A nucleic acid detection kit and method for simultaneously identifying brucella virulent strains and vaccine strains

Abstract

The application discloses a nucleic acid detection kit and method for simultaneously identifying Brucella virulent strains and vaccine strains, wherein the Brucella virulent strains are bovine Brucella (B. Brucella abortus ), ovine Brucella (B. Brucella melitensis ) and porcine Brucella (B. Brucella suis ) virulent strains; the vaccine strains are A19 vaccine strains and S2 vaccine strains; the kit comprises five groups of specific primer pairs and corresponding detection probes, and target genes are ASU (bovine specific), ADZ (ovine specific), WZP (porcine specific), CP (conserved in bovine, ovine and porcine, A19 deletion gene) and WP (conserved in bovine, ovine and porcine, S2 deletion gene). Whether a sample with a known immune background is infected with a Brucella wild strain can be determined, and typing can be performed; for a sample with an unknown immune background, whether the sample is infected with a Brucella wild strain can be determined through double-tube quadruple fluorescence quantitative PCR detection. The experimental period is shortened, and the detection efficiency is improved.

Description

Technical Field

[0001] This invention relates to the field of biological detection technology, specifically to a nucleic acid detection kit and method for simultaneously identifying virulent Brucella strains and vaccine strains. Background Technology

[0002] Brucella is a Gram-negative bacterium belonging to the genus Brucella. It is the pathogen that causes brucellosis, a zoonotic infectious disease, and is classified as a Class B infectious disease in my country. The genus Brucella currently comprises 10 species, including Brucella bovis (…). Brucella.abortus ), Brucella mesenteriae ( Brucella.melitensis ), swine brucellosis ( Brucella.suis ), canine brucellosis ( Brucella.canis Brucella epididymis of sheep ( Brucella.ovis ), desert forest rodent species Brucella ( Brucella.neotomae) Brucella aureus (Vol. spp.) Brucella.microti ), Brucella cetacea ( Brucella.ceti (isolated from whales and dolphins), pinniped Brucella ( Brucella.pinnipedialis (isolated from pinnipeds) and Brucella australis ( Brucella.inopinata (isolated from patients). Among them, the first three types are relatively widespread and can infect humans, seriously affecting the development of animal husbandry and human health in my country.

[0003] The diagnosis of brucellosis relies on routine serological testing and bacterial culture isolation, which is considered the "gold standard" for brucellosis diagnosis. Brucellosis is a zoonotic infectious disease. Etiological testing requires a high level of environmental and laboratory safety, necessitating a biosafety level 3 laboratory. Furthermore, bacteriological methods are time-consuming and dangerous, potentially causing infection among laboratory personnel and serious consequences, thus limiting their application. Currently, laboratories primarily use serological testing, but this technology is not perfect, lacking in sensitivity and specificity. The sensitivity of serological tests ranges from 65% to 95%. The main limitation of serological techniques is their low specificity, due to serological cross-reactivity, particularly between Brucella and Yersinia enterocolitica. In addition, molecular biological diagnostics are also commonly used to diagnose brucellosis. Routine PCR, real-time quantitative PCR, and loop-mediated isothermal amplification assay (LAMP)-PCR have been introduced as rapid diagnostic tools. Multiplex PCR has become a universal technique, capable of simultaneously amplifying multiple sites of one or more different genes. As costs and procedures become increasingly affordable and simple, molecular techniques are being used more and more for rapid microbial diagnostics. Due to their high sensitivity, molecular diagnostics has now become a useful tool for diagnosing many viral, bacterial, and fungal infections. Therefore, providing a detection method that can determine the presence of Brucella wild-type infection, perform typing, shorten experimental cycles, and improve detection efficiency has become a research topic we need to study. Summary of the Invention

[0004] To address the aforementioned technical problems, the first objective of this invention is to provide a nucleic acid detection kit for simultaneously identifying virulent and vaccine strains of Brucella. The second objective is to provide a detection method. This invention can determine whether samples with a known immune background are infected with wild-type Brucella strains and can perform typing. For samples with an unknown immune background, the presence of wild-type Brucella strains can be detected using dual-tube quadruple real-time PCR. This shortens the experimental cycle, improves detection efficiency, and provides a powerful tool for timely detection and diagnosis of Brucella strains.

[0005] To achieve the first objective mentioned above, the present invention provides the following technical solution: a nucleic acid detection kit for simultaneously identifying virulent Brucella strains and vaccine strains, characterized in that: the virulent Brucella strain is Brucella bovis (… Brucella.abortus ), Brucella mesenteriae ( Brucella.melitensis ), swine brucellosis ( Brucella.suis The virulence strains; the vaccine strains are A19 vaccine strain and S2 vaccine strain.

[0006] The kit includes 5 sets of specific primer pairs and corresponding detection probes, with target genes ASU (bovine specific), ADZ (sheep specific), WZP (swine specific), CP (A19 deletion gene), and WP (S2 deletion gene).

[0007] The nucleotide sequences of each primer are as follows:

[0008] ASU upstream F ASU For example, SEQ ID NO.1; ASU downstream R ASU For example, SEQ ID NO.2;

[0009] ADZ upstream F ADZ For example, SEQ ID NO.3; ADZ downstream R ADZ For example, SEQ ID NO.4;

[0010] WZP upstream F WZP For example, SEQ ID NO.5; WZP downstream R WZP For example, SEQ ID NO.6;

[0011] CP upstream F CP For example, SEQ ID NO.7; CP downstream R CP For example, SEQ ID NO.8;

[0012] WP upstream F WP For example, SEQ ID NO.9; WPT downstream R WP For example, SEQ ID NO.10;

[0013] The corresponding probe nucleotide sequences are as follows:

[0014] ASU probe P ASU For example, SEQ ID NO.11; ADZ probe P ADZ For example, SEQ ID NO.12;

[0015] WZP probe P WZP For example, SEQ ID NO.13; CP probe P CP For example, SEQ ID NO.14;

[0016] WP probe P WP For example, SEQ ID NO.15; each probe nucleotide sequence is labeled with a fluorescent reporter group and a fluorescent quencher group.

[0017] In the above scheme: the fluorescent reporter group labeled at the 5' end of the ASU probe is the FAM fluorescent group, and the fluorescent quencher group labeled at the 3' end is the MGB group.

[0018] In the above scheme: the fluorescent reporter group labeled at the 5' end of the ADZ probe is the VIC fluorescent group, and the fluorescent quencher group labeled at the 3' end is the MGB group.

[0019] In the above scheme: the fluorescent reporter group labeled at the 5' end of the WZP probe is an NED fluorescent group, and the fluorescent quencher group labeled at the 3' end is an MGB group.

