Sirb gene snp molecular marker related to dalbergcon odorifera tree height and application thereof

Abstract

The application discloses a SirB gene SNP molecular marker related to Dalbergia odorifera tree height and application thereof, and belongs to the technical field of genetic engineering. The SNP molecular marker disclosed by the application is located at the 290th base of the sequence shown in SEQ ID NO. 5, the polymorphism of the molecular marker is C or T, and the genotypes include CC, CT and TT. It is verified through correlation analysis that the tree height of the Dalbergia odorifera with the CC genotype is significantly higher than that of the individuals with the CT genotype and the TT genotype. The application further provides a kit for detecting the SNP molecular marker and application of the kit in the aspect of Dalbergia odorifera tree height trait auxiliary screening. With the aid of the molecular marker, the superior genotype individuals can be quickly and accurately identified at the Dalbergia odorifera seedling stage, the breeding efficiency of the Dalbergia odorifera can be significantly improved, and the application has important value for cultivating the Dalbergia odorifera with rapid growth.

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and plant molecular breeding technology, specifically to a SirB gene SNP molecular marker related to the height of Dalbergia odorifera and its application. Background Technology

[0002] Dalbergia odorifera TC Chen, commonly known as Hainan rosewood, is a semi-deciduous tree belonging to the genus Dalbergia in the subfamily Papilionaceae of the family Fabaceae. It is a national second-class protected plant, possessing beautiful ornamental characteristics and extremely high application value. Native to Hainan Province, China, it has now been introduced to Fujian, Guangdong, Yunnan, and Zhejiang provinces, and is widely used in landscaping. Cultivating fast-growing varieties of Dalbergia odorifera is of great significance for achieving rapid landscaping and reducing costs.

[0003] Studies have shown that the SirB (Sirohydrochlorin ferrochelatase) gene is a key enzyme involved in the biosynthesis of siroheme, which is a crucial cofactor for nitrite reductase (NiR) and sulfite reductase (SiR), participating in nitrogen and sulfur assimilation processes, respectively. This gene plays an important role in plant embryonic development and growth.

[0004] Tree height, as an important trait of trees, is a key trait to focus on when cultivating high-quality, fast-growing tree germplasm resources. By developing SNP markers using genome-wide association analysis (GWAS) and exploring the genetic association between the SirB gene and the height of Dalbergia odorifera, molecular markers related to tree height can be developed for early plant screening, achieving the goal of marker-assisted breeding. This can shorten the breeding cycle of Dalbergia odorifera and improve breeding efficiency. Summary of the Invention

[0005] To address the shortcomings of existing breeding methods, the present invention aims to provide a single nucleotide polymorphism (SNP) molecular marker for the SirB gene associated with the height trait of Dalbergia odorifera and its application. The present invention detects and screens a single nucleotide variation associated with the height trait of Dalbergia odorifera, which can be used as a molecular marker for the targeted selection of height in Dalbergia odorifera.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0007] This invention measured the tree height trait data of 303 Dalbergia odorifera trees over 12 months, and used whole-genome resequencing technology to perform SNP genotyping. Through genome-wide association analysis, a SirB gene SNP molecular marker significantly associated with the height of Dalbergia odorifera trees was screened. The SNP is located at the 290th base of the sequence shown in SEQ ID NO.5. This site is located 1435 bp downstream of the SirB gene, and the polymorphism is C or T. The genotypes corresponding to the SNP molecular markers are CC, CT, and TT. The height of Dalbergia odorifera trees with the CC genotype is significantly higher than that of individuals with the CT and TT genotypes.

[0008] Preferably, the upstream 300 bp sequence of the flanking sequence of the SNP molecular marker site is shown in SEQ ID NO.1, and the downstream 300 bp sequence of the flanking sequence is shown in SEQ ID NO.2.

[0009] Preferably, the upstream 30 bp sequence of the flanking sequence of the SNP molecular marker site is as shown in SEQ ID NO.6: TGGGTCGGGTTAGATCAAATCTGAACTTAG, and the downstream 30 bp sequence of the flanking sequence is as shown in SEQ ID NO.7: TCTATTTTTTAGATCAGGTCAATTTTTTGAA.

