A method for creating a high-quality disease-resistant and stress-resistant rice germplasm based on CRISPR / Cas9 multi-target precise editing

Abstract

The application belongs to the field of plant biotechnology, and particularly relates to a method for directionally creating disease-resistant high-quality stress-resistant rice germplasm based on CRISPR / Cas9 multi-target precise editing. OsBADH2 gene, OsSSIIa gene, OsXa13 gene, OsTT2 gene and OsSdr4 gene are edited, and two complementary gene editing strategies are flexibly adopted, a classic CRISPR / Cas9 knockout is adopted for a disease gene needing function loss, and guide editing is adopted for a functional site needing fine regulation to realize single-base resolution precise modification, so that multi-gene and multi-traits are coordinately improved. Therefore, the technical scheme of the application can not only be used for improving rice aroma, reducing amylose content of rice, improving rice resistance to bacterial leaf blight, improving rice resistance to high temperature, and improving rice storage resistance, but also can obtain disease-resistant high-quality stress-resistant rice germplasm, and provide scientific guidance for rice breeding and trait improvement.

Description

Technical Field

[0001] This invention belongs to the field of plant biotechnology, specifically relating to a method for the targeted creation of disease-resistant, high-quality, and stress-resistant rice germplasm based on CRISPR / Cas9 multi-target precise editing. Background Technology

[0002] Rice ( Oryza sativa L. (Leymus chinensis) is one of the world's most important food crops, and its yield, quality, and resistance directly affect food security. Traditional hybridization breeding is time-consuming and inefficient, making it difficult to rapidly aggregate multiple superior alleles. In recent years, gene editing technologies, represented by CRISPR / Cas9, have brought about groundbreaking changes in crop genetic improvement. This technology guides Cas9 protein to cut DNA double strands by recognizing genomic targets using guide RNA (gRNA), achieving gene knockout through the non-homologous end joining (NHEJ) repair pathway or precise editing through the homologous recombination repair (HDR) pathway. However, HDR has extremely low efficiency in plant cells (up to about 8.8%) and has strict requirements on cell division state, greatly limiting its application in precision crop breeding.

[0003] Unlike CRISPR / Cas9, guided gene editing is a precise gene modification technique that does not require DNA double-strand breaks or donor DNA templates. This technique fuses the nCas9 (H840A) nickase with reverse transcriptase (RT). Guided by engineered pegRNA, a single-stranded nick is created at the target site and used as a primer to integrate a reverse transcription template (RTT) containing the intended editing information into the genome, achieving precise base transitions, transversions, or small fragment insertions / deletions. However, there are no reports of rice editing using either of these gene editing strategies. Summary of the Invention

[0004] The purpose of this invention is to provide a method for the targeted creation of disease-resistant, high-quality, and stress-resistant rice germplasm based on CRISPR / Cas9 multi-target precise editing, through rice... OsBADH2 Gene, OsSSIIa Gene, OsXa13 Gene, OsTT2 Genes and OsSdr4 Gene editing yields disease-resistant, high-quality, and stress-resistant rice.

[0005] This invention provides a method for the targeted creation of disease-resistant, high-quality, and stress-resistant rice germplasm based on CRISPR / Cas9 multi-target precision editing, through rice... OsBADH2 Gene, OsSSIIa Gene, OsXa13 Gene, OsTT2 Genes and OsSdr4Gene editing yields disease-resistant, high-quality, and stress-resistant rice; the editing includes: (1) targeted gene editing. OsBADH2 The Y163H and W170Q loci of the gene are about to be... OsBADH2 The codon encoding tyrosine (Y) at position 163 in the gene is mutated to encode histidine (H), and the codon encoding tryptophan (W) at position 170 is mutated to encode glutamine (Q), thus achieving... OsBADH2 Gene editing; (2) Targeted OsSSIIa The L781F site of the gene is about to OsSSIIa The codon encoding leucine (L) at position 781 in the gene is mutated to encode phenylalanine (F), thus achieving... OsSSIIa Gene editing; (3) knockout OsXa13 The coding region of a gene; (4) targeting OsTT2 The C165A site of the gene is about to OsTT2 The codon encoding cysteine ​​(C) at position 165 in the gene is mutated to encode alanine (A), thus achieving... OsTT2 Gene editing; (5) Inserting the enhancer sequence shown in SEQ ID NO:19 into rice at specific sites. OsSdr4 The gene translation start codon is located 50-200 bp upstream of the ATG codon; OsBADH2 Gene, OsSSIIa Gene, OsXa13 Gene, OsTT2 Genes and OsSdr4 The nucleotide sequences of the gene correspond to SEQ ID NO:22, 23, 24, 25 and 26 respectively; the disease-resistant, high-quality and stress-resistant traits are: enhancing rice aroma, reducing rice amylose content, improving rice resistance to bacterial blight, improving rice high-temperature resistance and improving rice storage resistance.

