Conserved molecular switch of cytoplasmic alkaline convertase CINV and its application in regulating CINV activity.

Abstract

This invention discloses a conserved molecular switch for the plant cytoplasmic alkaline invertase CINV and its application in regulating CINV activity. The conserved molecular switch for CINV is a C-terminal hexapeptide of CINV, characterized by a six-amino acid sequence: [K / R / A / P / T]RSXSW, where X represents any amino acid. Changes in the activity of CINV in the plant cytoplasm alter the sugar concentration in sink tissues (young leaves, roots, stems, flowers, fruits, seeds, tubers, and other unusual organs), thereby triggering specific gene expression and physiological responses. This couples the plant's nutritional status with processes such as growth and development, and stress response, ultimately affecting the biomass or yield of the sink organs.

Description

Technical Field

[0001] This invention belongs to the field of biology, specifically relating to a conserved molecular switch of the cytoplasmic alkaline convertase CINV and its application in regulating the activity of CINV in the cytoplasm. Background Technology

[0002] Cytosolic neutral / alkaline invertase (CINV) (also known as Cytosolic CIN; β-type CIN; Cytosolic N / A-Invs; β-type N / A-Invs) is a key enzyme in sucrose metabolism, and its activity is crucial for crop growth.

[0003] To date, only two articles have reported the regulatory mechanisms of cytoplasmic neutral / alkaline convertases, both discovered in the model plant Arabidopsis thaliana. One article found that the Arabidopsis 14-3-3 protein can interact with AtCINV1 and promote its activity (https: / / doi.org / 10.1111 / tpj.12677); the other found that the Arabidopsis PIP5K9 can interact with AtCINV1 and negatively regulate its activity (https: / / doi.org / 10.1105 / tpc.106.045658). However, the regulatory mechanisms of these studies are unclear and have no breeding application value. Summary of the Invention

[0004] This invention discovers a conserved regulatory sequence (molecular switch) consisting of 6 amino acids in CINVs of all terrestrial plants. By editing its amino acid sequence, the activity of the enzyme can be positively or negatively regulated, thereby finely regulating the growth, development and yield of plants.

[0005] Based on this, the present invention provides a conserved molecular switch for the alkaline invertase CINV in plant cytoplasm and its application.

[0006] The conserved molecular switch for the cytoplasmic alkaline convertase CINV is a conserved six-amino acid sequence found in the C-terminal domain of the plant CINV protein: [K / R / A / P / T]RSXpSW, where X represents any amino acid and pS represents phosphorylated serine. The first position is either K-lysine, R-arginine, A-alanine, P-proline, or T-threonine; the second position is R-arginine; the third position is S-serine; the fourth position can be any amino acid; the fifth position is phosphorylated serine; and the sixth position is W-tryptophan. This six-amino acid hexamer motif interacts with the active site (GH100) of the CINV enzyme, thereby inhibiting enzyme activity. Therefore, this hexamer is the molecular switch regulating CINV enzyme activity. The degree of promotion or inhibition of enzyme activity is related to the strength of the interaction between the hexamer and the active site.

[0007] This invention reveals that the interaction strength between the hexamer (TRSVSW) of CINVs in lower plants (such as charophytes) and GH100 is weak, resulting in a weak self-inhibition effect. With the gradual evolution of terrestrial plants, the interaction strength between the hexamer (TRSASW) of bryophyte CINVs, the CINVs (PRSASW) of ferns, and the CINVs (KRSASW) of higher plants and GH100 has gradually increased, leading to a stronger self-inhibition effect.

[0008] Specifically, for example, Arabidopsis thaliana ( Arabidopsis thaliana The conserved molecular switch sequence of AtCINV1 is KRSASW, which is the amino acid sequence from the N-terminus of sequence SEQ ID No. 10, positions 543-548; (Brazilian rubber tree ( Hevea brasiliensis The conserved molecular switch sequence of HbNIN2 is KRSSSW, which is the amino acid sequence from the N-terminus of sequence SEQ ID No. 11, positions 550-555; rice ( Oryza sativa The conserved molecular switch sequence of L.)OsCYT-INV1 is KRSASW, which is the amino acid sequence from the N-terminus of sequence SEQ ID No. 12, positions 555-560; Ginkgo ( Ginkgo biloba The conserved molecular switch sequence of GbCINV1 is TRSVSW, which is the amino acid sequence from the N-terminus of sequence SEQ ID No. 13, positions 571-576; *Adiantum capillus-veneris* (Water Fern) Ceratopteris richardii The conserved molecular switch sequence of CrCINV1 is TRSASF, which is the amino acid sequence from the N-terminus of sequence SEQ ID No. 14, positions 559-564; *Sclerotium spp.* Physcomitrium patens The conserved molecular switch sequence of PpCINV1 is TRSASW, which is the amino acid sequence from the N-terminus of sequence SEQ ID No. 15, positions 560-565; SM algae ( Spirogloea muscicola The conserved molecular switch sequence of SmCINV1 is TRSNSW, which is the amino acid sequence from the N-terminus of sequence SEQ ID No. 16, positions 537-542; Kerria ( Klebsormidium nitens The conserved molecular switch sequence of KnCINV1 is TRSVSW, which is the amino acid sequence from the N-terminus of sequence SEQ ID No. 17, positions 596-601.