[0020] In the above scheme: the fluorescent reporter group labeled at the 5' end of the CP probe is the ROX fluorescent group, and the fluorescent quencher group labeled at the 3' end is the MGB fluorescent group.

[0021] In the above scheme: the fluorescent reporter group labeled at the ' end of the WP probe is the ROX fluorescent group, and the fluorescent quencher group labeled at the 3' end is the MGB fluorescent group.

[0022] In the above scheme: the kit also includes positive control standards and negative control standards; the positive control standards are recombinant plasmids carrying the ASU, ADZ, WZP, CP, and WP genes respectively; the negative control standards are solutions free of Brucella or its nucleic acid. The negative control is one of sterile water (ddH2O) or physiological saline.

[0023] The kit of this invention combines A19 deletion region detection primers or S2 deletion region detection primers with bovine, ovine, and swine Brucella detection primers to form two quadruple fluorescent PCR technologies. It can simultaneously detect bovine, ovine, and swine Brucella and differentiate vaccine strains in a single tube. Based on the amplification and detection results, it can analyze and determine whether there is Brucella wild-type infection and accurately type the infected Brucella.

[0024] Since the kit described in this invention uses multiplex fluorescent PCR technology for detection, it can also include other common PCR reagents, such as dNTPs, MgCl2, PCR buffer, Taq DNA polymerase, and sterile water (ddH2O). These commonly used PCR reagents can be purchased individually from the market or prepared in-house. Therefore, the specific reagents to be included in the kit can be configured according to the customer's actual needs; for convenience, all reagents can also be included in the kit.

[0025] In the above scheme: the kit contains two sets of quadruple qPCR reaction system reagents, namely the A19 immune background quadruple reaction system and the S2 immune background quadruple reaction system. Specifically, the A19 immune background contains primer and probe combinations of bovine, ovine, and swine Brucella specific genes and A19 deletion regions, and the S2 immune background contains primer and probe combinations of bovine, ovine, and swine Brucella specific genes and S2 deletion regions. Each of the above primer pairs and probes can also be packaged and used individually. In other words, the kit of the present invention can contain the above-mentioned individually packaged primer pairs and probes.

[0026] The PCR reaction system can be prepared by the user or obtained by adding the primers and probes of this invention directly to a commercially available universal PCR reaction solution that does not contain primers and probes. For example:

[0027] Components and dosage of the A19 immune background quadruple reaction system:

[0028] 2×T5 Fast qPCR Mix (Probe): 10μL;

[0029] 10 μmol / LF ASU R ASU 0.4 μL each, 10 μmol / L ASU 0.2μL;

[0030] 10 μmol / LF ADZ R ADZ 0.6 μL each, 10 μmol / L ADZ 0.2μL;

[0031] 10 μmol / LF WZP R WZP 0.8 μL each, 10 μmol / L WZP 0.2μL;

[0032] 10 μmol / LF CP R CP 0.4 μL each, 10 μmol / L CP 0.3μL;

[0033] DNA template: 2 μL;

[0034] Add sterile water (ddH2O) to a final volume of 20 μL.

[0035] Components and dosage of the S2 immune background quadruple reaction system:

[0036] 2×T5 Fast qPCR Mix (Probe): 10μL;

[0037] 10 μmol / LF ASU R ASU 0.4 μL each, 10 μmol / L ASU 0.2μL;

[0038] 10 μmol / LF ADZ R ADZ 0.6 μL each, 10 μmol / L ADZ 0.2μL;

[0039] 10 μmol / LF WZP R WZP 0.8 μL each, 10 μmol / L WZP 0.2μL;

[0040] 10 μmol / LF WP R WP 0.4 μL each, 10 μmol / L WP 0.3μL;

[0041] DNA template: 2 μL;

[0042] Add sterile water (ddH2O) to a final volume of 20 μL.

[0043] The second objective of this invention is achieved as follows: a quadruple TaqMan real-time quantitative qPCR detection method for simultaneously identifying virulent Brucella strains and vaccine strains, characterized by comprising the following steps:

[0044] (1) Extract genomic DNA from the sample as a template;

[0045] (2) Sample addition: Add the sample genomic DNA, positive control or negative control to the PCR tube containing the PCR reaction system to obtain the corresponding sample reaction tube, positive reaction tube and negative reaction tube. The PCR reaction system contains the 5 sets of specific primer pairs and corresponding detection probes.

[0046] (3) PCR reaction: The reaction tubes were placed on a fluorescent PCR instrument to carry out the PCR reaction;

[0047] (4) After the PCR reaction is completed, analyze the results.

[0048] Beneficial Effects: This invention employs a quadruple fluorescent PCR detection kit, designing primers and probes for detecting *Brucella bovis*, *Brucella ovis*, *Brucella swine*, the A19 deletion region, and the S2 deletion region. These are combined to form two single-tube quadruple fluorescent PCR kits: one for *Brucella bovis*, *Brucella ovis*, and *Brucella swine* with an A19 immune background, and the other for *Brucella bovis* with an S2 immune background, both containing the same primers and probes. Single-tube quadruple quantitative PCR can determine the presence of wild-type *Brucella* in samples with known immune backgrounds and can perform genotyping. For samples with unknown immune backgrounds, dual-tube quadruple quantitative PCR can detect wild-type *Brucella swine* infection. This shortens the experimental cycle, improves detection efficiency, and provides a powerful tool for timely detection and diagnosis of *Brucella* types.

[0049] The fluorescent PCR detection kit used in this invention features high sensitivity, low detection limit, and good specificity. The primers and probes used are designed based on Brucella nucleic acid sequences from the NCBI GenBank public database, ensuring high specificity and ease of operation. Results can be obtained within 3 hours without additional processing of the PCR products. PCR amplification and fluorescence detection are performed in the same reaction tube in a completely closed system, significantly reducing the risk of cross-contamination between samples and environmental pollution. Various types of samples can be directly detected without the need for enrichment culture. Attached Figure Description

[0050] Figure 1 This is a standard curve for quadruple qPCR.

[0051] Figure 2A The results show the sensitivity of quadruple qPCR in the A19 immune background system.

[0052] Figure 2B The results show the sensitivity of quadruple qPCR in the A19 immune background system.

[0053] Figure 2C The results show the sensitivity of quadruple qPCR in the A19 immune background system.

[0054] Figure 2D The results show the sensitivity of quadruple qPCR in the A19 immune background system.

[0055] Figure 3A The results show the sensitivity of quadruple qPCR in the S2 immune background system.

[0056] Figure 3B The results show the sensitivity of quadruple qPCR in the S2 immune background system.

