An infectious bronchitis virus raa-cr ispr / cas13a detection reagent kit and detection method
Patent Information
- Application Number
- CN202610799696.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-06-04
- Publication Date
- 2026-08-28
AI Technical Summary
但目前尚无将RAA扩增与CRISPR/Cas13a系统联合应用于IBV核酸检测的公开报道,相关技术与产品仍处于空白状态
[0017] 1. High sensitivity and strong specificity: RAA isothermal amplification enables rapid amplification of target nucleic acids, combined with precise identification and signal amplification of Cas13a protein. The sensitivity of the fluorescence detection method is consistent with that of qPCR. It is designed for the conserved N gene of IBV, and has a broad spectrum of recognition for different serotypes of IBV. It has no cross-reaction with other avian pathogens.
Smart Images

Figure CN122648619A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of virus detection technology, and in particular to a detection kit and method for chicken infectious bronchitis virus RAA-CRISPR / Cas13a. Background Technology
[0002] Infectious Bronchitis Virus (IBV) is the primary pathogen causing infectious bronchitis (IB) in chickens, belonging to the family Coronaviridae and the genus Gamma Coronavirus. The virus genome is a single-stranded positive-sense RNA with a high natural mutation rate and a tendency for gene recombination, resulting in numerous circulating serotypes, frequent antigenic variations, and extremely weak cross-protective ability between different serotypes. This poses a significant challenge to vaccine immunization and disease control. IBV primarily causes acute, highly contagious respiratory infection in chickens, and can also affect the urinary and reproductive systems, leading to stunted growth in chicks, decreased egg production in laying hens, and increased mortality. It causes continuous and severe economic losses to the global poultry industry and is one of the key pathogens for poultry disease control.
[0003] Rapid, accurate, and sensitive nucleic acid testing is the core technological support for early diagnosis, precise tracing, and scientific prevention and control of IBV. Current mainstream IBV nucleic acid testing methods still have significant limitations: real-time quantitative PCR (qPCR) and conventional PCR rely on sophisticated thermal cyclers and dedicated fluorescence detection equipment, requiring high standards for laboratory conditions and professional operators, with complex and time-consuming procedures, making them unsuitable for rapid on-site screening; while virus isolation and identification are the "gold standard" for pathogen detection, they are cumbersome and time-consuming, failing to achieve rapid diagnosis; rapid detection technologies such as colloidal gold immunochromatographic test strips, although simple to operate, generally suffer from low sensitivity and insufficient specificity, easily leading to missed detections and misdiagnoses, making them unsuitable for detecting early clinical infections and low-virus-load samples. Therefore, developing a new IBV nucleic acid testing technology that is simple to operate, rapid, sensitive, highly specific, requires no complex instruments, and is suitable for on-site testing has become a critical technological need urgently needing to be addressed in the field of poultry disease prevention and control.
[0004] The CRISPR / Cas system is a rapidly developing next-generation gene editing and molecular detection technology that has demonstrated significant advantages in the field of precise nucleic acid detection. Cas13a, a crRNA-guided RNA-dependent ribonuclease, can activate highly efficient non-specific trans-cleavage activity after specifically recognizing target RNA, rapidly degrading fluorescently labeled single-stranded RNA reporter probes within the system to amplify the detection signal, providing a core technological foundation for high-sensitivity, high-specificity nucleic acid detection. Recombinase-mediated isothermal amplification (RAA) technology can rapidly amplify target nucleic acids at room temperature (around 37°C), offering significant advantages such as no need for a thermal cycler, fast reaction speed, ease of operation, and strong anti-interference capabilities, making it highly suitable for rapid on-site detection scenarios.