[0006] Preferably, it includes the following steps: S1. Construct guided editing expression vectors and knockout editing expression vectors respectively; the target genes to be edited by the guided editing expression vectors include: OsBADH2 Gene, OsSSIIa Gene, OsTT2 Genes and OsSdr4 Genes; the target genes for editing using the knockout editing expression vector include: OsXa13 S2. Introduce the guided editing expression vector and the knockout editing expression vector into the rice to be edited to obtain disease-resistant, high-quality, and stress-resistant rice.

[0007] Preferably, in step S1, the guided editing expression vector includes: a fusion protein expression cassette and a tandem pegRNA polycistronic expression cassette; The tandem pegRNA polycistronic expression cassette, from 5' to 3', sequentially includes: a promoter, a Csy4RS recognition sequence, and a target... OsBADH2 pegRNA1 coding region of the gene, Csy4RS recognition sequence, target OsSSIIa pegRNA2 coding region of the gene, Csy4RS recognition sequence, target OsTT2 pegRNA3 coding region of the gene, Csy4RS recognition sequence, target OsSdr4 The gene's pegRNA4 coding region, Csy4RS recognition sequence, and transcription termination element.

[0008] Preferably, the Csy4RS identification sequence is as shown in SEQ ID NO:20, specifically: GTTCACTGCCGTATAGGCAG; The promoter includes: OsU6 promoter; The transcription termination element includes: HSP18.2 Gene transcription terminator.

[0009] Preferably, the pegRNA1 includes: the spacer1 sequence as shown in SEQ ID NO:1, the RTT1 sequence as shown in SEQ ID NO:2, and the PBS1 sequence as shown in SEQ ID NO:3; The pegRNA2 includes: pegRNA2-1 and pegRNA2-2; The pegRNA2-1 includes: the spacer2-1 sequence as shown in SEQ ID NO:4, the RTT2-1 sequence as shown in SEQ ID NO:5, and the PBS2-1 sequence as shown in GGCCGGCA; The pegRNA2-2 includes: the spacer2-2 sequence as shown in SEQ ID NO:6, the RTT2-2 sequence as shown in SEQ ID NO:7, and the PBS2-2 sequence as shown in CCAGCTCTC; The pegRNA3 includes: the spacer3 sequence as shown in SEQ ID NO:8, the RTT3 sequence as shown in SEQ ID NO:9, and the PBS3 sequence as shown in SEQ ID NO:10; The pegRNA4 includes: pegRNA4-1 and pegRNA4-2; The pegRNA4-1 includes: the spacer4-1 sequence shown in SEQ ID NO:11, the RTT4-1 sequence shown in SEQ ID NO:12, and the PBS4-1 sequence shown in TGACGGC; The pegRNA4-2 includes: the spacer4-2 sequence as shown in SEQ ID NO:13, the RTT4-2 sequence as shown in SEQ ID NO:14, and the PBS4-2 sequence as shown in AGCCAGCC.

[0010] Preferably, the knockout editing expression vector includes: an sgRNA expression cassette and a Cas9 expression cassette; The sgRNA expression cassette, from 5' to 3', contains: a promoter, Gly-tRNA, and a target RNA. OsXa13 The sgRNA1 coding region of the gene, Gly-tRNA, and target OsXa13 The sgRNA2 coding region and transcription termination element of the gene.

[0011] Preferably, the Gly-tRNA is as shown in SEQ ID NO:21; The promoter includes: OsU6 promoter; The transcription termination element includes: HSP18.2 Gene transcription terminator.

[0012] Preferably, the nucleotide sequence of the sgRNA1 is shown in SEQ ID NO:15; The nucleotide sequence of the sgRNA2 is shown in SEQ ID NO:16.