[0057] Figure 3C The results show the sensitivity of quadruple qPCR in the S2 immune background system.

[0058] Figure 3D The results show the sensitivity of quadruple qPCR in the S2 immune background system.

[0059] Figure 4A The results are from a quadruple qPCR specific detection of the A19 immune background system.

[0060] Figure 4B The results are from a quadruple qPCR specific detection of the A19 immune background system.

[0061] Figure 4C The results are from a quadruple qPCR specific detection of the A19 immune background system.

[0062] Figure 4D The results are from a quadruple qPCR specific detection of the A19 immune background system.

[0063] Figure 4E The results are from a quadruple qPCR specific detection of the A19 immune background system.

[0064] Figure 4F The results are from a quadruple qPCR specific detection of the A19 immune background system.

[0065] Figure 5A The results are specific to the quadruple qPCR in the S2 immune background system.

[0066] Figure 5B The results are specific to the quadruple qPCR in the S2 immune background system.

[0067] Figure 5C The results are specific to the quadruple qPCR in the S2 immune background system.

[0068] Figure 5D The results are specific to the quadruple qPCR in the S2 immune background system.

[0069] Figure 5E The results are specific to the quadruple qPCR in the S2 immune background system.

[0070] Figure 5F The results are specific to the quadruple qPCR in the S2 immune background system.

[0071] Figure 6 Simulated samples were used to test the A19 immune background system.

[0072] Figure 7 Simulated samples were used to test the S2 immune background detection system. Detailed Implementation

[0073] The present invention will be further described below with reference to embodiments.

[0074] Example 1: Candidate gene screening and standard preparation

[0075] 1. Gene screening

[0076] Genome alignments of *Brucella abortus*, *Brucella melitensis*, and *Brucella suis* were performed to identify species-specific candidate genes. Virulent *Brucella abortus* strains were aligned with A19, and viulent *Brucella suis* strains with S2 to identify vaccine strain-specific deletion candidate genes. Nucleic acid BLAST alignments were performed on these candidate genes to analyze the conservation and specificity of the target genes across species. Species-specific regions were found only in specific *Brucella* subtypes, while vaccine deletion regions were common to all *Brucella* strains but were deleted only in vaccine strains.

[0077] Finally obtained B.abortusSpecific target sequence ASU gene (ID: ASU76746.1, abbreviated as ASU). B. melitensis The specific target sequence is the ADZ gene (ID: ADZ88906.1, abbreviated as ADZ). B.suis The specific target sequences are WZP gene (ID: WZP50733.1, abbreviated as WZP), A19-specific deletion target sequence CP gene (ID: CP033079.1, abbreviated as CP), and S2-specific deletion target sequence WP gene (ID: WP004687917.1, abbreviated as WP). The A19 vaccine strain is an attenuated strain of Brucella bovis, and the S2 vaccine strain is an attenuated strain of Brucella suis. CP is conserved in Brucella bovis, Brucella ovis, and Brucella suis, but is deleted in A19. WP is conserved in Brucella bovis, Brucella ovis, and Brucella suis, but is deleted in S2.

[0078] Based on the ASU, ADZ, WZP, CP, and WP nucleic acid sequence results, primers and probes for detecting Brucella bovis, Brucella ovis, Brucella swine, A19 deletion region, and S2 deletion region were designed and synthesized, respectively. Their nucleotide sequences are shown in Table 1 below:

[0079] Table 1

[0080]

[0081] 2. Preparation of recombinant T-vectors for target genes

[0082] Genomic DNA was extracted from each vaccine strain. Using the extracted genomic DNA as templates, the ASU, ADZ, and WZP specific genes and the vaccine strains' deleted CP and WP genes were amplified using designed specific primers (see Table 1 for upstream and downstream primers). The amplification reaction system is shown in Table 2.

[0083] Table 2 PCR amplification reaction system

[0084]

[0085] Reaction conditions: 94℃ for 300s; 94℃ for 60s, 55℃ for 10s, 72℃ for 10s, 35 cycles; 72℃ for 7min.

[0086] Nucleic acid gel electrophoresis was performed using a 3% agarose gel at a constant voltage of 50V to excise the agarose gel containing the target gene fragment. The PCR product was recovered using a DNA purification kit, and the obtained target gene fragment was stored at -20℃.

[0087] Escherichia coli DH5α competent cells were prepared using the CaCl2 method under low temperature conditions, aliquoted into 100 μL portions, and stored at -80°C for later use.

[0088] The gene fragments were ligated into pMD19-T cells using a ligation system consisting of 2 μL of the target gene, 0.5 μL of the pMD19-T cloning vector, and 2.5 μL of Solution I (Takara pMD19-T kit). Ligation was carried out at 16°C for 1 h. 5 μL of the recombinant ligation product was added to 100 μL of DH5α competent cells, gently mixed, and then placed on ice for 5 min. The cells were then heat-shocked at 42°C for 90 s and immediately placed on ice for 5 min. Subsequently, 900 μL of liquid LB medium was added, and the mixture was shaken at 250 rpm for 60 min at 37°C. The sample was then centrifuged at 4000 rpm for 3 min, 800 μL of supernatant was discarded, and the precipitate was resuspended in the remaining 200 μL of supernatant. The precipitate was plated on solid medium containing ampicillin (Amp) and incubated overnight at 37°C.

[0089] The inserted Brucella amplicon sequence is 164 bp in length, and its nucleotide sequence is shown in SEQ ID NO.16:

[0090] ATAATCTGGGTGATGCTTCGGGTGGGCTTGCCATTAATGGTGGCGCCACATTGCAGCTCACGGATAATTTGACCACGGCCCGGGGTGGTGACGCTTGGAGCGGGAACGGCCACCATCACGATCGATGGCGGCAAGACGGCGCAGTTCTCGAACAAGCTGACGGGC.

[0091] The inserted Brucella melitica amplicon sequence is 119 bp in length, and its nucleotide sequence is shown in SEQ ID NO.17:

[0092] AATATCGCATCGGCAGTTTCCAATGAAAAGGGCCTCGGCATGGCCCGCAATCTGGAAAAGGCCAAAAGCTGGTATCAGCTTGCCCGCAGATCAGGGCAATGCAAGCGCCATGCACAATCTT.

[0093] The inserted Brucella amplicon sequence is 168 bp in length, and its nucleotide sequence is shown in SEQ ID NO.18, specifically:

[0094] TCGATAAGGTCGATACGCCAGCCATTATAGAGATAGATTGCAAGCCCTGCAAAAAGCAGGAACCACACGCCGACAATGATATGGCCGGCTATCCGCGTTCGCGTCCATGTTTCACGACTGGCGGAGGAGCCATTATCTCGGCGGACGGATTGGAGGCGACTTGGTTC.