[0005] Combining RAA isothermal rapid amplification with CRISPR / Cas13a high-specificity recognition and signal amplification technology can construct an IBV nucleic acid detection system that is rapid, sensitive, specific, and applicable to the field, effectively compensating for the shortcomings of existing detection technologies. However, there are currently no publicly reported applications of combining RAA amplification with the CRISPR / Cas13a system for IBV nucleic acid detection, and related technologies and products remain undeveloped. Summary of the Invention
[0006] In view of this, the present invention provides a detection kit and method for detecting chicken infectious bronchitis virus RAA-CRISPR / Cas13a to solve the above problems.
[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0008] A nucleic acid detection method for chicken infectious bronchitis virus (IBV) based on RAA-CRISPR / Cas13a is proposed. Using the highly conserved N gene of IBV as the detection target, the method combines recombinase-mediated isothermal amplification (RAA) technology with the CRISPR / Cas13a system, and designs two modes: fluorescence detection and lateral flow chromatography strip detection. The specific steps include:
[0009] 1. Nucleic acid extraction from samples to be tested: Total nucleic acid was extracted from chicken pharyngeal swabs, cloacal swabs, tissue samples and other samples to be tested using conventional nucleic acid extraction methods, and used as a test template.
[0010] 2. RAA isothermal amplification: Using the IBV N gene as the target, the optimal primer pair F2 / R1 isothermal amplification of RAA is performed without thermal cycling, achieving rapid and efficient amplification of the target nucleic acid;
[0011] 3. CRISPR / Cas13a cleavage reaction: The RAA amplification product was mixed with the optimized CRISPR / Cas13a reaction system and the cleavage reaction was carried out at a suitable temperature; the CRISPR / Cas13a reaction system contained LwCas13a protein, crRNA1, and a reporter probe, wherein the LwCas13a protein specifically recognized the IBV N gene RNA amplified by RAA under the guidance of crRNA1, activated the trans cleavage activity, and degraded the reporter probe in the system;
[0012] 4. Result Interpretation: If the sample contains IBV nucleic acid, the Cas13a protein will activate its cleavage activity, degrade the fluorescent reporter probe, and generate a fluorescent signal. The signal change will be detected by a qPCR instrument. If a fluorescent signal is present, the result is considered positive; if no fluorescent signal is generated, the result is considered negative.
[0013] Furthermore, the CRISPR / Cas13a reaction system in this invention has been systematically optimized to determine the optimal concentrations of each component: LwCas13a protein concentration of 120 nM, crRNA1 concentration of 50 nM, and fluorescent reporter probe concentration of 500 nM. This optimized system can ensure the efficiency and specificity of the cleavage reaction, maximizing the detection sensitivity and accuracy.
[0014] The LwCas13a protein used in this invention was obtained through prokaryotic expression and purification. The specific preparation method is as follows: the LwCas13a protein expression vector was transformed into Rosetta (DE3) competent Escherichia coli, and efficient soluble expression was achieved by induction with an inducer; after collecting the bacterial culture and sonicating it, the protein was purified by nickel column affinity chromatography. The purified protein concentration was not less than 0.82 mg / mL, and the activity was identified as having good RNA cleavage activity, which can specifically recognize and cleave target RNA.
[0015] The detection method described in this invention has excellent sensitivity and specificity: the fluorescence detection method has a detection limit of 1 copies / µL for IBV nucleic acid, which is consistent with the sensitivity of the traditional qPCR method; the method has good broad-spectrum recognition of different IBV serotypes and different isolates, and has no cross-reactivity with other common avian pathogens, so the detection results are accurate and reliable.
[0016] By adopting the above technical solution, the present invention has the following beneficial effects:
[0017] 1. High sensitivity and strong specificity: RAA isothermal amplification enables rapid amplification of target nucleic acids, combined with precise identification and signal amplification of Cas13a protein. The sensitivity of the fluorescence detection method is consistent with that of qPCR. It is designed for the conserved N gene of IBV, and has a broad spectrum of recognition for different serotypes of IBV. It has no cross-reaction with other avian pathogens.