[0013] Preferably, the nucleotide sequence of the guided editing expression vector is shown in SEQ ID NO:17; The nucleotide sequence of the knockout editing expression vector is shown in SEQ ID NO:18.

[0014] The present invention provides the application of the method for directional creation of disease-resistant, high-quality and stress-resistant rice germplasm described in the above technical solution, wherein the application includes at least one of the following (1)-(5): (1) enhancing the aroma of rice; (2) reducing the amylose content of rice; (3) improving the resistance of rice to bacterial blight; (4) improving the high temperature resistance of rice; (5) improving the storage resistance of rice.

[0015] Beneficial effects: The engineered plant-guided editing (ePPE) system used in this invention has significantly improved editing efficiency in monocotyledonous plants such as rice through optimization of nuclear localization signal (NLS) and Cas9 enzyme (introducing R221K / N394K mutation).

[0016] This invention utilizes rice OsBADH2 Gene, OsSSIIa Gene, OsXa13 Gene, OsTT2 Genes and OsSdr4Gene editing is performed by flexibly employing two complementary gene editing strategies: classic CRISPR / Cas9 knockout is used for disease-susceptible genes that require loss of function, while guided editing is used to achieve precise modification at single-base resolution for functional sites that require fine regulation. This enables synergistic improvement of multiple genes and traits, which can be used to enhance rice aroma, reduce rice amylose content, improve rice resistance to bacterial blight, improve rice heat tolerance, and improve rice storage tolerance. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 The plasmid map of OsePEmax-OsBADH2&OsSSIIa&OsTT2&OsSdr4 provided by this invention. Detailed Implementation

[0019] Unless otherwise specified, all reagents, instruments, or biological materials used in this invention are commercially available.

[0020] The present invention OsBADH2 The present invention OsSSIIa

[0021] The present invention OsXa13

[0022] The present invention OsTT2

[0023] The present invention OsSdr4

[0024] To further illustrate the present invention, the solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0025] Example 1 Retrieve rice from the NCBI database website OsBADH2 Gene (LOC_Os08g32870) OsSSIIa Gene (LOC_Os06g12450) OsXa13 Gene (LOC_Os08g42350) OsTT2 Gene (LOC9269602) and OsSdr4 The gene (LOC_Os07g39700) sequence was used, and pegRNA / sgRNA was designed based on the above target gene to guide the editing target site ( OsBADH2 Gene, OsSSIIa Gene, OsTT2 Genes and OsSdr4 Genes): Using professional design software such as PrimeDesign or CRISPR-P 2.0 (PE module), 4-6 candidate pegRNAs are designed for each gene, including spacer sequence, sgRNA backbone, PBS and RTT.

[0026] After verification of editing activity, the pegRNA / sgRNA information of different target genes was finally determined as shown in Table 1 (in Table 1, lowercase letters in a sequence indicate the specific location of the change).

[0027] Table 1. pegRNA / sgRNA information for different target genes

[0028] 1. Vector system selection (using two independent but compatible expression modules) (1) Guided Editor (PE) Module The engineered plant-guided editing (ePPE) system developed by Professor Zong Yuan's research group at China Agricultural University was used, and the ePPEmax vector was selected. This vector is mediated by rearranged double SV40 NLS and c-Myc NLS for nuclear localization, and R221K / N394K double mutations were introduced into SpCas9 H840A to enhance DNA binding and cleavage activity, thereby significantly improving editing efficiency.

[0029] (2) CRISPR / Cas9 knockout module To target OsXa13, the pYLCRISPR / Cas9 binary vector system developed by Professor Liu Yaoguang's research group at South China Agricultural University was used. The pYLCRISPR / Cas9Pubi-H vector was selected, and SpCas9 protein expression was driven by the maize ubiquitin promoter pUbi. Hygromycin resistance genes were used for screening.

[0030] 2. Construction of multi-target expression boxes For guided editing targets: A Csy4RS-pegRNA polycistronic tandem strategy is employed, with multiple pegRNA coding sequences cis-tandemly linked using Csy4RS sequences as spacers, driven by a single promoter for full-length polycistronic transcription. The transcription product is then cleaved by the Csy4 endonuclease co-expressed in the vector, releasing multiple independent mature pegRNAs for multi-target co-expression. Simultaneously, the Csy4RS hairpin structure retained at the 3' end of the pegRNA after cleavage prevents pegRNA circularization, further improving guided editing efficiency. The element arrangement of a single pegRNA coding unit is: [Csy4RS] - [Spacer] - [gRNA scaffold] - [RTT] - [PBS]; the corresponding plasmid map is shown below. Figure 1 .