[0010] To detect the SNP genotype, this invention provides a primer pair for detecting the SNP molecular marker, which includes a forward primer and a reverse primer; the forward primer F is shown in SEQ ID NO.3: 5'-TTGGGTGATATTCACCTCCTCT-3'; the reverse primer R is shown in SEQ ID NO.4: 5'-GCGGTTAGGGACCTAATTAAACAC-3'; the nucleotide sequence obtained after PCR amplification is shown in SEQ ID NO.5, and the SNP molecular marker is located at the 290th base.

[0011] This invention provides a kit for detecting the high-quality traits of Dalbergia odorifera, the kit comprising the detection primer pair and PCR amplification reagent.

[0012] This invention also provides the application of the kit in the assisted screening and genetic breeding of tall Dalbergia odorifera. The application involves using the kit to detect the genotype of SNP molecular markers, wherein Dalbergia odorifera with the CC genotype is taller than those with the CT and TT genotypes, and individuals with the CC genotype are screened and retained as candidate individuals for the tall trait.

[0013] Furthermore, the application includes the following steps:

[0014] (1) Collect leaves of Dalbergia odorifera and extract genomic DNA;

[0015] (2) Use a kit to perform PCR amplification on the extracted genomic DNA to obtain PCR products;

[0016] (3) Perform Sanger sequencing on the PCR product and determine the genotype corresponding to the 290th base of the sequence shown in SEQ ID NO.5 based on the sequencing results;

[0017] (4) Select and retain Dalbergia odorifera plants with the CC genotype as candidate individuals with tall tree height traits. Use this SNP molecular marker for early screening during the seedling stage. Specifically, when Dalbergia odorifera grows to 3 months old, leaves are collected for DNA extraction and genotype identification to initially screen and retain individuals with the CC genotype. At 6 months old, a second screening is conducted based on seedling height growth data to eliminate individuals with slow growth. Finally, the superior individuals with the CC genotype after two rounds of screening are planted in the breeding nursery.

[0018] The beneficial effects of this invention are as follows:

[0019] This invention identified a SirB gene SNP marker, Chr02a_73400426_C / T, significantly associated with height in Dalbergia odorifera (fragrant rosewood) through genome-wide association analysis. This SNP marker can be used for targeted selection of height traits in Dalbergia odorifera. Individuals with the CC genotype at this locus exhibited significantly higher tree height than those with the heterozygous CT and homozygous TT genotypes. This marker allows for early screening of Dalbergia odorifera seedlings, greatly reducing breeding workload, improving breeding efficiency, and lowering breeding costs. In practical applications, this marker can be used for molecularly assisted selection breeding of Dalbergia odorifera to cultivate fast-growing plants. Attached Figure Description

[0020] The specific embodiments of the present invention will be further described in detail below with reference to the accompanying drawings.

[0021] Figure 1 The figure shows the results of genome-wide association analysis of high-quality traits in Dalbergia odorifera.

[0022] Figure 2 This is a statistical result diagram of the genotype and tree height of the Dalbergia odorifera sample in Example 1.

[0023] Figure 3 The results of SNP molecular marker verification for different genotypes in Example 2 and the location of SNPs on the gene are shown. A is an electrophoresis diagram of the PCR amplification results of the three genotypes, and B is a peak diagram of the sequences of different genotypes. Detailed Implementation

[0024] The present invention will now be described in detail with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto.

[0025] The following are the number of Dalbergia odorifera samples and their sources in the examples:

[0026] A total of 303 Dalbergia odorifera trees were cultivated at the Agricultural Science Base of Hainan University Danzhou Campus in Hainan Province, China.