[0018] 2. Simple operation and no complicated instruments required: RAA amplification and Cas13a cutting are both isothermal reactions, requiring no thermal cycler; the fluorescence detection method only requires a qPCR instrument, and it can emit fluorescence under blue light, allowing the results to be directly interpreted by the naked eye, without the need for any instruments, and the operator does not need professional molecular biology skills.
[0019] 3. Fast detection speed: From reagent reaction to result interpretation, the entire process can be completed within 30-60 minutes, which is much faster than conventional qPCR, virus isolation and other methods. Attached Figure Description
[0020] Figure 1 The reaction principle of RAA-CRISPR / Cas13a.
[0021] Figure 2 This is a plasmid map of the LwCas13a protein.
[0022] Figure 3 SDS-PAGE electrophoresis image of LwCas13a protein; where M is the protein molecular weight marker, 1: before loading; 2: flow-through; 3: washing; 4: 20 mM imidazole elution; 5: 50 mM imidazole elution; 6-8: 75 mM imidazole elution; 9-10: 100 mM imidazole elution; 11: 120 mM imidazole elution; 12: 200 mM imidazole elution; 13: 500 mM imidazole elution.
[0023] Figure 4 Agarose gel electrophoresis image (A) of RAA primer screening and fluorescence detection results of screening primers (B); In A, M is DNA molecular weight marker, 1: F1R1 negative; 2: F1R2 negative; 3: F2R1 negative; 4: F2R2 negative; 5: F1R1 positive; 6: F1R2 positive; 7: F2R1 positive; 8: F2R2 positive.
[0024] Figure 5 Real-time fluorescence images optimized for each component of the RAA-CRISPR / Cas13a fluorescence detection method; where A is the fluorescence image optimized for Cas13a concentration; B is the fluorescence image for crRNA screening; C is the fluorescence image for crRNA concentration screening; and D is the fluorescence image optimized for fluorescent probes.
[0025] Figure 6 This is a standard plasmid map of the N gene.
[0026] Figure 7 The graph shows the sensitivity detection results of RAA-CRISPR / Cas13a fluorescence detection. The horizontal axis represents the cycle number, and the vertical axis represents the relative fluorescence intensity.
[0027] Figure 8This is the qPCR standard curve, with the horizontal axis representing the logarithm of the IBV N gene standard plasmid copy number and the vertical axis representing the Ct value of qPCR amplification.
[0028] Figure 9 The graph shows the qPCR amplification curve, with the Ct value of qPCR on the x-axis and the real-time fluorescence intensity (RFU) on the y-axis.
[0029] Figure 10 The graph shows the broad-spectrum detection results of RAA-CRISPR / Cas13a fluorescence detection; the horizontal axis represents the cycle number, and the vertical axis represents the relative fluorescence intensity.
[0030] Figure 11 This is a graph showing the specificity detection results of RAA-CRISPR / Cas13a fluorescence detection; the horizontal axis represents the cycle number, and the vertical axis represents the relative fluorescence intensity. Detailed Implementation
[0031] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention. Unless otherwise specified, all reagents used in the present invention are commercially available conventional reagents; unless otherwise specified, all experimental methods used are conventional molecular biology experimental methods.
[0032] Example 1. Expression, purification, and activity identification of LwCas13a protein
[0033] In this embodiment, the expression and purification process of LwCas13a protein is a prerequisite for the subsequent construction of the CRISPR-Cas13a detection system and does not constitute the core inventive point of this invention. In practical applications, commercially available LwCas13a protein can also be used directly for experiments without affecting the implementation of the core technical solution of this invention.
[0034] The pC013-Twinstrep-SUMO-huLwCas13a plasmid (image shown) was used. Figure 2 (As shown) Transformed into Rosetta (DE3) competent Escherichia coli, plated on LB agar containing the resistant strain, and incubated at 37°C for 12 h; single colonies were picked and inoculated into LB liquid medium, and cultured at 37°C on a shaker until OD. 600 =0.6~0.8, add IPTG inducer (final concentration 0.2 mM), and induce at 16℃ for 12 h to achieve soluble protein expression.