[0009] The application of the conserved molecular switch of the cytoplasmic alkaline convertase CINV in regulating the activity of CINV in the cytoplasm is also within the scope of protection of this invention. The application is to mutate the first position from the N-terminus of the conserved molecular switch, so that it is mutated from T to K, or from K to T.

[0010] Meanwhile, we also found that CINV proteins in all plants have self-inhibitory properties. The nitrogen-terminus, carbon-terminus, or both ends can interact with the active site, thereby inhibiting enzyme activity. If any one end or both ends are removed, enzyme activity can be increased.

[0011] This invention also provides a method for increasing the activity of the alkaline invertase CINV in plant cytoplasm, characterized in that it is achieved by relieving the self-inhibition of CINV in plants, and is selected from any one or more of the following: (1) The N-terminal self-inhibition region of CINV in plants is missing. (2) The C-terminal self-inhibition region of CINV in plants is missing. (3) The N-terminal and C-terminal self-inhibition regions of CINV in plants are missing, while the complete GH100 catalytic domain is preserved; (4) The conserved molecular switch described in the CINV of plants is mutated from threonine T to lysine K at the first position from the N-terminus.

[0012] In one embodiment of the invention, the plant includes Arabidopsis thaliana (… Arabidopsis thaliana Brazilian rubber tree () Hevea brasiliensis ), rice ( Oryza sativa L.), Ginkgo ( Ginkgo biloba ), water fern ( Ceratopteris richardii ), Small bowl moss ( Physcomitrium patens ), SM algae ( Spirogloea muscicola ), Kryptospira ( Klebsormidium nitens ) and Chlorella vulgaris ( Chlorokybus atmophyticus One of them.

[0013] Among them, Arabidopsis thaliana ( Arabidopsis thalianaThe amino acid sequence of CINV of SEQ ID No. 10 is shown in SEQ ID No. 10, wherein amino acid residues 1-84 from the N-terminus of SEQ ID No. 10 constitute the N-terminal self-inhibition region, amino acid residues 84-535 from the N-terminus of SEQ ID No. 10 constitute the GH100 catalytic domain, and amino acid residues 535-551 from the N-terminus of SEQ ID No. 10 constitute the C-terminal self-inhibition region; Brazilian rubber tree ( Hevea brasiliensis The amino acid sequence of CINV of rice is shown in SEQ ID No. 11. The N-terminal amino acid residues 1-91 of SEQ ID No. 11 constitute the N-terminal self-inhibition region, the N-terminal amino acid residues 91-542 of SEQ ID No. 11 constitute the GH100 catalytic domain, and the N-terminal amino acid residues 542-557 of SEQ ID No. 11 constitute the C-terminal self-inhibition region. Oryza sativa The amino acid sequence of CINV of Ginkgo biloba (L.) is shown in SEQ ID No. 12. The N-terminal amino acid residues 1-98 of SEQ ID No. 12 constitute the N-terminal self-inhibition region, the N-terminal amino acid residues 98-544 of SEQ ID No. 12 constitute the GH100 catalytic domain, and the N-terminal amino acid residues 544-562 of SEQ ID No. 12 constitute the C-terminal self-inhibition region. Ginkgo biloba The amino acid sequence of CINV of ) is shown in SEQ ID No. 13. The N-terminal amino acid residues 1-113 of SEQ ID No. 13 constitute the N-terminal self-inhibition region, the N-terminal amino acid residues 113-563 of SEQ ID No. 13 constitute the GH100 catalytic domain, and the N-terminal amino acid residues 563-578 of SEQ ID No. 13 constitute the C-terminal self-inhibition region; (Water fern ( ) Ceratopteris richardii The amino acid sequence of CINV of SEQ ID No. 14 is shown in SEQ ID No. 14. The first 101 amino acid residues from the N-terminus of SEQ ID No. 14 constitute the N-terminal self-inhibition region, the 101-551 amino acid residues from the N-terminus of SEQ ID No. 14 constitute the GH100 catalytic domain, and the 551-564 amino acid residues from the N-terminus of SEQ ID No. 14 constitute the C-terminal self-inhibition region. (Note: The last part about *Moss sphaerocephala* appears to be unrelated and likely refers to another part of the text.) Physcomitrium patens The amino acid sequence of CINV is shown in SEQ ID No. 15. The first 104 amino acid residues from the N-terminus of SEQ ID No. 15 constitute the N-terminal self-inhibition region, the 104-550 amino acid residues from the N-terminus of SEQ ID No. 15 constitute the GH100 catalytic domain, and the 550-567 amino acid residues from the N-terminus of SEQ ID No. 15 constitute the C-terminal self-inhibition region. Spirogloea muscicolaThe amino acid sequence of CINV is shown in SEQ ID No. 16. The N-terminal amino acid residues 1-77 of SEQ ID No. 16 constitute the N-terminal self-inhibition region, the N-terminal amino acid residues 77-525 of SEQ ID No. 16 constitute the GH100 catalytic domain, and the N-terminal amino acid residues 525-544 of SEQ ID No. 16 constitute the C-terminal self-inhibition region. (Kreephyra) Klebsormidium nitens The amino acid sequence of CINV of SEQ ID No. 17 is shown in SEQ ID No. 17. The N-terminal amino acid residues 1-131 of SEQ ID No. 17 constitute the N-terminal self-inhibition region, the N-terminal amino acid residues 131-587 of SEQ ID No. 17 constitute the GH100 catalytic domain, and the N-terminal amino acid residues 587-607 of SEQ ID No. 17 constitute the C-terminal self-inhibition region; *Chlorella vulgaris* ( Chlorokybus atmophyticus The amino acid sequence of CINV is shown in SEQ ID No. 18. The N-terminal amino acid residues 1-219 of SEQ ID No. 18 are the N-terminal self-inhibition region, the N-terminal amino acid residues 219-678aa of SEQ ID No. 17 are the GH100 catalytic domain, and the N-terminal amino acid residues 678-717 of SEQ ID No. 17 are the C-terminal self-inhibition region.