[0031] The Golden Gate cloning method was used, and multiple sgRNA / pegRNA fragments were sequentially tandemly by digestion with BsaI and ligation with T4 ligase. Using Csy4RS to tandem different gRNAs effectively avoids homologous recombination between sgRNA expression cassettes in the plant genome, improving the stability of multi-target vectors.

[0032] For the knockout target: The two sgRNA expression cassettes of OsXa13 (both driven by a single OsU6 promoter and tandemly linked by tGly) were assembled into the pYLCRISPR / Cas9 vector backbone via the Golden Gate.

[0033] 3. Vector transformation and validation The ligation product was transformed into Escherichia coli DH5α strain and plated on LB agar containing kanamycin. Single colonies were picked for PCR amplification and sequencing verification. Positive clones with completely correct sequences were screened, and plasmids were extracted and stored at -20℃ for later use.

[0034] Finally, the prime editing expression vector with the nucleotide sequence shown in SEQ ID NO: 17 is obtained, which is specifically as follows: 5’-ATGGAGTCAAAGATTCAAATAGAGGACCTAACAGAACTCGCCGTAAAGACTGGCGAACAGTTCATACAGAGTCTCTTACGACTCAATGACAAGAAGAAAATCTTCGTCAACATGGTGGAGCACGACACACTTGTCTACTCCAAAAATATCAAAGATACAGTCTCAGAAGACCAAAGGGCAATTGAGACTTTTCAACAAAGGGTAATATCCGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTTATTGTGAAGATAGTGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGAT TGGCAGACATACTGTCCCACAA ATGAAGATGGAATCTGTAAAAGAAAACGCGTGAAATAATGCGTCTGACAAAGGTTAGGTCGGCTGCCTTTAATCAA TACCAAAGTGGTCCCTACCACGATGGAAAAACTGTGCAGTCGGTTTGGCTTTTTCTGACGAACAAATAAGATTCGT GGCCGACAGGTGGGGGTCCACCATGTGAAGGCATCTTCAGACTCCAATAATGGAGCAATGACGTAAGGGCTTACGA AATAAGTAAGGGTAGTTTGGGAAATGTCCACTCACCCGTCAGTCTATAAATACTTAGCCCCTCCCTCATTGTTAAG GGAGCAAAATCTCAGAGAGATAGTCCTAGAGAGAGAAAGAGAGCAAGTAGCCTAGAAGTAGTCAAGGCGGCGAAGT ATTCAGGCACGTGGCCAGGAAGAAGAAAAGCCAAGACGACGAAAACAGGTAAGAGCTAAGC ATCTAGGT AAGTTGA AAACAATCTTCAAAAGTCCCACATCGCTTAGATAAGAAAACGAAGCTGAGTTTATATACAGCTAGAGTCGAAGTAG TGATT GTTCACTGCCGTATAGGCAGgggatgtgtatttctactgcGTTTCAGAGCTATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCGGAGCTACCTTttgTGTTGCCATgAGcAaAGGATgGTTCCTGCAgtagaaatacacCGAGGAAG CGCGGTTCTATCTAGTTACGCGTTAAACCAACT AGAA GTTCACTGCCGTATAGGCAGAGTACAAGGAGAGCTGGAGGGTTTCAGAGCTATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCGCGCACCTGGAaCCCCCTCCAGCTCTCCGAGGAAGCGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAA GTTCACTGCCGTATAGGCAGaggcctcacgccgtcacgcgGTTTCAGAGCTATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCtggcgGTAAGCGCTTACGTAAGCGCTTACGTAAGCGCTTACtgccccgcgtgacggcCGAGGAAG CGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAA GTTCACTGCCGTATAGGCAGgttccgccgcggtcactggcGTTTCAGAGCTATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCccgtcacgcggggcaGTAAGCGCTTACGTAAGCGCTTACGTAAGCGCTTACcgccagccagccAATTTCTC CGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAA GTTCACTGCCGTATAGGCAGGGATCCACGCTGCCTCCAGAGTTTCAGAGCTATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTACTCTCTtCAaCAcCTGGAGGCAGCGTACAAATAA CGCGGTTCT ATTCTAGTTACGCGTTAAACCAACTAGAA GTTCACTGCCGTATAGGCAGTTTTTTTT GATATCTCCGGGGCTAATTG AATATGAAGAATGAAGAAATATTTGGTGTGTCAAATAAAAAGCTGGTGTGCTTAAGTTTGTGTTTTTTTCTTGG CTTGTTGTGTTATGAATTTGTGGCTTTTTCTAATATTAAATGAATGTAAGATCTCATTATAATGAATAAACAAATG TTTCTATAATCCATTGTGAATGTTTTGTTGGATCTCTTCTGCAGCATATAACTACTGTATGTGCTATGGTATGGAC TATGGAATATGATTAAAGATAA -3'.