[0027] Example 1: Detection and Identification of SNP Molecular Markers

[0028] 1. DNA extraction, whole-genome resequencing, and genotype data acquisition

[0029] Leaf samples were collected from 303 Dalbergia odorifera trees, and DNA was extracted from the leaf samples using the genomic DNA extraction kit from Tiangen Biotech Co., Ltd. DNA purity was checked using a miniature spectrophotometer. Quality-compliant DNA samples were used for genomic DNA resequencing analysis. Genomic DNA library construction and sequencing were performed using the standard methods of the DNBSEQ-T7 sequencing platform. The obtained raw data was filtered using FASTP to remove adapter contamination and low-quality reads, resulting in clean data. Sentiion was used for variant detection, and the SelectVariants tool in GATK was used to screen for SNPs and obtain genotype information.

[0030] 2. Genome-wide association analysis of SNP molecular markers and tree height trait

[0031] Using GEMMA software, combined with population structure and phylogenetic relationships, variant sites with a minor allele frequency (MAF) > 0.01 and a loss rate of less than 5% were selected. Genome-wide association analysis (GWAS) was performed on tree height data from 303 Dalbergia odorifera samples over 12 months using a mixed linear model (MLM). Significant SNPs with a p-value of 8e-08 in phenotypic association analysis were screened using PLINK. Results are as follows: Figure 1 As shown, the SNP molecular marker reached a significant level in tree height data in April, May, June and August, and can be used as a molecular marker for the breeding of Dalbergia odorifera.

[0032] 3. Identification of SNP molecular markers

[0033] Conserved sequences were extracted from the upstream and downstream flanking sequences of the SNP molecular marker Chr02a_73400426_C / T, specifically 300 bp upstream (SEQ ID NO.1) and 300 bp downstream (SEQ ID NO.2). Using the relevant functions of NCBI Primer-BLAST, primers F (SEQ ID NO.3) and R (SEQ ID NO.4) were designed to detect the upstream fragment, which was 586 bp long (SEQ ID NO.5) and exhibited specificity.

[0034] SEQ ID NO.1:

[0035] TCTTTATATATTTGGGTGATATTCACCTCCTCTAAACTTTACTATTCAATTTACCATAGAAGGGATAATAGTAGTATGATTGTACACATACGAGTAAGATTGGTATAGTAAATTTTACAAATAAAGAGGAATAACTTAATTTCATTGAAT TTAAGGGTGAAAGGGTATAATTTGTTCTTATAAGTAACATCAAAATTTTCAAGTTGAGGGGCAGCATCTATTTCATATACTTGTTCTAATATGAACATTAAGGGTCCATGCAGGATCAGTTGGGTCGGGTTAGATCAAATCTGAACTTAG

[0036] SEQ ID NO.2:

[0037] TCTATTTTTAGATCAGGTCAATTTTTTGAACTCGAACCCATCTGATAATTATCCAACCAGTGATTGAGTCAAATCAGGTCTACCTATTCTTTAAACAATATATTAAGATTTGAACATTATATACATTAATGTTATGAAATTTATAAGTAA AAAAATAAATTCAAGAAATATTTTAGGTTTAATTAATCCGTCAGTCCCTATAGTTTTACTGAATTTTCAATTGGGTCCCTACATTTTAAAAGTTTTCAATTGGATCCTATACTAAAAATAAGTGTTTAATTAGGTCCTAACCGCATAA

[0038] Forward primer F (SEQ ID NO.3):

[0039] 5'-TTGGGTGATATTCACCTCCTCT-3';

[0040] Reverse primer R (SEQ ID NO.4):

[0041] 5'-GCGGTTAGGGACCTAATTAAACAC-3'.

[0042] SEQ ID NO.5:

[0043] TTGGGTGATATTCACCTCCTCTAAACTTTACTATTCAATTTACCATAGAAGGGATAATAGTAGTATGATTGTACACATACGAGTAAGATTGGTATAGTAAATTTTACAAATAAAGAGGAATAACTTAATTTCATTGAATTTAAGGG TGAAAGGGTATAATTTGTTCTTATAAGTAACATCAAAATTTTCAAGTTGAGGGGCAGCATCTATTTCATATACTTGTTCTAATATGAACATTAAGGGTCCATGCAGGATCAGTTGGGTCGGGTTAGATCAAATCTGAACTTAGCTCT ATTTTTAGATCAGGTCAATTTTTTGAACTCGAACCCATCTGATAATTATCCAACCAGTGATTGAGTCAAATCAGGTCTACCTATTCTTTAAACAAATATATTAAGATTTGAACATTATATACATTAATGTTATGAAAATTTATAAGTA AAAAAATAAATTCAAGAAATATTTTAGGTTTAATTAATCCGTCAGTCCCTATAGTTTTACTGAATTTTCAATTGGGTCCCTACATTTTAAAAGTTTTCAATTGGATCCTATACTAAAAATAAGTGTTTAATTAGGTCCTAACCGC