[0014] This invention also provides a highly active alkaline invertase in plant cytoplasm, characterized in that it is selected from: (1) A truncated protein of plant cytoplasmic alkaline invertase CINV that lacks the N-terminal self-inhibition region and / or the C-terminal self-inhibition region and retains the GH100 catalytic domain; (2) The conserved molecular switch of the C-terminal self-inhibition region of the plant cytoplasm alkaline invertase CINV is a mutant protein with lysine K at the first position from the N-terminus.

[0015] The conserved molecular switch of plant cytoplasmic alkaline invertase CINV and its application in regulating the activity of cytoplasmic alkaline invertase CINV, the method for increasing the activity of plant cytoplasmic alkaline invertase CINV, and the application of the highly active plant cytoplasmic alkaline invertase in crop genetic improvement, improving sucrose utilization efficiency, promoting growth and development, enhancing stress resistance, and increasing biomass or yield are also within the scope of protection of this invention.

[0016] The plants mentioned include Arabidopsis thaliana, rice, Brazilian rubber tree, ginkgo, water fern, small bowl moss, corn, wheat, potato, vegetables and fruit trees, etc.

[0017] Specifically, the present invention also provides a method for promoting plant growth, characterized by comprising any one or more of the following steps: (1) Edit the plant endogenous CINV gene to make its N-terminal self-repressed region and / or self-repressed region, C-terminal repression region missing, or perform gene editing on the conserved molecular switch of the C-terminal self-repressed region of the plant cytoplasm alkaline invertase CINV as described in claim 1 or 2; (2) Overexpressing the highly active plant alkaline invertase of claim 7 in plants; Preferably, the plant is Arabidopsis thaliana, Arabidopsis thaliana ( Arabidopsis thaliana The amino acid sequence of CINV of Arabidopsis thaliana is shown in SEQ ID No. 10, wherein amino acid residues 1-84 from the N-terminus of SEQ ID No. 10 constitute the N-terminal self-inhibition region, amino acid residues 84-535 from the N-terminus of SEQ ID No. 10 constitute the GH100 catalytic domain, and amino acid residues 535-551 from the N-terminus of SEQ ID No. 10 constitute the C-terminal self-inhibition region; Arabidopsis thaliana The conserved molecular switch sequence of CINV is KRSASW, which is the amino acid sequence from the N-terminus of sequence SEQ ID No. 10, positions 543-548.

[0018] In summary, the above-mentioned applications can regulate the activity of alkaline invertase CINV in the cytoplasm. Changes in the activity of plant cytosolic invertase (CINV) can alter the sugar concentration in sink tissues (young leaves, roots, stems, flowers, fruits, seeds, tubers, and other atypical organs), thereby triggering specific gene expression and physiological responses, coupling the plant's nutritional status with processes such as growth and development and stress response, and ultimately affecting the biomass or yield of sink organs. This is mainly manifested in the following aspects: (1) promoting plant growth and development and morphogenesis; (2) regulating carbon allocation and metabolism; (3) participating in osmotic regulation and enhancing tolerance to abiotic stress; and (4) participating in sugar signal transduction. Attached Figure Description

[0019] Figure 1 This is a schematic diagram of the predicted functional domains of CINV in nine plant species; the gray areas represent the N-terminal regulatory region (N) and the C-terminal regulatory region (C), respectively, and the blue area is the conserved Glyco_hydro_100 catalytic domain; the numbers above indicate the start and end positions of the amino acids in the domain, and the right side indicates the total protein length (aa).