[0035] In SEQ ID NO:17 above, the bold sequence represents the 35s enhancer; the single underline sequence represents the CmYLCV constitutive promoter; the double underline and italic sequence represents the OsU6 promoter; and the wavy line sequence represents... HSP18.2 Gene transcription terminator; the bolded and wavy line sequence represents the tevopreQ1 sequence.

[0036] The nucleotide sequence of the knockout editing expression vector is as shown in SEQ ID NO:18, specifically as follows: 5'- GGATCATGA ACCAACGGCCTGGCTGTATTTGGTGGTTGTGTAGGGAGATGGGGAGAAGAAGCCCCGATTCTCTTCGCTGGTGATG GGCTGGATGCATGCGGGGGAGCGGGAGGCCCAAGTACGTGCACGGTGAGCGGCCCACAGGGCGAGTGTGAGCGCGA GAGGCGGGAGGAACAGTTTAGTACCACATTGCCCAGCTAACTCGAACGCGACCAACTTATAAACCCGCGCGCTGTC GCTTGTGAACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCATCCCTCTACCGGCCATCGTG GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCA ACTTGAAAAAGTGGCACCGAGTCGGTGC AACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCACGACAACCGCAACAACTCGT GTTTAGAGCTAGAAATAGCAAGTTAA AATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC TTTTTTTT GATATCTCCGGGGCTAATT GAATATGAAGATGAAGATGAAATATTTGGTGTGTCAAATAAAAAGCTGGTGTGCTTAAGTTTGTGTTTTTTTCTTG GCTTGTTGTGTTATGAATTTGTGGCTTTTTCTAATATTAAATGAATGTAAGATCTCATTATAATGAATAAACAAAT GTTTCTATAATCCATTGTGAATGTTTTGTTGGATCTCTTCTGCAGCATATAACTACTGTATGTGCTATGGTATGGA CTATGGAATTGATTAAAGATAA -3'; In SEQ ID NO:18 above, the bolded sequence represents Gly-tRNA (SEQ ID NO:21); the italicized sequence represents the OsU6 promoter; and the wavy line sequence represents... HSP18.2 Gene transcription terminator; double-underlined sequence indicates gRNAscaffold.

[0037] 4. Agrobacterium-mediated genetic transformation of rice The genetic transformation process in this experiment mainly referenced the "rapid transformation method for rice" optimized by Professor Chen Hao's research group at Huazhong Agricultural University, as well as related research on indica rice transformation (Reference 1: Cui Ying, Cai Zhaoxia, Lin Yongjun, Chen Hao. (2018). Agrobacterium-mediated rapid transformation of rice. Bio-101 e1010176. Doi:10.21769 / BioProtoc.1010176.), (Reference 2: Liu Yu, Ling Fei, Lin Yongjun, Chen Hao. (2018). Agrobacterium-mediated genetic transformation of indica rice. Bio-101 e1010175. Doi:10.21769 / BioProtoc.1010175.), which significantly shortened the transformation cycle.

[0038] Specific cultivation process and parameters: 1) Preparation of recipient material: Select plump and healthy Nipponbare japonica rice seeds, using mature embryos as starting material.

[0039] 2) Callus induction: Remove the seed coat, disinfect with 75% alcohol for 1 minute, soak in 0.15% HgCl2 (containing 0.1% Tween) for 15-18 minutes, and rinse 5 times with sterile water. Inoculate the disinfected seeds onto the induction medium: N6max + N6min + Fe-EDTA + 2 mg / L 2,4-D + 0.5 g / L hydrolyzed casein + 30 g / L sucrose + 8 g / L agar, pH 5.8. Culture parameters: 32°C, 24 h light for 10 days.