[0035] The specific steps are as follows:
[0036] (1) After the plasmid dry powder is briefly centrifuged, 20 μL of sterile water is added under sterile conditions to dissolve it completely;
[0037] (2) Add 5 μL of plasmid solution to Rosetta (DE3) competent cells, incubate on ice for 30 min, then heat shock at 42℃ for 90 s, and quickly transfer to ice to cool for 5 min;
[0038] (3) Add 500 μL of antibiotic-free LB liquid medium to the system and incubate at 37°C with shaking for 50 min;
[0039] (4) After centrifuging at 6000 rpm for 5 min, discard the supernatant, retain about 60 μL of liquid to resuspend the bacterial cells, spread them on LB solid plates containing ampicillin resistance, and incubate at 37°C upside down overnight;
[0040] (5) Pick a single colony and inoculate it into LB liquid medium containing the resistance, and incubate at 37°C and 220 rpm until OD. 600 =0.6~0.8, add IPTG to a final concentration of 0.2 mM, and induce at 16℃ for 12 h to achieve soluble expression of LwCas13a protein. Collect the bacterial culture, centrifuge at 8000 r / min for 10 min at 4℃, and discard the supernatant; resuspend the bacterial cells with lysis buffer, sonicate and centrifuge at 12000 r / min for 20 min at 4℃, and collect the supernatant; pass the supernatant through a nickel affinity chromatography column, and after equilibration, binding, elution, and dialysis, obtain purified LwCas13a protein; the protein concentration was detected by a BCA protein quantification kit and was 0.82 mg / mL.
[0041] The specific purification process is as follows:
[0042] (1) Equilibrate the column: Open the valve to drain the nickel column preservation solution, wash the nickel column with 10 column volumes of filtered ddH2O, and then equilibrate the nickel column with 10 column volumes of equilibration buffer.
[0043] (2) Protein loading: After the nickel column is equilibrated, slowly add the filtered supernatant into the column in batches, controlling the flow rate to 3 s / drop. Repeat the column loading process 3 to 5 times to allow the protein to be adsorbed onto the nickel column.
[0044] (3) Impurity removal: The nickel column was rinsed with 20 mM imidazole elution buffer to remove non-specifically bound proteins. At the same time, the eluent was monitored with a protein indicator while rinsing. 10 μL of the protein sample to be tested was taken and 30 μL of protein indicator was added. The color was observed until it no longer changed, to ensure that the impurities were completely removed.
[0045] (4) Elution: The target protein was eluted with gradients of 50 mM, 75 mM, 100 mM, 120 mM, 200 mM, and 500 mM imidazole elution buffers and collected. Simultaneously, the elution buffer was monitored with a protein indicator during elution; once the color of one gradient stopped changing, the next gradient was switched.
[0046] (5) Cleaning the column: After gradient elution, rinse the column with 1 M imidazole elution buffer to remove residual protein, then clean the nickel column with 10 column volumes of filtered ddH2O, and finally add 20% ethanol solution to block the nickel column.
[0047] (6) Select the protein samples that react most strongly with the indicator from the collected protein samples and then perform SDS-PAGE gel electrophoresis and Western Blot analysis.
[0048] The experimental group and the negative control group were set up and incubated at 37℃ for 60 min. The fluorescence signal was detected by qPCR. Figure 3 The results showed that the experimental group showed obvious fluorescence signals, while the negative control group showed no fluorescence signals, indicating that the purified LwCas13a protein has good RNA enzyme cleavage activity and can specifically recognize target RNA and activate the cleavage function.
[0049] Example 2. RAA primer screening and amplification system optimization
[0050] Primer design and synthesis: Using the conserved sequence of the IBV N gene in GenBank as a template, two pairs of specific primers (F1 / R1, F2 / R2) were designed and synthesized according to the RAA primer design principle, as shown in Table 1.