[0095] The amplicon sequence of the inserted A19 deletion region is 80 bp in length, and its nucleotide sequence is shown in SEQ ID NO.19, specifically:

[0096] TTGGAGCGTTTCCTGTCGATCTTGATAAGATCCACGCCCTTCGGTATTTTTTAAATTTATACAGAAGATATGGGAACCCG.

[0097] The inserted S2 deletion region amplicon sequence is 86 bp in length, and its nucleotide sequence is shown in SEQ ID NO.20:

[0098] TCGTCAGTTTCCAAGGTCGGCTCCCTCATAAATGGCTTTCTTCATATACGAACAGCGTAAAGGGTGAAAGGAATAACCACCCGCAA.

[0099] Colony PCR was performed on bacterial cultures containing the recombinant plasmids pMD19T-ASU and pMD19T-ADZ using ASU and ADZ gene primers. The target bands for pMD19T-ASU and pMD19T-ADZ were between 100 and 200 bp, consistent with the expected results.

[0100] Colony PCR was performed on bacterial cultures containing recombinant plasmids pMD19T-WZP, pMD19T-CP, and pMD19T-WP using primers for the WZP, CP, and WP genes. The target band for pMD19T-WZP was approximately 150 bp, while the target bands for pMD19T-CP and pMD19T-WP were less than 100 bp, consistent with the expected results.

[0101] Five recombinant plasmids, pMD19T-ASU, pMD19T-ADZ, pMD19T-WZP, pMD19T-CP, and pMD19T-WP, were extracted according to the recommended steps of the plasmid extraction kit, and the sequencing results were consistent with expectations.

[0102] Example 2: Establishment of a SYBR qPCR detection system for identifying B. melitensis, B. abortus, and B. suis

[0103] 1. Construction of the standard curve for target gene amplification in SYBR dye-based qPCR

[0104] Using the upstream and downstream primers in Table 1, the recombinant plasmid standards pMD19T-ASU, pMD19T-ADZ, pMD19T-WZP, pMD19T-CP, and pMD19T-WP were serially diluted 10-fold to obtain a concentration of 10. 7 Copy / μL~10 2 A recombinant plasmid of copy number / μL was used as a standard. qPCR was performed according to the recommended system of the SYBR kit, as detailed in Table 3. A negative control was set up using ddH2O as a template. After the reaction, the system automatically generated an amplification curve. A standard curve was constructed with Ct value on the ordinate and the copy number of the standard on the abscissa. The correlation coefficient R was required. 2 It should be greater than 0.99.

[0105] Table 3 qPCR amplification reaction system

[0106]

[0107] Reaction conditions: 95℃ for 300s, 95℃ for 10s, 55℃ for 10s, 72℃ for 10s, 40 cycles, melting cooling.

[0108] 2. Sensitivity detection of SYBR dye-based qPCR

[0109] The recombinant plasmid standards pMD19T-ASU, pMD19T-ADZ, pMD19T-WZP, pMD19T-CP, and pMD19T-WP were diluted to four concentrations: 100 copies / μL, 50 copies / μL, 20 copies / μL, and 10 copies / μL, respectively. Using the reaction system shown in Table 3, each concentration was tested in triplicate. A negative control was set up using ddH2O as a template, and a positive control was set up using the prepared standards as templates. A Ct value less than 35 was considered a positive signal. The limit of detection was defined as the lowest template concentration at which all replicates of the same concentration showed a positive signal.

[0110] 3. Specificity detection by SYBR dye method qPCR

[0111] Commonly found bacteria such as *Escherichia coli*, *Staphylococcus aureus*, *Salmonella* (similar to brucellosis symptoms), and *Yersinia enterocolitica* (highly similar to brucellosis in nucleic acid sequence) were used as negative reference strains. Genomes were extracted using a bacterial genome extraction kit and used as templates for specificity experiments. Genomes of *B. abortus* vaccine strain A19, *B. melitensis* M5-90, and *B. suis* vaccine strain S2 were used as typing templates. pMD19T-ASU, pMD19T-ADZ, pMD19T-WZP, pMD19T-CP, and pMD19T-WP standards were used as positive control templates, and ddH2O was used as a negative control template. qPCR experiments were performed, with a Ct value less than 35 indicating a positive result. Amplification results for each sample are shown in Table 4, with positive results indicated by "+" and negative results by "-".

[0112] Table 4 Reference Table for SYBR Test Results

[0113]

[0114] ASU positive standard at 5.8 × 10 7 Copy / μL ~ 5.8 × 10 2 Within the range of copies / µL, the copy number exhibits a good linear relationship with its corresponding Ct value, and the correlation coefficient Rt is [value missing]. 2 The slope was -3.5, the amplification efficiency was 93.055%, and the linear equation between copy number (X) and Ct value (Y) was: y = -3.5 lgx + 36.23. The detection limit of the ASU primer system was 10 copies, and the Ct values ​​of all three replicates were less than 35. The bovine ASU primer system only produced positive amplification curves when using B. abortus DNA as a template. No amplification was observed for non-target B. melitensis M5, B. suis S2, and the four negative reference strains. The bovine ASU primer system showed good specificity and successfully identified B. abortus.

[0115] ADZ positive standard at 5.0×10 7 Copy / μL ~ 5.0 × 10 2 Within the range of copies / µL, the copy number exhibits a good linear relationship with its corresponding Ct value, and the correlation coefficient Rt is [value missing]. 2The coefficient of variation (Ct) was 0.999, the slope was -3.772, and the amplification efficiency was 84.133%. The linear equation between copy number (X) and Ct value (Y) was: y = -3.772 lgx + 40.159. At 10 copies, amplification curves were observed in all three replicates, but one replicate showed relatively low fluorescence intensity and a Ct value greater than 35. At 20 copies, amplification curves were observed in all three replicates, and the Ct values ​​were all less than 35. The detection limit of the ADZ primer system was 20 copies. The sheep ADZ primer system produced a positive amplification curve when using *B. melitensis* DNA as a template. A trace signal was observed for *B. abortus* DNA, which, after melting curve analysis, was determined to be non-specific amplification caused by primer dimers. No amplification was observed for other non-target *B. melitensis* M5 strains or four negative reference strains. The sheep ADZ primer system showed good specificity and successfully identified *B. melitensis*.