[0040] 3) Agrobacterium infection and co-culture: Activated Agrobacterium (carrying the target vector; the target vector includes the guide editing expression vector shown in SEQ ID NO:17 and the knockout editing expression vector shown in SEQ ID NO:18, with a volume ratio of 1:1) was cultured with shaking in suspension medium (induction medium + 10 g / L glucose + 20 mg / L AS, pH 5.2) until OD. 600 =0.1-0.2. Place the callus tissue induced for 10 days into the bacterial solution and infect for 5-10 minutes. After aspirating the bacterial solution, transfer the callus to a co-culture medium (induction medium + 10 g / L glucose + 20 mg / L AS + 3 g / L Phytagel, pH 5.2) and cover the surface with sterile filter paper. Culture parameters: incubate overnight in the dark at 20°C, then transfer to 25°C for another 2 days in the dark.

[0041] 4) Resistance screening and regeneration: After co-culturing, the callus was washed with sterile water containing 500 mg / L carbenicillin (Cn), sterilized, and then dried. It was then transferred to screening medium (induction medium + 50 mg / L hygromycin + 300 mg / L Cn, pH 5.8). Culture parameters: 32°C, under light for 14 days, with fresh medium replaced once during this period.

[0042] The resistant callus was transferred to differentiation medium (MSmax + MSmin + Fe-EDTA + 2 mg / L 6-BA + 0.2 mg / L NAA + 1 g / L hydrolyzed casein + 30 g / L sucrose + 8 g / L agar, pH 5.8) and cultured at 28°C with a photoperiod of 14 h light / 10 h dark. When the regenerated seedlings grew to 3-4 cm, they were transferred to rooting medium (1 / 2 MSmax + 1 / 2 MSmin + Fe-EDTA + 15 g / L sucrose + 8 g / L agar, pH 5.8) to obtain complete plants.

[0043] 5. Molecular identification and phenotypic evaluation of edited strains 1) Multiplex PCR was performed on T0 generation plants to differentiate between edited and wild-type, and homozygous and heterozygous states based on band size and presence. Predicted potential off-target sites were sequenced to assess off-target risk. Computer prediction combined with experimental verification ensured no significant off-target events. For guide editing targets, the similarity between the pegRNA spacer sequence and the rice genome was examined; for knockout targets, potential off-target sites of sgRNA were investigated. The editing effects of each target gene are shown in Table 2.

[0044] Table 2 Editing efficiency of different target genes

[0045] Based on the data in Table 2, stable and precise editing was achieved at each PE target site, and high knockout efficiency was achieved at the Cas9 target site. No significant off-target events were detected at the predicted high-risk off-target sites. After co-transformation with Agrobacterium, 49 resistant regenerated T0 seedlings were obtained. Further targeted sequencing of positive plants confirmed the editing type, distinguishing between two types of mutations: precise PE modification and Cas9 frameshift knockout.

[0046] 2) Phenotypic identification and aggregation of desirable traits Representative lines with different editing combinations were screened from T0 generation edit-positive plants, and stable T1 generation progeny were obtained through self-pollination for phenotypic analysis. Using wild-type rice Nipponbare as the control (WT), the following representative lines were selected: L1, which was the first to develop... OsBADH2 and OsXa13 Double gene-edited line; L2, for occurrence OsBADH2 , OsXa13 and OsSSIIa Three gene-edited lines; L3, for which occurrence OsBADH2 , OsSSIIa , OsXa13 , OsTT2 and OsSdr4 Five-gene aggregation editing lines were established. The traits of WT, L1, L2, and L3 plants were examined, and the results are shown in Table 3.

[0047] The systematic phenotypic identification of T0 and T1 generation plants is as follows: Aroma trait: 2-acetyl-1-pyrrolidone content (2-AP) was determined by GC-MS; Resistance to bacterial blight: the length of lesions was measured after artificial inoculation to assess the resistance level; Rice quality: the amylose content was determined by the iodine colorimetric method; High-temperature seed setting rate was calculated by statistically analyzing the seed setting rate after high-temperature stress during the flowering period; Storage tolerance was determined by measuring the germination rate after artificial accelerated aging treatment.

