeds were sown on MS medium containing 50 mg / L kanamycin for resistance selection, and molecular detection was performed using the TransDirect Plant Tissue PCR Kit. Transgenic plants that tested positive by PCR were retained for further self-pollination. The above selection and identification process was repeated for the obtained T2 generation seeds until homozygous transgenic plants were obtained. GUS histochemical staining of seedlings, stems, leaves, flowers, and pods of the obtained homozygous transgenic Arabidopsis plants was performed using a GUS staining kit (Coolaber, China), and the samples were observed and imaged under a stereomicroscope (Leica, M165C).

[0061] GUS histochemical staining results showed that obvious GUS staining signals were detected in transgenic Arabidopsis seedlings, stems, flowers, and pods, as shown in the figures below. Figure 3As shown in Figures A, B, C, and D, obvious staining signals were also present in the stem and epidermal hairs. These results indicate that... GhOSMLP1 The promoter exhibits expression activity in different tissues, suggesting that... GhOSMLP1 It may be involved in plant tissue development.

[0062] Example 4 GhOSMLP1 Construction and identification of cotton overexpression materials The overexpression vector 35S:: was constructed according to the method in Example 2. GhOSMLP1 The *Agrobacterium* strain was transformed into *Agrobacterium* LB4404 competent cells, and positive strains were preserved for future use after PCR identification. The genetic transformation steps for cotton are as follows: (1) Select plump Jin668 seeds, disinfect the surface twice with 75% alcohol, then wash twice with sterile water, plant them in 1 / 2MS solid medium, and obtain sterile seedlings after 7 days.

[0063] (2) The contents of 35S:: GhOSMLP1 After activation of Agrobacterium with recombinant plasmid, the OD of the bacterial culture was adjusted. 600 Reserve up to 0.5.

[0064] (3) Cut the hypocotyl of the sterile seedling into stem segments of about 1 cm, place the hypocotyl explants in the Agrobacterium tumefaciens solution obtained in (2) for 2 min, and discard the solution. Place the hypocotyls on the culture medium and culture for 2 days.

[0065] (4) The co-cultured hypocotyls were transferred to MSB medium containing kanamycin to induce callus tissue.

[0066] (5) After embryogenic callus appears, transfer it to differentiation medium for further culture.

[0067] (6) Transfer the differentiated embryoids to the rooting medium until regenerated plants are obtained.

[0068] Genomic DNA was extracted from the regenerated plants, and positive plants were screened for subsequent analysis using PCR identification following the PCR system and procedure described in Example 2. RT-qPCR was used to detect the presence of genomic DNA in each transgenic line. GhOSMLP1 The expression level was determined using the method described in Example 1. Results showed that among the four overexpression lines obtained... GhOSMLP1 The expression levels of [the substance] were significantly higher than those of wild-type Jin668, such as [the expression level of the substance]. Figure 4 As shown in A.

[0069] Example 5 GhOSMLP1 Construction and identification of gene-edited cotton materials according to GhOSMLP1Encoding gene sequence information, and designing targeted therapies using CRISPR-P2.0 and CRISPR-GE online software. GhOSMLP1 The gene encoding sgRNA1 and sgRNA2. The target sequence of sgRNA1 is CACCCTGTCCTCGAACGAGG, as shown in SEQ ID NO: 3; the target sequence of sgRNA2 is CCGCATTGAATGCAACGGTC, as shown in SEQ ID NO: 4. An sgRNA expression cassette was constructed using overlap PCR, with the following primers used: CasGhOSMLP1-F: agagtcgaagtagtgattgCACCCTGTCCTCGAACGAGGgttttagagctagaaata, SEQ ID NO: 12; CasGhOSMLP1-R:tatttctagctctaaacGACCGTTGCATTCAATGCGGcaatcactacttcgactc, SEQ ID NO: 13.

[0070] The gene editing vector p7N was used... Bsa I After enzyme digestion, the sgRNA expression cassette was recovered via gel extraction. The sgRNA expression cassette was ligated into the p7N vector. The correctly sequenced plasmid was transformed into Agrobacterium LB4404, and colony PCR was performed for identification. Positive Agrobacterium strains were preserved for later use. The PCR system and reaction procedure are shown in Tables 7 and 8, respectively. The PCR primer sequences are as follows: Cas-F: CTGGCGAAAGGGGGATGTGCTGCAA, SEQ ID NO: 14; Cas-R: GCCATTTGTCTGCAGAATTG, SEQ ID NO: 15.

[0071] The genetic transformation method for gene-edited cotton materials was performed according to the genetic transformation method for overexpression cotton materials in Example 4. After obtaining regenerated plants, sequencing analysis was performed on each gene-edited line.

[0072] Sequencing results showed that, compared with wild-type Jin668, the KO1, KO2, and KO3 lines were... GhOSMLP1 Sequence alterations occurred in all target regions of the coding genes, manifesting as different types of editing mutations, such as... Figure 4 As shown in B. Nucleotide positions are indicated by SEQ ID NO: 1. GhOSMLP1 The first nucleotide of the coding sequence is the starting point for counting.

[0073] Among them, the KO1 strain GhOSMLP1 The G base at position 155 of the coding gene is deleted; KO2 strain GhOSMLP1The coding gene has a deletion of the G base at position 155 and a deletion of the CAT bases at positions 297–299; the KO3 strain... GhOSMLP1 The coding gene has a G base deletion at position 155 and a T base insertion after position 296.

[0074] Plants with confirmed editing were continuously screened through multiple generations to obtain homozygous lines, ultimately yielding three homozygous GhOSMLP1 gene-edited lines with different editing types. KO1 and KO2 were selected for subsequent fiber length and quality analysis.