[0116] WZP positive standard at 4.78×10 7 Copy / μL ~4.78×10 2 Within the range of copies / µL, the copy number exhibits a good linear relationship with its corresponding Ct value, and the correlation coefficient Rt is [value missing]. 2 The coefficient of performance (Ct) was 0.998, the slope was -3.4, and the amplification efficiency was 96.83%. The linear equation between copy number (X) and Ct value (Y) was: y = -3.4 lgx + 36.153. The detection limit of the WZP primer system was 10 copies. The porcine WZP primer system only produced a positive amplification curve when using B. suis DNA as a template. No amplification was observed for non-target strains such as B. abortus A19, B. melitensis M5, and the four negative reference strains. The porcine WZP primer system showed good specificity and successfully identified B. suis.

[0117] CP positive standard at 1.0×10 7 Copy / μL ~ 1.0 × 10 2 Within the range of copies / µL, the copy number exhibits a good linear relationship with its corresponding Ct value, and the correlation coefficient Rt is [value missing]. 2 The coefficient of performance (Ct) was 0.999, the slope was -3.423, the amplification efficiency was 90.899%, and the linear equation between copy number (X) and Ct value (Y) was: y = -3.56 lgx + 37.504. The detection limit of the CP primer system was 10 copies. The CP primer system was negative for Brucella vaccine strain A19 and other non-target templates, but produced positive amplification curves for other Brucella DNA templates, consistent with the expected results. It can identify Brucella vaccine strain A19, and the CP primer system has good specificity.

[0118] WP positive standard at 1.0 × 107 Copy / µL ~ 1.0 × 10 2 Within the range of copies / µL, the concentration copy number of the positive standard showed a good linear relationship with its corresponding Ct value, and the correlation coefficient R0 was [value missing]. 2 The coefficient of performance (Ct) was 0.997, the slope was -3.298, and the amplification efficiency was 101.025%. The linear equation between copy number (X) and Ct value (Y) was: y = -3.298 lgx + 36.381. The detection limit of the WP primer system was 20 copies. Amplification curves were observed in all three replicates, and the Ct values ​​were all less than 35. The WP primer system produced a positive amplification curve when Brucella DNA was used as a template. For the vaccine strain S2, a negative result was obtained by combining melting curve analysis. For other non-target templates, the results were all negative, indicating good specificity of the WP primer system.

[0119] Five SYBR qPCR reaction systems for detecting Brucella showed no cross-reactivity with common bacteria such as Escherichia coli, Staphylococcus aureus, Salmonella (which causes brucellosis), and Yersinia enterocolitica (which has a similar sequence to Brucella), demonstrating good specificity.

[0120] Example 3: Establishment of a TaqMan probe-based singlet qPCR detection system

[0121] The PCR detection probe sequences are shown in Table 1.

[0122] Five recombinant plasmid standards were diluted 10-fold, with a concentration of 10... 6 Using a recombinant plasmid standard of 1 copy / μL as a template, a two-step amplification procedure was used, with three parallel experiments performed each time. The recommended 10μL system for the qPCR (Probe) kit included 5μL of 2×T5 Fast qPCR Mix (Probe), 1μL of DNA template, upstream primer, downstream primer, probe, and sterile water.

[0123] The primer concentrations for ASU, ADZ, WZP, CP, and WP gene amplification were 200, 300, 400, 200, and 200 nM, respectively; P ASU P ADZ P WZP P CP P WP The optimal probe concentrations are 100, 100, 100, 150, and 150 nM.

[0124] The recombinant plasmid standards pMD19T-ASU, pMD19T-ADZ, pMD19T-WZP, pMD19T-CP, and pMD19T-WP were serially diluted 10-fold, and the concentration was taken as 10. 7 Copy / μL~102 A recombinant plasmid of [copy / μL] was used as a standard for qPCR, with ddH2O as a template for a negative control. After the reaction, the system automatically generated an amplification curve, and a standard curve was constructed with Ct value on the ordinate and the copy number of the standard on the x-axis.

[0125] The recombinant plasmid standards pMD19T-ASU, pMD19T-ADZ, pMD19T-WZP, pMD19T-CP, and pMD19T-WP were diluted to 100 copies / μL, 50 copies / μL, 20 copies / μL, and 10 copies / μL, respectively. A negative control was set up using ddH2O as a template, and a positive control was set up using the standards as templates. Each template concentration was run in triplicate. The lowest template concentration where all replicates showed a signal and the Ct value was less than 35 was considered the limit of detection for this assay system.

[0126] Table 5 Single qPCR detection systems for ASU, ADZ, WZP, CP, and WP

[0127]

[0128] Reaction conditions: 95℃ for 300s, 95℃ for 10s, 55℃ for 30s, 40 cycles.

[0129] Five optimized detection systems were used, with bacterial DNA from Salmonella (S. enterica), Escherichia coli (E. coli), Staphylococcus aureus (S. aureus), Yersinia enterocolitica (Y. enterocolitica), B. abortus A19 vaccine strain, B. melitensis M5-90 vaccine strain, and B. suis S2 vaccine strain as templates. The corresponding recombinant plasmids pMD19-ASU, pMD19-ADZ, pMD19-WZP, pMD19-CP, and pMD19-WP were used as positive control templates, and ddH2O was used as a negative control template. Singleton qPCR experiments were performed to evaluate the specificity of the five singleton qPCR detection systems. The detection results are shown in Table 6.

[0130] Table 6. Schematic diagram of singlet qPCR detection results

[0131]

[0132] Select a concentration of 10 after a 10-fold dilution. 6 copies / μL, 10 5 copies / μL, 10 4Using a recombinant plasmid standard at a concentration of 1 copy / μL as a template, perform three parallel experiments for each concentration to establish intra-group technical replicates. Replace the 2×T5 Fast qPCR Mix (Probe), place the template at 4℃ for one day, and then perform the experiment again, performing three replicates to establish inter-group biological replicates. Use ddH2O as a template to set up a negative control and the standard as a template to set up a positive control.

[0133] Experimental results showed that the standard curves for real-time quantitative PCR using five single TaqMan probes were all satisfactory, R 2 All values ​​were greater than 0.99. In the sensitivity test, all replicates of the five reaction systems showed positive results at approximately 100 copies, with 100 copies being the detection limit, indicating good sensitivity. In the specificity test, no reaction was observed for the negative reference strains *Escherichia coli*, *Salmonella*, *Staphylococcus aureus*, and *Yersinia enterocolitica*, demonstrating good specificity. Performance verification of the five detection systems was performed using intra-group technical repeatability and inter-group biological repeatability experiments. Both intra-group technical repeatability and inter-group biological repeatability experiments showed coefficients of variation of less than 2%, indicating good stability. The combined results of the five reaction systems enable the typing and identification of *B. melitensis*, *B. abortus*, *B. suis*, and A19 and S2 vaccine strains.