[0051] Table 1 Detection Primers
[0052] F1 GATCCGATCAAGTCTTTGGTCCCCGTACTAAAGGTA SEQ ID NO.1 R1 TAATACGACTCACTATAGGGATTCAAATCTCAAGTGAAGCCCATCTGGTTG SEQ ID NO.2 F2 GGATCCGATCAAGTCTTTGGTCCCCGTACT SEQ ID NO.3 R2 TAATACGACTCACTATAGGGTGGGCGTCACCCTACTTCCAAAAAGGCAAGCATGG SEQ ID NO.4
[0053] Primer screening: Using IBV standard nucleic acid as a template, RAA isothermal amplification was performed using two pairs of primers interchangeably with the basic RAA nucleic acid amplification kit (Hangzhou Zhongce Biotechnology Co., Ltd.). The reaction was carried out at 37℃ for 30 min, and the amplification products were detected by agarose gel electrophoresis.
[0054] (1) 13.5 μL of enzyme-free water, 25 μL of buffer A, 2 μL of upstream primer (10 μM) and 2 μL of downstream primer (10 μM) were premixed and then added to a detection tube pre-filled with the reaction dry powder reagent.
[0055] (2) Add 5 μL of the sample to be amplified to the tube above.
[0056] (3) Add 2.5 μL of buffer B to the tube cap, cover the tube, invert it 5-6 times, and centrifuge at low speed for 10 s. (Whether this step is completely mixed will determine the repeatability of the experimental results)
[0057] (4) Place the above detection tube in a 42ºC water bath for 30 min.
[0058] (5) After the reaction is complete, add 50 μL of extraction buffer (phenol:chloroform:isoamyl alcohol volume ratio = 25:24:1) to the tube, mix thoroughly, centrifuge at 12000 rpm for 5 min, transfer the supernatant to a new centrifuge tube, perform electrophoresis detection, and store the remaining sample at -20ºC.
[0059] After amplification, the amplification products were detected by agarose gel electrophoresis, and the results are as follows: Figure 4 As shown in the figure. The results showed that the amplification band of primer pair F2 / R1 was bright and single, with no nonspecific amplification, and the amplification efficiency of primer pair F2 / R1 was significantly higher than that of other primer pairs detected by fluorescence, thus confirming F2 / R1 as the optimal RAA primer pair.
[0060] Example 3. Optimization of the RAA-CRISPR / Cas13a detection system
[0061] Three crRNA sequences were designed based on the amplification target sequence, namely crRNA1, crRNA2, and crRNA3, and their sequences are shown in SEQ ID NO.5~7 respectively; the fluorescent reporter probe is shown in SEQ ID NO.8.
[0062] Table 2 crRNA and probe sequences
[0063] crRNA1 GGGAUUUAGACUACCCCAAAAACGAAAGGGGACUAAAAACGAGGGGAAAAUUUUGGUGAUGACAAGAUGA SEQ ID NO.5 crRNA2 GGGAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAACGGUGAUGACAAGAUGAAUGAGGAAGGUA SEQ ID NO.6 crRNA3 GGGAUUUAGACUACCCCAAAAACGAAGGGGGACUAAAAACAUGGGCGUGUUACAGCAAUGCUCAACCU SEQ ID NO.7 Report probe 5'-FAM-UUUUU-BHQ1-3'
[0064] Using IBV standard nucleic acid as a template, the key components of the CRISPR / Cas13a reaction system were optimized through single-factor experiments. The effects of different concentrations of LwCas13a protein (90nM, 120nM, 150nM, 180nM, 210nM), crRNA (crRNA1, crRNA2, crRNA3), crRNA concentration (25nM, 50nM, 100nM, 150nM, 200nM, 250nM, 300nM), and fluorescent reporter probe (200nM, 300nM, 400nM, 500nM, 600nM, 700nM, 800nM) on the detection results were investigated. The optimal concentrations of LwCas13a protein, crRNA, and fluorescent reporter probe in the detection system were determined using fluorescence signal intensity as the evaluation index. The RAA-CRISPR / Cas13a detection system is shown in Table 3.