[0020] Figure 2 SDS-PAGE analysis of full-length and truncated AtCINV1 recombinant proteins expressed in prokaryotes and detection of enzyme activity in purified proteins. (A) SDS-PAGE gel electrophoresis detection of recombinant proteins expressed in prokaryotes. Lane 1: AtCINV1 (1-551 aa)-pMALc5E, Lane 2: AtCINV1 (1-535 aa)-pMALc5E, Lane 3: AtCINV1 (84-535 aa)-pMALc5E, Lane 4: AtCINV1 (84-551 aa)-pMALc5E, Lane 5: Bovine serum albumin (BSA). Red arrows indicate the expected location of the target protein in each lane. (B) Enzyme activity analysis of recombinant fusion proteins expressed and purified in prokaryotes.

[0021] Figure 3 (A) Enzyme activity and function analysis of AtCINV1 full-length and truncated yeast heterologous expression; (B) Gray value analysis of protein expression abundance (Flag-tagged antibody) by Western Blot detection; (C) Enzyme activity analysis of crude enzyme solution of functionally complementary yeast; (D) Spot assay of functionally complementary SEY6210.

[0022] Figure 4 SDS-PAGE analysis of the full-length HbNIN2 and its truncated recombinant protein expressed in prokaryotes and enzyme activity detection of the purified protein; (A) SDS-PAGE electrophoresis detection of the prokaryotic recombinant protein. Lane 1: HbNIN2-FL-pMALc5E, Lane 2: HbNIN2-ΔC-pMALc5E, Lane 3: HbNIN2-ΔNC-pMALc5E, Lane 4: HbNIN2-ΔN-pMALc5E, Lane 5: Bovine serum albumin (BSA). Red arrows indicate the expected location of the target fusion protein in each lane. (B) Enzyme activity analysis of the purified protein.

[0023] Figure 5 Enzyme activity analysis of full-length HbNIN2 and its catalytic active domain GH100 truncated yeast heterologous expression.

[0024] Figure 6 SDS-PAGE analysis of the full-length OsCYT-INV1 and its truncated recombinant protein expressed in prokaryotes and enzyme activity detection of the purified protein; (A) SDS-PAGE electrophoresis of the prokaryotically expressed recombinant protein. Lane 1: OsCYT-INV1-FL-pMALc5E, Lane 2: OsCYT-INV1-ΔNC-pMALc5E, Lane 3: Bovine serum albumin (BSA). Red arrows indicate the expected location of the target fusion protein in each lane. (B) Enzyme activity analysis of the purified protein.

[0025] Figure 7 To analyze the heterologous expression, enzyme activity, and function of OsCYT-INV1 full-length, full-length, and truncated forms in yeast.

[0026] Figure 8 SDS-PAGE analysis of the full-length GbCINV1 and its truncated recombinant protein expressed in prokaryotes and enzyme activity detection of the purified protein; (A) SDS-PAGE electrophoresis detection of the prokaryotic recombinant protein. Lane 1: GbCINV1-FL-pMALc5E, Lane 2: GbCINV1-ΔNC-pMALc5E, Lane 3: Bovine serum albumin (BSA). Red arrows indicate the expected location of the target fusion protein in each lane. (B) Enzyme activity analysis of the purified protein.

[0027] Figure 9 Enzyme activity analysis of full-length GbCINV1 and its truncated GH100 yeast heterologous expression.

[0028] Figure 10 SDS-PAGE analysis of the full-length CrCINV1 and its truncated recombinant protein expressed in prokaryotes and enzyme activity detection of the purified protein; (A) SDS-PAGE electrophoresis detection of the prokaryotic recombinant protein. Lane 1: CrCINV1-FL-pMALc5E, Lane 2: CrCINV1-ΔC-pMALc5E, Lane 3: CrCINV1-ΔNC-pMALc5E, Lane 4: CrCINV1-ΔN-pMALc5E, Lane 5: Bovine serum albumin (BSA). Red arrows indicate the expected location of the target fusion protein in each lane. (B) Enzyme activity analysis of the purified protein.

[0029] Figure 11 To analyze the heterologous expression, enzyme activity, and function of full-length CrCINV1 and its truncated form in yeast; (A) Western blotting to detect protein expression abundance and grayscale analysis (Flag-tagged antibody); (B) Enzyme activity analysis of crude enzyme solution from functionally complementary yeast strains; (C) Spotting experiment of functionally complementary SEY6210 strain.