[0044] The primers were used to perform PCR on samples with different genotypes to obtain the target fragment, which was then sent to Platinum Biotech Co., Ltd. for Sanger sequencing to identify the presence of SNPs.

[0045] The PCR reaction program was as follows: 94℃ pre-denaturation for 3 minutes, 94℃ denaturation for 30 seconds, 58℃ annealing for 30 seconds, 72℃ extension for 1 minute, denaturation to extension for 35 cycles, and 72℃ extension for 5 minutes.

[0046] The PCR reaction system consisted of: 1 μL DNA template, 1 μL forward primer F (10 μM), 1 μL reverse primer R (10 μM), 10 μL 2×Taq PCR Master Mix, 7 μL ddH2O, and a total volume of 20 μL.

[0047] 4. Identification of dominant genotypes using SNP molecular markers

[0048] The SNP molecular marker Chr02a_73400426_C / T has three genotypes: CC, CT, and TT. The sample population was divided into three genotype groups, and the dominant genotypes significantly affecting tree height were screened using this trait. The results are as follows: Figure 2 As shown, in the Dalbergia odorifera population, individuals with the CC genotype at this locus had significantly higher tree height than those with the heterozygous mutant CT genotype and the homozygous mutant TT genotype. Significant differences existed among the three genotypes: significant difference between CC and CT (p=0.014), significant difference between CT and TT (p=0.029), and highly significant difference between CC and TT (p=0.00014). The CC genotype is the dominant genotype for this SNP molecular marker and can be applied to the selection of Dalbergia odorifera trees for height traits.

[0049] Example 2: Validation of SNP molecular markers

[0050] The SNP molecular marker is located at base position 290 as shown in SEQ ID NO.5, with a polymorphism of C or T. The 30 bp upstream sequence of the flanking sequence is shown in SEQ ID NO.6: TGGGTCGGGTTAGATCAAATCTGAACTTAG; the 30 bp downstream sequence of the flanking sequence is shown in SEQ ID NO.7: TCTATTTTTTAGATCAGGTCAATTTTTTGAA.

[0051] Fifteen samples with different genotypes were randomly selected from 303 samples for verification. The DNA samples were amplified by PCR using Tiangen 2×TaqPCRMasterMix enzyme (KT 211). The reaction system and reaction procedure were as described in Example 1, and the primers used were as shown in SEQ ID NO.3 and SEQ ID NO.4.

[0052] After the PCR reaction, the results were detected by 1.0% agarose gel electrophoresis. 0.2 g of agarose was dissolved in 20 mL of 1% TAE, and 2 μL of Goldview nucleic acid dye was added. 5 μL of PCR amplification product was pipetted into each well of the gel, along with 5 μL of DNA Marker (D2000) as a control. Electrophoresis was performed at a constant voltage of 150 V for 25 minutes, followed by observation and photographing under UV light. The electrophoresis results are shown below. Figure 3 As shown in Figure A, a band is present at 586 bp, indicating that the primer design is reasonable and the product size is normal and reliable. The PCR products were sent to Platinum Biotech Co., Ltd. for sequencing. The base peak diagram of the sequence was visualized using SnapGene software. SNP molecular marker sites were analyzed based on the peak diagram. The visualization results of the sequenced genotypes CC, CT, and TT are shown below. Figure 3 As shown in B in the diagram. The genotype information for the gel wells from left to right is as follows:

[0053] genotype CC CT TT

[0054] Example 3: Dominant Genotype Analysis

[0055] The SNP molecular marker Chr02a_73400426_C / T has three genotypes: CC, CT, and TT. Combined with the screening of tree height trait, the dominant genotype that significantly affects tree height was identified.