[0065] Table 3 RAA-CRISPR / Cas13a detection system
[0066] 10×buffer 2 μL LwCas13a protein 0.35 μL crRNA 2 μL NTP 1 μL Rnase Inhibitor 0.4 μL Fluorescent probe (10 μM) 1 μL T7 RNA Polymerase 0.1 μL target DNA 3 μL Enzyme-free water Up to 20 μL
[0067] The results are as follows Figure 5As shown in the figure. The results showed that the strongest fluorescence signal and the best reactivity were observed under the following conditions: LwCas13a protein 120 nM, crRNA 150 nM, and fluorescent reporter probe 500 nM. Therefore, this detection system was used for subsequent experiments.
[0068] Example 4. Sensitivity testing of the RAA-CRISPR / Cas13a detection method
[0069] 1. Preparation of N gene standard plasmid
[0070] (1) Primer design: Primers were designed targeting the highly conserved region of the IBV N gene. This primer pair can amplify a 249 bp fragment. The sequence is shown in Table 4:
[0071] Table 4 Primer Sequences
[0072] NF TTGAAGGTAGTGGTGTTCCTGA SEQ ID NO.8 NR CAGCAACCCACACTATACCATC SEQ ID NO.9
[0073] (2) Preparation of N gene standard plasmid:
[0074] Prepare the reaction system according to Table 5 and set the PCR amplification program: pre-denaturation at 95℃ for 5 min, perform 34 cycles, each cycle including denaturation at 95℃ for 30 s, annealing at 54℃ for 30 s, and extension at 72℃ for 12 s.
[0075] Table 5 PCR reaction system
[0076] ExTaq 10 μL NF 1 μL NR 1 μL template 1 μL <![CDATA[ddH2O]]> up to 20 μL
[0077] After purifying the PCR product, the purified product was ligated to the pMD19-T vector with blunt ends, and then transformed into DH5α competent cells. Single colonies were picked and sequenced. Positive clones were expanded and plasmids were extracted. The standard plasmid map of the N gene is shown below. Figure 6 As shown.
[0078] A series of serially diluted IBV N gene standard plasmids were prepared, each containing 1.1 × 10⁻⁶ cells. 6 copies / µL, 1.1×10 4 copies / µL, 1.1×10 3 copies / µL, 1.1×10 2 copies / µL, 1.1×10 1 copies / µL and 1.1×10 1 copies / µL. Detection was performed using the optimal primers from Example 2 and the optimized RAA-CRISPR / Cas13a fluorescence detection method from Example 3, as well as the conventional qPCR method. The specific methods are as follows:
[0079] 2. RAA-CRISPR / Cas13a detection method
[0080] Using F2 / R1 primers and the N gene standard plasmid as a template, amplification was performed. The amplification system and conditions were as described in Example 2. After amplification, the amplification products were recovered and amplified according to the RAA-CRISPR / Cas13a detection system in Table 3. The final concentrations of LwCas13a protein, crRNA1, and fluorescent reporter probe in the system were 120 nM, 50 nM, and 500 nM, respectively. The results of the RAA-CRISPR / Cas13a fluorescence detection method are as follows: Figure 7 As shown, the lowest detection limit is 1 copy / μL.
[0081] 3. Quantitative real-time PCR detection: Calculate the copy number of the standard plasmid using the following formula:
[0082]
[0083] The plasmid was serially diluted to 1~1×10⁻⁶. 6 The reaction mixture was prepared in μL and used as a template for quantitative real-time PCR detection. A standard curve was constructed based on this, and the reaction system is shown in Table 6 below.