[0075] Sequencing results showed that the KO1, KO2, and KO3 lines GhOSMLP1 Different types of insertion or deletion mutations occurred in the target region of the coding gene. Combined with the fiber length and fiber quality test results from Example 6, this indicates that by... GhOSMLP1 Mutations in the coding gene can reduce the normal function of GhOSMLP1, thereby improving the quality of cotton fibers.

[0076] Example 6 GhOSMLP1 Effects on cotton fiber length and fiber quality Will GhOSMLP1 Overexpression lines, wild-type Jin668 and GhOSMLP1 The gene-edited strain was planted in the experimental field, and field management was carried out in accordance with conventional cotton cultivation management measures.

[0077] Flowers harvested on the day of flowering were collected, and the ovaries were removed and placed in sterile Erlenmeyer flasks. The ovary surface was then disinfected twice with 75% ethanol. Subsequently, the ovaries were cut open and the ovules were removed. The ovules were placed in cotton ovule in vitro culture medium and cultured at 30°C. Samples were taken on days 5, 10, 15, 20, 25, and 30 after culture to observe and measure fiber length.

[0078] The results showed that at all detection periods, the fiber length of the overexpression lines OE1 and OE2 was lower than that of the wild-type Jin668, while the fiber length of the gene-edited lines KO1 and KO2 was higher than that of the wild-type Jin668, with more significant differences at 10 days and 25 days. Figure 4 As shown in C and D. The above results indicate that GhOSMLP1 It has a negative regulatory effect on cotton fiber elongation. Further verification is needed. GhOSMLP1 The effect on mature fiber length was investigated by measuring the length of fibers from the same part of mature cotton bolls from each line after harvesting mature cotton bolls. The results showed that overexpression... GhOSMLP1 The length of post-mature fibers decreases, thus making GhOSMLP1 Mutations or knockouts in coding genes lead to increased mature fiber length, such as... Figure 4 As shown in C and D.

[0079] Further quality testing was conducted on the mature fibers, including fiber length, uniformity index, fiber breaking strength, and micronaire value. Fiber quality testing was carried out by the Cotton Research Institute of the Chinese Academy of Agricultural Sciences and the Cotton Quality Inspection and Testing Center of the Ministry of Agriculture and Rural Affairs.

[0080] Table 9 GhOSMLP1 Comparison of overexpression and gene editing with wild-type cotton fiber quality

[0081] Note: Data are expressed as mean ± standard deviation; * indicates a significant difference compared to wild-type Jin668. P <0.05; ** indicates a highly significant difference compared to wild-type Jin668. P< 0.01.

[0082] As shown in Table 9, compared with the wild type Jin668, GhOSMLP1 The overexpression lines OE1 and OE2 showed decreased fiber length and fiber breaking strength, but increased micronaire value. GhOSMLP1 Gene-edited lines KO1 and KO2 showed increased fiber length and fiber breaking strength, while their micronaire values ​​decreased or showed a decreasing trend.

[0083] The above results indicate that GhOSMLP1 It negatively regulates the cotton fiber quality formation process and can affect fiber quality traits such as fiber length, fiber breaking strength, and micronaire value. By making... GhOSMLP1 Mutations or knockouts in the coding gene can reduce or eliminate the function of the GhOSMLP1 protein, thereby increasing cotton fiber length, increasing cotton fiber breaking strength, and / or decreasing cotton fiber micronaire value.

Claims

1. The application of GhOSMLP1 protein or its encoding gene in improving cotton fiber quality, characterized in that, By knocking out of the cotton GhOSMLP1 The gene encodes a material that improves the quality of cotton fibers; wherein the improvement in cotton fiber quality is manifested in increased cotton fiber length, increased cotton fiber breaking strength, and / or decreased cotton fiber micronaire value; the amino acid sequence of the GhOSMLP1 protein is shown in SEQ ID NO:

2.

2. The application according to claim 1, characterized in that, The knockout was achieved using the CRISPR / Cas9 gene editing system.

3. The application according to claim 2, characterized in that, The CRISPR / Cas9 gene editing system includes targeted... GhOSMLP1 The gene encoding sgRNA1 and sgRNA2, wherein the target sequence of sgRNA1 is shown in SEQ ID NO: 3 and the target sequence of sgRNA2 is shown in SEQ ID NO:

4.

4. The application according to claim 3, characterized in that, The CRISPR / Cas9 gene editing system contains targeted... GhOSMLP1 Recombinant gene editing vectors encoding sgRNA expression cassettes of genes.

5. The application according to any one of claims 1-4, characterized in that, The GhOSMLP1 The coding sequence of the gene is shown in SEQ ID NO: 1; the cotton is upland cotton.

6. A method for improving the quality of cotton fibers, characterized in that, By knocking out of the cotton GhOSMLP1 Encoding genes to improve cotton fiber quality; wherein, the improved cotton fiber quality is manifested in increased cotton fiber length, increased cotton fiber breaking strength, and / or decreased cotton fiber micronaire value; the... GhOSMLP1 The coding sequence of the gene is shown in SEQ ID NO:1; GhOSMLP1 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO:

2.

7. The method according to claim 6, characterized in that, The knockout is achieved using a CRISPR / Cas9 gene editing system; the CRISPR / Cas9 gene editing system includes a targeted... GhOSMLP1 The gene encoding sgRNA1 and sgRNA2, wherein the target sequence of sgRNA1 is shown in SEQ ID NO: 3 and the target sequence of sgRNA2 is shown in SEQ ID NO:

4.

8. The method according to claim 6, characterized in that, The cotton in question is upland cotton.

Images