[0134] Example 4: Establishment and sensitivity analysis of a quadruple TaqMan real-time qPCR detection kit

[0135] I. Establishment of qPCR Detection Kit

[0136] Two types of quadruple fluorescent PCR detection mixtures were prepared according to the primer pairs and probe combinations in Table 1, namely the A19 immune background quadruple detection system and the S2 immune background quadruple detection system.

[0137] Components and dosage of the A19 immune background quadruple reaction system:

[0138] 2×T5 Fast qPCR Mix (Probe): 10 μL;

[0139] 10 μmol / LF ASU R ASU 0.4 μL each, 10 μmol / L ASU 0.2μL;

[0140] 10 μmol / LF ADZ R ADZ 0.6 μL each, 10 μmol / L ADZ 0.2μL;

[0141] 10 μmol / LF WZPR WZP 0.8 μL each, 10 μmol / L WZP 0.2μL;

[0142] 10 μmol / LF CP R CP 0.4 μL each, 10 μmol / L CP 0.3μL;

[0143] DNA template: 2 μL;

[0144] Add sterile water (ddH2O) to a final volume of 20 μL.

[0145] Components and dosage of the S2 immune background quadruple reaction system:

[0146] 2×T5 Fast qPCR Mix (Probe): 10μL;

[0147] 10 μmol / LF ASU R ASU 0.4 μL each, 10 μmol / L ASU 0.2μL;

[0148] 10 μmol / LF ADZ R ADZ 0.6 μL each, 10 μmol / L ADZ 0.2μL;

[0149] 10 μmol / LF WZP R WZP 0.8 μL each, 10 μmol / L WZP 0.2μL;

[0150] 10 μmol / LF WP R WP 0.4 μL each, 10 μmol / L WP 0.3μL;

[0151] DNA template: 2 μL;

[0152] Add sterile water (ddH2O) to a final volume of 20 μL.

[0153] When using this kit to detect Brucella in cattle, sheep, and pigs, the quality control is as follows: The negative control result should show "Undetermined" (ABI 7500), "N / A" (CFX 96), or "No Ct" (SLAN) across all four channels; the positive control result should show Ct values ​​≤ 38 for the FAM, VIC, NED, and ROX channels. Otherwise, the experiment is considered invalid. The criteria for interpreting the test results are as follows:

[0154] 1. Interpretation of reaction results in the A19 immune background quadruple reaction system

[0155] Table 7. Experimental results of primer-probe combinations targeting specific genes and A19 deletion regions of Brucella bovine, ovine, and swine.

[0156]

[0157] If the Ct value of the sample to be tested is between 38 and 40, it needs to be measured repeatedly. If the Ct value obtained from the repeated measurement is still between 38 and 40, it is judged to be below the detection limit and the report is negative.

[0158] The principle behind the above judgment criteria is as follows: the Brucella target genes detected by the reagent combination in Table 7 include: bovine-specific gene ASU (FAM marker), sheep-specific gene ADZ (VIC marker), swine-specific gene WZP (NED marker), and conserved gene CP (ROX marker). Bovine Brucella carries both ASU and CP genes; sheep Brucella carries both ADZ and CP genes; swine Brucella carries both WZP and CP genes; the A19 vaccine carries the ASU gene but lacks the CP gene; the S2 vaccine carries both WZP and CP genes. Specific and conserved genes in the sample can be amplified, while missing genes cannot. This combination can identify bovine, sheep, and swine Brucella and the A19 vaccine, but cannot distinguish between swine Brucella and the S2 vaccine. It is suitable for detecting disease outbreaks in livestock that have not been immunized with A19, S2, or have been immunized with A19.

[0159] 2. Interpretation of reaction results in the S2 immune background quadruple reaction system

[0160] Table 8. Experimental results of primer-probe combinations targeting specific genes and S2 deletion regions of Brucella bovine, ovine, and swine.

[0161]

[0162] If the Ct value of the sample to be tested is between 38 and 40, it needs to be measured repeatedly. If the Ct value obtained from the repeated measurement is still between 38 and 40, it is judged to be below the detection limit and the report is negative.

[0163] The principle behind the above judgment criteria is as follows: the Brucella target genes detected by the reagent combination in Table 8 include: bovine-specific gene ASU (FAM marker), sheep-specific gene ADZ (VIC marker), swine-specific gene WZP (NED marker), and conserved gene WP (ROX marker). Bovine Brucella carries both ASU and WP genes; sheep Brucella carries both ADZ and WP genes; swine Brucella carries both WZP and WP genes; the S2 vaccine carries the WZP gene and lacks the WP gene; the A19 vaccine carries both ASU and WP genes. Specific and conserved genes in the sample can be amplified, while missing genes cannot. This combination can identify bovine, sheep, and swine Brucella and the S2 vaccine, but cannot distinguish between bovine Brucella and the A19 vaccine. It is suitable for detecting disease outbreaks in livestock that have not been immunized with A19 or S2, or those immunized with S2.

[0164] The two reagent combinations in Tables 7 and 8, when used together, can accurately identify and differentiate Brucella aureus in cattle, sheep, and pigs, as well as A19 and S2 vaccines.

[0165] II. Sensitivity Analysis of the Reagent Kit

[0166] 1. Construction of a standard curve for quadruple qPCR

[0167] Standard curves were prepared for the two immune background detection systems. For the A19 immune background detection system, recombinant plasmid standards of pMD19T-ASU, pMD19T-ADZ, pMD19T-WZP, and pMD19T-CP with the same copy number concentration were mixed (referred to as A19 background standards) and used as standards for subsequent quadruple qPCR experiments. For the S2 immune background detection system, recombinant plasmid standards of pMD19T-ASU, pMD19T-ADZ, pMD19T-WZP, and pMD19T-WP with the same copy number concentration were mixed (referred to as S2 standards) and used as standards for subsequent quadruple qPCR experiments. The two mixed recombinant plasmids were diluted 10-fold serially, and the concentration was taken as 10. 7 Copy / μL~10 3 A quadruple qPCR reaction was performed using a mixed recombinant plasmid standard at a concentration of 1 copy / μL as a template, and standard curves were established for each reaction. A negative control was set up using ddH2O as a template. After the reaction, the system automatically generated the amplification curve, and a standard curve was established with Ct value on the ordinate and the copy number of the standard on the abscissa.