[0048] Table 3. Characteristics of different treatments

[0049] Based on the data in Table 3, the technical solution provided in this application simultaneously affects rice. OsBADH2 Gene, OsSSIIa Gene, OsXa13 Gene, OsTT2 Genes and OsSdr4 After gene editing, disease-resistant, high-quality, and stress-resistant rice can be obtained. Currently, single editing methods can only improve 1-2 traits, while this application differentiates and combines PE+Cas9 knockout vectors to aggregate five major breeding advantages traits in one go, solving the technical shortcomings of traditional editing that can only improve single traits and has a long cycle for multi-gene aggregation, resulting in outstanding technical effects.

[0050] Therefore, OsBADH2 The gene was edited to achieve site-specific substitutions at two amino acid sites, Y163H and W170Q. OsSSIIa The gene was edited to achieve site-specific substitution of the L781F amino acid site; OsTT2 Genes can achieve site-specific substitution at the C165A amino acid site through guided editing; OsSdr4 The gene was inserted at a specific site within the region 50-200 bp upstream of the translation start codon ATG by guided editing; the enhancer sequence shown in SEQ ID NO:19 was inserted. OsXa13 Genes are knocked out by insertion / deletion mutations in the coding region via CRISPR / Cas9, resulting in frameshifts or premature termination of the reading frame. These different types of editing correspond to improvements in aroma, amylose content, resistance to bacterial blight, heat tolerance, and storage stability. Therefore, this application enables precise editing of target genes with low off-target risk, yielding homozygous superior lines with excellent phenotypes and complete trait aggregation, providing scientific guidance for improving core parents and rice breeding.

[0051] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A method for the targeted creation of disease-resistant, high-quality, and stress-resistant rice germplasm based on CRISPR / Cas9 multi-target precise editing, characterized in that, Includes the following steps: S1. Construct the guided editing expression carrier and the knockout editing expression carrier respectively; The target genes used for editing by the guided editing expression vector include: OsBADH2 Gene, OsSSIIa Gene, OsTT2 Genes and OsSdr4 Gene; The target genes used to edit by the knockout editing expression vector include: OsXa13 Gene; The nucleotide sequence of the guided editing expression vector is shown in SEQ ID NO:17; The nucleotide sequence of the knockout editing expression vector is shown in SEQ ID NO:18; S2. The guided editing expression vector and the knockout editing expression vector are introduced into the rice to be edited to obtain disease-resistant, high-quality and stress-resistant rice. The editing includes: (1) Targeting OsBADH2 The Y163H and W170Q loci of the gene are about to be... OsBADH2 The codon encoding tyrosine (Y) at position 163 in the gene is mutated to encode histidine (H), and the codon encoding tryptophan (W) at position 170 is mutated to encode glutamine (Q), thus achieving... OsBADH2 Gene editing; (2) Targeting OsSSIIa The L781F site of the gene is about to OsSSIIa The codon encoding leucine (L) at position 781 in the gene is mutated to encode phenylalanine (F), thus achieving... OsSSIIa Gene editing; (3) Knock out the coding region of the OsXa13 gene; (4) Targeting the C165A site of the OsTT2 gene, which is about to OsTT2 The codon encoding cysteine ​​(C) at position 165 in the gene is mutated to encode alanine (A), thus achieving... OsTT2 Gene editing; (5) The enhancer sequence shown in SEQ ID NO:19 was inserted into rice at a specific site. OsSdr4 The gene translation start codon is located 50-200 bp upstream of the ATG codon. The OsBADH2 Gene, OsSSIIa Gene, OsXa13 Gene, OsTT2 Genes and OsSdr4 The nucleotide sequences of the gene correspond to SEQ ID NO:22, 23, 24, 25 and 26 respectively; The disease-resistant, high-quality, and stress-resistant traits are: enhanced rice aroma, reduced rice amylose content, improved rice resistance to bacterial blight, improved rice high-temperature resistance, and improved rice storage resistance.

2. The application of the method for targeted creation of disease-resistant, high-quality, and stress-resistant rice germplasm as described in claim 1, characterized in that, The application is any one of the following (1)-(5): (1) Enhances the aroma of rice; (2) Reduce the amylose content in rice; (3) Improve the resistance of rice to bacterial blight; (4) Improve the high-temperature resistance of rice; (5) Improve the storage resistance of rice.

Images