[0084] Table 6 qPCR reaction system
[0085] 2×Ultra SYBR Mixture 10 μL NF 0.4 μL NR 0.4 μL template 0.8 μL <![CDATA[ddH2O]]> up to 20 μL
[0086] After preparing the system, select the SYBR channel and set the reaction program according to Table 7. After the reaction is completed, construct a standard curve based on the plasmid copy number and cycle number Ct value.
[0087] Table 7 qPCR reaction procedure
[0088]
[0089] qPCR amplification curve ( Figure 9 The standard curve ( ) exhibits a typical S-shape. Figure 8 R 2 >0.99, in the range of 1~1×10 6 The linear relationship was good within the concentration range of copies / μL, and the detection limit was as low as 1 copy / μL. Results of the RAA-CRISPR / Cas13a fluorescence detection method are as follows: Figure 7 As shown, the lowest detection limit is 1 copy / μL, which is consistent with the sensitivity of the qPCR method, indicating that the method of the present invention can detect low-copy IBV samples and can meet the needs of clinical sample testing.
[0090] Example 5. Broad-spectrum detection of the RAA-CRISPR / Cas13a detection method
[0091] The established RAA-CRISPR / Cas13a detection method for chicken infectious bronchitis virus was validated for broad spectrum. In the experiment, nucleic acid samples of different serotypes of IBV strains, including TW, QX, H120, W93, LDT3-A, and 4 / 91, were used. The IBVN gene standard plasmid was used as a positive control (PC), and nuclease-free water was used as a negative control (NC). After extracting the nucleic acid from each sample, the target sequence was isothermally amplified at 37°C using the specific RAA primer set F2 / R1 designed in this invention. The amplified product was then mixed with a CRISPR reaction system consisting of LwCas13a protein, crRNA targeting the IBVN gene, and a fluorescent reporter probe. Real-time fluorescence detection was performed at 37°C, and the fluorescence signal intensity (RFU) at different cycle numbers was recorded. Figure 10 The results showed that all IBV strain samples and positive controls exhibited typical "S-shaped" fluorescence amplification curves, while the fluorescence signal of the negative control remained at the baseline level throughout the process without significant increase. This indicates that the detection method of the present invention can broadly identify IBV strains of different serotypes, without cross-reaction or non-specific signal interference, and is suitable for rapid detection of different variant IBV strains.
[0092] Example 6. Specificity detection of the RAA-CRISPR / Cas13a detection method
[0093] The cross-reactivity specificity of the established RAA-CRISPR / Cas13a detection method for infectious bronchitis virus in chickens was validated. Nucleic acid samples of common avian pathogens such as infectious bursal disease virus (IBDV), Newcastle disease virus (NDV), avian influenza virus (AIV), and avian adenovirus (FAV), as well as the IBV N gene standard plasmid (PC) and a nuclease-free water negative control (NC) were used as templates. The detection was performed according to the optimal reaction system and conditions established in Example 3, and the fluorescence signal was recorded in real time. Figure 11 The results showed that only the IBV positive control sample showed an "S-shaped" fluorescence amplification curve, while the fluorescence signals of other pathogens such as IBDV, NDV, AIV, and FAV, as well as the negative control, remained at the baseline level without significant increase. This indicates that the detection method of the present invention has high specificity for IBV, no cross-reaction with other common avian pathogens, no false positive results, and strong specificity and anti-interference ability.
[0094] Example 7. Repeatability test of the RAA-CRISPR / Cas13a detection method
[0095] Select 10 6 10 3 10 1Three high, medium, and low concentrations of IBV standard nucleic acid (copies / μL) were used for three repeated detections using the method of this invention, with three parallel wells set up each time. The results are shown in Table 8. The intra-assay coefficient of variation of the fluorescence detection method was less than 5%, and the inter-assay coefficient of variation was less than 10%, indicating that the method has good repeatability and high stability.