[0168] 2. Quadruple qPCR sensitivity detection experiment

[0169] The A19 and S2 immune background standards were diluted to 100 copies / μL, 50 copies / μL, 20 copies / μL, and 10 copies / μL, respectively. A combined quadruple qPCR detection system was used, with ddH2O as a template for a negative control and the mixed standards as a positive control. Each template concentration was used in triplicate. The limit of detection was defined as the lowest template concentration with a Ct value less than 35 for all replicates.

[0170] 3. Quadruple qPCR specific detection experiment

[0171] The genomes of Salmonella (S. enterica), Escherichia coli (E. coli), Staphylococcus aureus (S. aureus), Yersinia enterocolitica (Y. enterocolitica), B. abortus A19 vaccine strain, B. melitensis M5 vaccine strain, and B. suis S2 vaccine strain were extracted as templates. For both the A19 and S2 immune background detection systems, corresponding standards were used as positive control templates, and ddH2O was used as a negative control template. Quadruple qPCR experiments were performed, with a Ct value less than 35 considered positive. The results of the A19 immune background detection system are shown in Table 9, and the results of the S2 immune background detection system are shown in Table 10.

[0172] Table 9. Schematic diagram of A19 immune background detection results

[0173] Table 10. Schematic diagram of S2 immune background detection results

[0174]

[0175] 4. Quadruple qPCR repeatability test experiment

[0176] Select a concentration of 10 after a 10-fold dilution. 6 copies / μL, 10 5 copies / μL, 10 4 Using a mixed plasmid standard at a concentration of [copy / μL] as a template, perform three replicates for each concentration to establish intra-group technical replicates. Replace the template with 2×T5 Fast qPCR Mix (Probe), incubate at 4°C for one day, and then perform the experiment again. Perform three parallel experiments for each concentration to establish inter-group biological replicates. Use ddH2O as a template for a negative control and the standard as a template for a positive control. Calculate the mean, standard deviation, and coefficient of variation using the obtained Ct values.

[0177] 5. Quadruple qPCR experiment using mouse immune serum sample simulants

[0178] (1) Preparation of mouse immune serum samples

[0179] Mice were divided into three groups of three mice each: experimental group 1, experimental group 2, and control group. Experimental group 1 mice were administered 200 μL of the drug via intraperitoneal injection for a total of 10 weeks. 7 CFU Brucella A19 vaccine, experimental group 2 received intraperitoneal injection of 200μL for a total of 10 doses. 7 CFU Brucella S2 vaccine was administered, and the control group received an intraperitoneal injection of 200 μL of physiological saline. Two weeks later, blood was collected from the eyeballs. The whole blood of the mice was left at room temperature for 2 hours, and then centrifuged at 3000 r / min to obtain serum.

[0180] (2) Preparation of simulated samples

[0181] Brucella DNA was extracted from blood samples after brucellosis vaccination in a simulated everyday scenario by adding a live attenuated vaccine to mouse whole blood. Two 250 μL portions of whole blood from control mice were taken; one portion was mixed with the A19 vaccine strain, and the other with the S2 vaccine strain. After thorough mixing, the genome of the whole blood samples was extracted according to the operating procedures of the blood pathogen genome extraction kit. The obtained DNA served as the template for the simulated sample.

[0182] (3) Simulated sample quadruple qPCR experiment

[0183] Using extracted simulated sample DNA as a template, four-fold TaqMan probe real-time quantitative PCR detection was performed using two different immune background detection systems.

[0184] Experimental results:

[0185] like Figure 1 As shown, the standard curve of the A19 immune background quadruple qPCR detection system ( Figure 1 The linear equation for the ASU-FAM copy number (X) versus the Ct value (Y) is y = -3.53 lgx + 39.259, R 2 =0.998, E=91.99. The linear equation for ADZ-VIC copy number (X) versus Ct value (Y) is y=-3.786 lgx+40.878, R 2 =0.995, E=83.715. The linear equation between the WZP-NED copy number (X) and the Ct value (Y) is y=-3.453 lgx+40.254, R 2 =0.999, E=94.818. The linear equation for the CP-ROX copy number (X) and Ct value (Y) is y=-3.389 lgx+40.423, R 2 =0.997, E=97.267, the linear relationship of the standard curve is good.

[0186] S2 immune background quadruple qPCR detection system standard curve ( Figure 1 The linear equation for the ASU-FAM copy number (X) versus the Ct value (Y) is y = -3.39 lgx + 37.105, R 2 =0.993, E=97.24. The linear equation for ADZ-VIC copy number (X) versus Ct value (Y) is y=-3.632 lgx+37.827, R 2 =0.993, E=88.495. The linear equation between the WZP-NED copy number (X) and the Ct value (Y) is y=-3.318 lgx+37.197, R 2 =0.992, E=100.181. The linear equation between the WP-ROX copy number (X) and the Ct value (Y) is y=-3.255 lgx+37.658, R 2 =0.992, E=102.884, the linear relationship of the standard curve is good.

[0187] like Figure 2A-2D and Figures 3A-3D As shown ( Figure 2A-2D (In 3A-3D: A: 100 copies / reaction; B: 50 copies / reaction; C: 20 copies / reaction; D: 10 copies / reaction)

[0188] In the A19 immune background system, amplification was observed in all three replicates at 50 copies / reaction, but the Ct value of the WZP-NED probe was greater than 35; no amplification was observed in replicates below 50 copies / reaction. At 100 copies / reaction, amplification was observed in all three replicates, and the Ct values ​​of all four probes were less than 35. 100 copies / reaction is considered the detection limit for the A19 immune background system.

[0189] The S2 immune background detection system showed amplification in all three replicates at 20 copies, but all four probes had Ct values ​​greater than 35. At 100 and 50 copies, all three replicates showed amplification, and the Ct values ​​of all four probes were less than 35. 50 copies was the detection limit of the detection system.

[0190] like Figures 4A-4F and Figures 5A-5F As shown (A: Four non-target pathogens; B: B. abortus vaccine A19; C: B. melitensis M5; D: B. suis vaccine S2; E: Positive control (recombinant plasmid mixed standard); F: Negative control):

[0191] The A19 immune background detection system was used to detect Escherichia coli, Salmonella, Staphylococcus aureus, Yersinia enterocolitica, Brucella A19, M5, and S2. The results are as follows: Figures 4A-4FThe results of the A19 immune background detection system were consistent with expectations, and there was no cross-reaction with non-target strains such as Escherichia coli, indicating good specificity.

[0192] The S2 immune background detection system was used to detect Escherichia coli, Salmonella, Staphylococcus aureus, Yersinia enterocolitica, Brucella A19, M5, and S2. The results are as follows: Figures 5A-5F The results of the A19 immune background detection system were consistent with expectations, and there was no cross-reaction with non-target strains such as Escherichia coli, indicating good specificity.