[0030] Figure 12 SDS-PAGE analysis of prokaryotic recombinant proteins of the full-length PpCINV1 and its truncated form; (A) SDS-PAGE electrophoresis detection of prokaryotic recombinant proteins. Lane 1: PpCINV1-FL-pMALc5E, Lane 2: PpCINV1-ΔNC-pMALc5E, Lane 3: Bovine serum albumin (BSA). Red arrows indicate the expected location of the target recombinant protein in each lane. (B) Enzyme activity analysis of purified proteins.

[0031] Figure 13 To analyze the heterologous expression, enzyme activity, and function of the full-length PpCINV1 and its truncated form in yeast.

[0032] Figure 14SDS-PAGE analysis of the full-length SmCINV1 and its truncated recombinant protein expressed in prokaryotes and enzyme activity detection of the purified protein; (A) SDS-PAGE gel electrophoresis detection of the prokaryotic recombinant protein. Lane 1: SmCINV1-pMALc5E, Lane 2: SmCINV1(1-525 aa)-pMALc5E, Lane 3: SmCINV1(77-525 aa)-pMALc5E, Lane 4: SmCINV1(77-544 aa)-pMALc5E, Lane 5: Bovine serum albumin (BSA). Red arrows indicate the expected location of the target fusion protein in each lane. (B) Enzyme activity analysis of the purified protein.

[0033] Figure 15 Enzyme activity analysis of full-length SmCINV1 and its catalytic active domain GH100 truncated yeast heterologous expression.

[0034] Figure 16 SDS-PAGE analysis of the full-length and truncated KnCINV1 prokaryotically expressed recombinant protein and enzyme activity detection of the purified protein; (A) SDS-PAGE electrophoresis detection of the prokaryotically expressed recombinant protein. Lane 1: KnCINV1-FL-pMALc5E, Lane 2: KnCINV1-ΔC-pMALc5E, Lane 3: KnCINV1-ΔNC-pMALc5E, Lane 4: KnCINV1-ΔN-pMALc5E, Lane 5: Bovine serum albumin (BSA). Red arrows indicate the expected location of the target fusion protein in each lane. (B) Enzyme activity analysis of the purified protein.

[0035] Figure 17 To analyze the heterologous expression, enzyme activity, and function of full-length KnCINV1 and its truncated form in yeast; (A) Western blotting analysis of protein expression abundance and grayscale values ​​(Flag-tagged antibody); (B) Enzyme activity analysis of crude enzyme solution from functionally complementary yeast strains.

[0036] Figure 18 SDS-PAGE analysis of the full-length CaCINV1 and its truncated recombinant protein expressed in prokaryotes and enzyme activity detection of the purified protein; (A) SDS-PAGE electrophoresis detection of the prokaryotic recombinant protein. Lane 1: CaCINV1-FL-pMALc5E, Lane 2: CaCINV1-ΔNC-pMALc5E, Lane 3: Bovine serum albumin (BSA). Red arrows indicate the expected location of the target fusion protein in each lane. (B) Enzyme activity analysis of the purified protein.

[0037] Figure 19 To analyze the heterologous expression, enzyme activity, and function of the full-length CaCINV1 and its truncated form in yeast.

[0038] Figure 20 Yeast double hetero interactions of Motif 13 and its point mutants with the catalytic domain GH100 were analyzed; (A) Y2H interaction analysis of AtMotif 13 and its point mutants with AtGH100; (B) Y2H interaction analysis of SmMotif 13 and its point mutants with SmGH100.

[0039] Figure 21 Enzyme activity analysis of crude enzyme solutions of CINV and its point mutants heterologously expressed in SEY6210; (A) Enzyme activity analysis of AtCINV1 and its point mutants; (B) Enzyme activity analysis of SmCINV1 and its point mutants.

[0040] Figure 22 Spotting assay for functional complementation of CINV and its point mutant SEY6210.

[0041] Figure 23 An ancestral hexapeptide variant that simultaneously enhances enzyme activity and plant growth; (A) Analysis of Arabidopsis thaliana genotype roots by RT-qPCR. CINV1 Transcript levels. The 2^(–ΔCT) method was used to measure housekeeping genes. ACT8 Expression levels were normalized for the internal control. Data are mean ± standard error (n=3). Differences between groups were determined using Student's t-test (** indicates P < 0.01). (B) Invertase activity in roots of the genotype shown. Data are mean ± standard deviation (n=3). (C) Seedling growth phenotype. Seeds were sown on 1 / 2 MS medium plates and grown vertically. Imaging observation was performed on day 9 after germination. (D) Mature plant phenotype. Seedlings were transplanted into soil on day 5 after germination and photographed on day 22 after germination. (E) Schematic diagram showing that modifying higher plant CINV with ancestral hexapeptide variants can reduce its autoinhibition, thereby simultaneously enhancing enzyme activity and promoting plant growth in Arabidopsis. Detailed Implementation

[0042] The present invention will be described in detail and completely below through specific embodiments, but this does not limit the invention in any way. Unless otherwise specified, the methods in the following embodiments are conventional methods.