[0096] Table 8 Results of intra-batch and inter-batch repeatability tests
[0097]
[0098] Example 8. Clinical Sample Testing
[0099] After completing the initial construction and evaluation of the CRISPR / Cas13a detection system, an artificial IBV infection model in chicks was established to prepare simulated clinical samples in order to further evaluate the clinical applicability of this method. SPF eggs were first incubated in an incubator for 21 days, and then isolated and raised until 14 days of age. Negative pharyngeal and anal swabs were collected from all chicks for 7 consecutive days before challenge. After collection, challenge was performed using nasal and ocular drops. The challenge virus was allantoic fluid passaged and propagated in the allantoic cavity of chicken embryos, diluted 10-fold with sterile PBS, 0.2 mL per chick. Two chicks were inoculated with the TW attenuated strain, two with the QX attenuated strain, and one with the 4 / 91 attenuated strain. The TW, QX, and 4 / 91 attenuated strains of infectious bronchitis were preserved in the laboratory. Chicks were isolated and grouped separately to avoid cross-contamination.
[0100] After successfully establishing an infectious bronchitis virus (IBV) infection model in chickens, 38 pharyngeal and cloacal swab samples were collected from IBV-infected chickens. These samples were detected using the RAA-CRISPR / Cas13a fluorescence detection method of this invention and the traditional qPCR method, respectively. The positive detection rate was calculated, and the results are shown in Table 9.
[0101] Table 9 Comparison of detection rates between qPCR and CRISPR / Cas13a
[0102] qPCR 20 18 38 100% RT-RAA-CRISPR-Cas13a 20 18 38 100% RT-RAA-CRISPR-Cas13a Sideflow Chromatography Test Paper 17 21 38 92.11%
[0103] qPCR detected 20 positive samples and 18 negative samples, with a concordance rate of 100%.
[0104] The fluorescence detection method detected 20 positive samples and 18 negative samples, with a concordance rate of 100%.
[0105] The results show that the detection method of the present invention has good consistency with the traditional qPCR method and can meet the needs of clinical IBV nucleic acid detection.
[0106] As can be seen from the above embodiments, the present invention provides a detection kit and method for chicken infectious bronchitis virus RAA-CRISPR / Cas13a. The method has high specificity, high sensitivity, good repeatability, and a 100% concordance rate with clinical qPCR detection.
[0107] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A detection kit for chicken infectious bronchitis virus RAA-CRISPR / Cas13a, characterized in that, The following reagents are included: RAA primer set for amplifying the conserved sequence of the IBV N gene, LwCas13a protein, crRNA targeting the IBV N gene, and reporter probe. Each reagent is packaged separately. The sequences of the primer set are shown in SEQ ID NO.3 and SEQ ID NO.2, and the sequence of the crRNA is shown in SEQ ID NO.5; The reporting probe is 5'-FAM-UUUUU-BHQ1-3'.
2. The reagent kit according to claim 1, characterized in that, The kit also includes isothermal amplification reaction reagents and nucleic acid extraction reagents.
3. A method for detecting chicken infectious bronchitis virus RAA-CRISPR / Cas13a for non-diagnostic purposes, characterized in that, Includes the following steps: (1) Extract nucleic acid from the sample to be tested; (2) The conserved sequence of the IBV N gene is amplified by RAA isotherm using the RAA primer set described in claim 1 to obtain the amplification product; (3) The amplification product was mixed with LwCas13a protein, crRNA and fluorescent reporter probe for CRISPR / Cas13a cleavage reaction; (4) Detect fluorescence signals to determine whether the sample contains chicken infectious bronchitis virus.
4. The detection method according to claim 3, characterized in that, The RAA isothermal amplification was performed at a temperature of 36-38°C for 28-32 minutes.
5. The detection method according to claim 3, characterized in that, In the CRISPR / Cas13a cleavage reaction system, the concentration of LwCas13a protein was 110-130 nM, crRNA1 was 40-60 nM, and the fluorescent reporter probe was 480-520 nM.
6. The detection method according to claim 3, characterized in that, The CRISPR / Cas13a cleavage reaction is carried out at a temperature of 36–38 °C for 58–62 min.