[0193] Using mixed recombinant plasmid standards as templates, intra-group technical repeatability experiments and inter-group biological repeatability experiments were established. The repeatability results of the A19 immune background detection system are shown in Table 11. The results show that the coefficients of variation within and between groups are both less than 2.5%, indicating good repeatability and stability. The repeatability results of the S2 immune background detection system are shown in Table 12. The results show that the coefficients of variation within and between groups are both less than 2.0%, indicating good repeatability and stability. It is evident that both immune background detection systems exhibit good repeatability and stability.

[0194] Table 11 Repeatability Tests of the A19 Immune Background System

[0195]

[0196] Table 12 Repeatability Tests of the S2 Immune Background System

[0197]

[0198] The results of the A19 vaccine immunization background testing system are as follows: Figure 6 (A: Whole blood sample from A19-immunized mice; B: Whole blood sample from S2-immunized mice) As shown, the results indicate that the A19 immune background detection system only showed amplification signals for the ASU-FAM probe, which identifies bovine breeds, in the whole blood samples of A19-immunized mice, successfully distinguishing between A19 vaccine and virulent strain infection. The results of the S2 immune background detection system are as follows... Figure 7 (A: Whole blood sample from A19-immunized mice; B: Whole blood sample from S2-immunized mice) The results showed that the S2 immune background detection system only showed an amplified signal for the WZP-VIC probe, which identifies bovine breeds, in the whole blood sample from S2-immunized mice, and could successfully distinguish between S2 vaccine or virulent strain infection.

[0199] In summary, this invention combines two types of vaccine-immune backgrounds to form a TaqMan real-time quantitative PCR detection system, which can identify whether an animal is infected by vaccination or a virulent strain, and can also type Brucella bacteria, all with the aid of only one reaction system.

[0200] The standard curves established for both detection systems showed good linearity, with R² greater than 0.99. The amplification efficiency of quadruple qPCR was slightly lower than that of single qPCR, which may be due to primer competition, but the amplification efficiency remained within a reasonable range. In sensitivity experiments, all probes in the A19 immune background monitoring system met the requirements at 100 copies, and 100 copies was identified as the detection limit for this system. All probes in the S2 immune background monitoring system met the requirements at both 50 and 100 copies, and 50 copies was identified as the detection limit for this system. In specificity experiments, no cross-reactivity was observed between the two systems against *Escherichia coli*, *Salmonella*, *Staphylococcus aureus*, and *Yersinia enterocolitica*, indicating good specificity. In intra-group technical replication experiments and inter-group biological replication experiments, the coefficient of variation for the A19 immune system was less than 2.5%, and that for the S2 immune system was less than 2%, both demonstrating good repeatability and stability. Brucella was successfully detected in whole blood samples using simulated samples, and the vaccine strain could be distinguished.

[0201] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

Claims

1. A nucleic acid detection kit for simultaneously identifying virulent Brucella strains and vaccine strains, characterized in that: The virulent strain of Brucella is Brucella bovis (Brucella abortus) Brucella.abortus ), Brucella mesenteriae ( Brucella.melitensis ), swine brucellosis ( Brucella.suis The vaccine strains are A19 and S2; the A19 vaccine strain is an attenuated strain of Brucella bovis, and the S2 vaccine strain is an attenuated strain of Brucella suis. The kit includes 5 sets of specific primer pairs and corresponding detection probes, targeting the genes ASU, ADZ, WZP, CP, and WP. The nucleotide sequences of each primer are as follows: ASU upstream F ASU For example, SEQ ID NO.1; ASU downstream R ASU For example, SEQ ID NO.2; ADZ upstream F ADZ For example, SEQ ID NO.3; ADZ downstream R ADZ For example, SEQ ID NO.4; WZP upstream F WZP For example, SEQ ID NO.5; WZP downstream R WZP For example, SEQ ID NO.6; CP upstream F CP For example, SEQ ID NO.7; CP downstream R CP For example, SEQ ID NO.8; WP upstream F WP For example, SEQ ID NO.9; WPT downstream R WP For example, SEQ ID NO.10; The corresponding probe nucleotide sequences are as follows: ASU probe P ASU For example, SEQ ID NO.11; ADZ probe P ADZ For example, SEQ ID NO.12; WZP probe P WZP For example, SEQ ID NO.13; CP probe P CP For example, SEQ ID NO.14; WP probe P WP For example, SEQ ID NO.15; each probe nucleotide sequence is labeled with a fluorescent reporter group and a fluorescent quencher group.

2. The nucleic acid detection kit for simultaneously identifying virulent Brucella strains and vaccine strains according to claim 1, characterized in that: The ASU probe is labeled with a FAM fluorescent reporter group at its 5' end and an MGB fluorescent quencher group at its 3' end.

3. The nucleic acid detection kit for simultaneously identifying virulent Brucella strains and vaccine strains according to claim 2, characterized in that: The ADZ probe is labeled with a VIC fluorescent reporter group at its 5' end and an MGB fluorescent quencher group at its 3' end.

4. The nucleic acid detection kit for simultaneously identifying virulent Brucella strains and vaccine strains according to claim 3, characterized in that: The WZP probe is labeled with a NED fluorescent reporter group at its 5' end and an MGB fluorescent quencher group at its 3' end.

5. The nucleic acid detection kit for simultaneously identifying virulent Brucella strains and vaccine strains according to claim 4, characterized in that: The CP probe is labeled with a ROX fluorescent reporter group at its 5' end and an MGB fluorescent quencher group at its 3' end.

6. The nucleic acid detection kit for simultaneously identifying virulent Brucella strains and vaccine strains according to claim 5, characterized in that: The WP probe is labeled with a ROX fluorescent reporter group at its 5' end and an MGB fluorescent quencher group at its 3' end.

7. The nucleic acid detection kit for simultaneously identifying virulent Brucella strains and vaccine strains according to claim 1, characterized in that: The kit also includes positive control standards and negative control standards; the positive control standards are recombinant plasmids carrying the ASU, ADZ, WZP, CP, and WP genes respectively; the negative control standards are solutions that do not contain Brucella.

8. The nucleic acid detection kit for simultaneously identifying virulent Brucella strains and vaccine strains according to claim 7, characterized in that: The negative control is either sterile water (ddH2O) or physiological saline.

9. The nucleic acid detection kit for simultaneously identifying virulent Brucella strains and vaccine strains according to claim 1, characterized in that: The kit contains two sets of quadruple qPCR reaction system reagents: the A19 immune background quadruple reaction system and the S2 immune background quadruple reaction system.

Images