[0043] Example 1: Removal of the nitrogen-terminus, carbon-terminus, or both ends of the CIV protein relieves its self-inhibitory properties and increases enzyme activity. We extracted CINV homologous proteins from representative plant species using published plant genome data. Nine representative CINV enzyme protein sequences were selected from lower to higher forms: three chain algae [*Cyclocarya spp.* (CaCINV1, Protein ID: Chrsp44S09054), *KnCINV1* (GAQ83843), *SmCINV1* (SM000130S27111)], one moss [*PpCINV1* (Pp3c10_23170)], one fern [*Ceric.28G004700* (CrCINV1)], and one gymnosperm [*Ginkgo biloba* (GbCINV1, Protein ID: GbCINV1).] [ID: evm.model.chr6.116], and three angiosperms [rubber tree (HbNIN2, Protein ID: ADC68260), rice (OsCYT-INV1, Protein ID: Os02g0550600), Arabidopsis thaliana (AtCINV1, Protein ID: NP_174791)]. We first discovered that these CINV proteins have self-inhibitory properties; the N-terminus, C-terminus, or both ends can interact with the active site, thereby inhibiting enzyme activity. If any one end or both ends are simultaneously removed (ΔN, ΔC, ΔNC), enzyme activity can be increased.

[0044] The specific verification method is as follows: Plant alkaline invertases exhibit enzyme activity self-inhibition. To verify the self-inhibition characteristics of these nine CINVs, we performed functional domain prediction on their protein sequences using the MPI Bioinformatics Toolkit (https: / / toolkit.tuebingen.mpg.de / ) online bioinformatics analysis platform. All CINVs consist of three parts: the N-terminus, the catalytic active domain GH100, and the C-terminus (…). Figure 1 ).

[0045] 1. Arabidopsis thaliana ( Arabidopsis thaliana AtCINV1 exhibits enzyme activity autoinhibition. (1) Enzyme activity analysis of full-length AtCINV1 and its different types of truncated variants expressed in prokaryotes Analysis of the AtCINV1 domains using the MPI Bioinformatics Toolkit online bioinformatics analysis platform showed that Arabidopsis thaliana ( Arabidopsis thalianaThe amino acid sequence of the alkaline convertase CINV (named AtCINV1) is shown in SEQ ID No. 10, with 1-84 aa being the N-terminus, 84-535 aa being the catalytic domain GH100 (i.e. AtGH100), and 535-551 aa being the C-terminus (Figure 1).

[0046] First, using the complete coding region of Arabidopsis thaliana AtCINV1 (CDS, SEQ ID No. 1 encodes the AtCINV1 protein shown in SEQ ID No. 10, nucleotides 1-252 from the 5' end of SEQ ID No. 1 encode the N-terminus of AtCINV1, nucleotides 253-1605 from the 5' end of SEQ ID No. 1 encode the catalytic active domain GF100 of AtCINV1, and nucleotides 1606-1656 from the 5' end of SEQ ID No. 1 encode the C-terminus of AtCINV1) as a template, amplification primers were designed for the full-length AtCINV1 (1-551 aa, FL), the C-terminal truncated form of AtCINV1 (AtCINV1(1-535 aa, ΔC), the C-terminal and N-terminal truncated form of AtCINV1 (84-535 aa, ΔNC), and the N-terminal truncated form of AtCINV1 (84-551 aa, ΔN). The sequences are as follows: AtCINV1 full-length (1-551 aa, FL) amplification primers: AtCINV1-FL-pMALc5E-F: 5′-GACGATGACAAGGTACCGCATATGATGGAAGGTGTTGGACTAAGAGC-3′; AtCINV1-FL-pMALc5E-R: 5′-ATTACCTGCAGGGAATTCGGATCCTCAATGGTGATGGTGATGATGGAGTTGTGGCCAAGACGC-3′.

[0047] C-terminal deletion truncated version of AtCINV1 (AtCINV1(1-535 aa, ΔC) amplification primers: AtCINV1-ΔC-pMALc5E-F: 5′-AAGGTACCGATGGAAGGTGTTGGACTAAGAGCTGTAG-3; AtCINV1-ΔC-pMALc5E-R: 5′-GTCGACTCAGTGATGATGATGATGATGGTCTTCTTCAAGAGAGATCATACC-3′.

[0048] AtCINV1 C-terminal and N-terminal truncated variants (84-535 aa, ΔNC) amplification primers: AtCINV1-ΔNC-pMALc5E-F: 5′-AAGGTACCGATGATGGCTGAAGCTTGGGAGGCTTTAAG-3′, AtCINV1-ΔNC-pMALc5E-R: 5′-GTCGACTCAGTGATGATGATGATGATGGTCTTCTTCAAGAGAGATCATACC-3′.