[0056] The results of dominant genotype analysis showed that individuals with the CC genotype of Dalbergia odorifera at this locus had significantly higher tree height than those with the heterozygous mutant CT genotype and the homozygous mutant TT genotype. Figure 2 As shown.

[0057] In summary, the tree height of individuals with the CC genotype in the Dalbergia odorifera population was significantly higher than that of individuals with the heterozygous mutant CT genotype and the homozygous mutant TT genotype.

[0058] Example 4: Establishment of a seedling grading and screening system

[0059] 1. Primary screening at 3 months of age: When Dalbergia odorifera reaches 3 months of age, 2-3 tender leaves are collected from each seedling, and DNA is extracted using the genomic DNA extraction kit from Tiangen Biotech Co., Ltd. Genotyping is performed using the PCR system and primers SEQ ID NO.3 and SEQ ID NO.4 described in Example 1. Individuals with the CC genotype are retained, while individuals with the CT and TT genotypes are discarded.

[0060] 2. Secondary screening at 6 months: For individuals with the CC genotype retained after screening at 3 months, seedling height is measured at 6 months. Superior individuals whose seedling height is higher than the population average plus 1 standard deviation (i.e., the top 30%) are retained, while slow-growing individuals are culled.

[0061] 3. Planting and Final Selection: The superior CC genotype individuals selected through two rounds of selection were planted in the breeding nursery and managed routinely. In the third year after planting, tree height was measured, and individuals with a height higher than the population average were ultimately retained as breeding materials.

[0062] This hierarchical screening system combines molecular marker-assisted selection with phenotypic selection, which can eliminate non-superior individuals at the seedling stage, greatly improving breeding efficiency and reducing breeding costs.

[0063] The foregoing has shown and described the principles, main features, and advantages of the present invention. For those skilled in the art, the above embodiments do not limit the present invention in any way, and various improvements and modifications can be made without departing from the technical principles of the present invention, which are also considered to be within the scope of protection of the present invention.

Claims

1. The application of an SNP molecular marker detection reagent or a kit containing said reagent in the trait-assisted screening and genetic breeding of Dalbergia odorifera, characterized in that, The reagent was used to detect the genotype of the SNP molecular marker, which is shown in SEQ ID NO.

5. The polymorphism of the 290th base of SEQ ID NO.5 is C or T, and the corresponding genotypes are CC, CT, and TT. Among them, the height of Dalbergia odorifera trees with CC genotype is higher than that of CT and TT genotypes. Individuals with CC genotype were screened and retained as candidates for the tall tree trait.

2. The application according to claim 1, characterized in that, The reagent is a detection primer pair, which includes a forward primer and a reverse primer; the forward primer F is shown in SEQ ID NO.3: 5'-TTGGGTGATATTCACCTCCTCT-3'; the reverse primer R is shown in SEQ ID NO.4: 5'-GCGGTTAGGGACCTAATTAAACAC-3'.

3. A method for breeding Dalbergia odorifera with high tree height and superior traits, characterized in that, The method includes the following steps: (1) Collect leaves of Dalbergia odorifera and extract genomic DNA; (2) Use a kit to perform PCR amplification on the extracted genomic DNA to obtain PCR products; (3) Perform Sanger sequencing on the PCR product and determine the genotype corresponding to the 290th base of the sequence shown in SEQ ID NO.5 based on the sequencing results; (4) Select and retain Dalbergia odorifera with genotype CC as candidate individuals for tall trees and high traits, and conduct seedling grading screening; at the seedling stage of 3 months, collect leaf DNA for genotype detection, and retain individuals with genotype CC as superior seedlings for further cultivation; at the seedling stage of 6 months, conduct a second screening based on seedling height growth data, and eliminate individuals with slow growth; finally, plant the superior individuals with CC genotype after two rounds of screening in the breeding nursery.

Images