[0049] Primers for amplifying the N-terminal truncated form of AtCINV1 (84-551 aa, ΔN): AtCINV1-ΔN-pMALc5E-F: 5′-AAGGTACCGATGATGGCTGAAGCTTGGGAGGCTTTAAG-3′, AtCINV1-ΔN-pMALc5E-R: 5′-GTCGACTCAGTGATGATGATGATGATGGAGTTGTGGCCAAGACGCAGATCG-3′.

[0050] Using Arabidopsis root tissue cDNA as a template, and with the primers mentioned above, polymerase chain reaction (PCR) was used to amplify the full-length AtCINV1 (1-551 aa, FL), the truncated AtCINV1 (AtCINV1(1-535 aa, ΔC), AtCINV1(84-535 aa, ΔNC) and AtCINV1(84-551 aa, ΔN)).

[0051] The full-length AtCINV1 (1-551 aa, FL) obtained by PCR amplification was used... Nde I and BamH I double digestion inserted into pMALc5E plasmid Nde I and BamH Between the I enzyme recognition sites, a recombinant expression vector expressing the full length of AtCINV1 was obtained, named AtCINV1-FL-pMALc5E.

[0052] The truncated AtCINV1 variants obtained by PCR amplification (AtCINV1(1-535 aa, ΔC), the C-terminal and N-terminal truncated AtCINV1 (84-535 aa, ΔNC), and the N-terminal truncated AtCINV1 (84-551 aa, ΔN) were digested with KpnI and SalI and inserted into the KpnI and SalI recognition sites of the pMALc5E plasmid, respectively. This yielded recombinant expression vectors expressing the truncated AtCINV1 variant (AtCINV1(1-535 aa, ΔC)) (named AtCINV1-ΔC-pMALc5E), the C-terminal and N-terminal truncated AtCINV1 (84-535 aa, ΔNC) (named AtCINV1-ΔNC-pMALc5E), and the N-terminal truncated AtCINV1 (84-551 aa, ΔN). The recombinant expression vector for ΔN (named AtCINV1-ΔN-pMALc5E) was used. A 6 × His tag was added before each of these recombinant expression vectors to facilitate affinity enrichment and purification of the prokaryotically expressed recombinant fusion protein using His-tag magnetic beads.

[0053] The recombinant plasmid was transformed into a prokaryotic expression recombinant vector. BL21(DE3) competent cells were cultured in 2 mL centrifuge tubes containing 500 μL LB liquid medium (containing 100 mg / L carbenicillin) at 37 ℃ with shaking at 220 rpm until OD600≈0.4-0.6. The cells were collected and the prokaryotic expression recombinant fusion protein was enriched and purified using His-tag magnetic beads.

[0054] SDS-PAGE was used to detect the purity and integrity of the four prokaryotically expressed and purified recombinant fusion proteins within the molecular weight range of 25-180 kDa. ImageJ software was used to perform grayscale scanning of target protein bands (indicated by red arrows) that met the expected molecular weight. Figure 2 A), and using the gray value of the electrophoretic band of 3 μg bovine serum albumin as a standard reference, the concentration of the target protein in the HEPES reaction buffer after elution and dialysis replacement was calculated by quantitative analysis of the gray value to ensure the accuracy of enzyme activity determination.

[0055] Under enzymatic reaction conditions of 35℃ and pH 8, the enzyme activity of four recombinant fusion proteins AtCINV1 (approximately 107 kDa), AtCINV1 (1-535 aa) (approximately 105.5 kDa), AtCINV1 (84-535 aa) (approximately 96 kDa), and AtCINV1 (84-551 aa) (approximately 98 kDa), which were expressed and purified in the same batch of prokaryotes, was simultaneously analyzed.

[0056] CINV activity assay: The reaction system (100 µL) contained 50 mM HEPES-NaOH buffer (pH 8.0 or specified pH), 5 mM MgCl, 1 mM EDTA, 100 mM sucrose, and enzyme extract. After incubation at 30°C (or specified temperature) for 1 hour, the generated reducing hexose was quantified by adding 900 µL DNS. The control group underwent the same procedure using an equal volume of heat-inactivated enzyme extract.

[0057] Enzyme activity calculation: The hexose content in the reaction mixture was calculated based on the hexose concentration standard curve. The enzyme activity of the purified protein after prokaryotic expression was analyzed. CINV activity was expressed as μmol hexose·nmol -1 protein·min -1 Calculations were performed in units of hexose. The crude enzyme activity of the prokaryotic expression, heterologous expression (SEY6210), and Atcinv1cinv2 double mutant complementary lines was analyzed in μmol hexose·mg. -1 protein·min -1 Expressed in units.

[0058] The results showed that the enzyme activity of the GH100 protein containing only the AtCINV1 catalytic domain (84-535 aa, ΔNC) was the highest, while the enzyme activity of the full-length protein was the lowest, with a difference of nearly 9 times; the enzyme activity of the GH100 + C-terminal protein (84-551 aa, ΔN) was approximately twice that of the N-terminal + GH100 protein (1-535 aa, ΔC). Figure 2 B). The above results indicate that the N-terminus and C-terminus of AtCINV1 have a significant inhibitory effect on the enzyme activity of its GH100 domain. Both the N-terminus and C-terminus are self-inhibitory regions of AtCINV1, with the inhibitory effect of the N-terminus being significantly greater than that of the C-terminus.

[0059] (2) Enzyme activity analysis of yeast heterologous expression of full-length AtCINV1 and its truncated protein The enzyme activity analysis results of the above prokaryotic expression system confirmed that AtCINV1 exhibits autoinhibition. To investigate this phenomenon, AtCINV1 and its different types of truncated proteins were further expressed in a eukaryotic system (yeast SEY6210). The expression level of the target protein was detected by Western blotting using a 1× Flag tag added to the C-terminus of the recombinant protein.

[0060] Primers were designed based on the complete reading frame of AtCINV1. Using AtCINV1-FL-pMALc5E as a template, the target fragment was amplified by PCR. The double restriction enzyme sites for the vector used to insert the target gene were SpeI and SalI, respectively. AtCINV1 and its truncated variants AtCINV1(1-535 aa, ΔC), AtCINV1(84-535 aa, ΔNC), and AtCINV1(84-551 aa, ΔN) were constructed in pDR196 yeast using the restriction enzyme ligation method. The primer sequences are as follows (where the bolded and highlighted bases are the vector restriction enzyme site sequences, and the green highlighted part is the encoding sequence of the introduced 1×FLAG tag): Primers for constructing the full-length recombinant vector AtCINV1-FL-pDR196 expressing AtCINV1: AtCINV1-FL-pDR196-F: 5′-ACTAGTATGGAAGGTGTTGGACTAAGAGCTGTAGGAT-3′; AtCINV1-FL-pDR196-R: 5′-GTCGACTCACTTGTCGTCGTCGTCTTTGTAGTCGAGTTGTGGCCAAGACGCAGATCGCTTGATGACTG-3′; Primers for constructing the recombinant vector AtCINV1-ΔC-pDR196 of the truncated AtCINV1 (1-535 aa, ΔC): AtCINV1-ΔC-pDR196-F: 5′-ACTAGTATGGAAGGTGTTGGACTAAGAGCTGTAGGAT-3′; AtCINV1-ΔC-pDR196-R: 5′-GTCGACTCACTTGTCGTCGTCGTCTTTGTAGTCGTCTTCTTCAAGAGAGATCATACCAATGTGTGAAG-3′; Primers for constructing the recombinant vector AtCINV1-ΔNC-pDR196 of the truncated AtCINV1 (84-535 aa, ΔNC): AtCINV1-ΔNC-pDR196-F: 5′-ACTAGTATGATGGCTGAAGCTTGGGAGGCTTTAAGAAG-3′; AtCINV1-ΔNC-pDR196-R: 5′-GTCGACTCACTTGTCGTCGTCGTCTTTGTAGTCGTCTTCTTCAAGAGAGATCATACCAATGTGTGAAG-3′; Primers for constructing the recombinant vector AtCINV1-ΔN-pDR196 of the truncated AtCINV1 (84-551 aa, ΔN): AtCINV1-ΔN-pDR196-F: 5′-ACTAGTATGATGGCTGAAGCTTGGGAGGCTTTAAGAAG-3′; AtCINV1-ΔN-pDR196-R: 5′-GTCGACTCACTTGTCGTCGTCGTCTTTGTAGTCGAGTTGTGGCCAAGACGCAGATCGCTTGATGACTG-3′.

[0061] The recombinant vectors prepared above were transformed into competent yeast mutant SEY6210 cells using the PEG / LiAc method. After transformation, the bacterial culture was plated on SD / -Ura screening medium (containing 2% sucrose, which was sterilized by filtration through a 0.22 μm aqueous syringe filter) and incubated at 28℃ for 2-3 days. Single yeast colonies from the SD / -Ura + 2% sucrose solid medium were picked, and after positive colony PCR identification, they were inoculated into centrifuge tubes containing 1 mL of SD / -Ura + 2% sucrose liquid medium and cultured at 28℃ and 220 rpm for 48-72 h with shaking. 800 μL of activated positive clones were transferred to 300 mL of SD / -Ura + 2% sucrose liquid medium and cultured at 28℃ and 220 rpm for 48-72 h with shaking until the bacterial concentration (OD600 ≈ 1.0) reached 1.0. The cultured bacterial culture was then centrifuged at 8000 rpm for 8 hours using a floor-standing centrifuge. Collect the bacterial precipitate after 5 min; transfer the precipitate to a pre-cooled, clean mortar (placed on ice), add liquid nitrogen and grind thoroughly for 5 min. Transfer the ground bacterial powder to a 50 mL clean centrifuge tube, add 2 mL of HEPES enzyme activity reaction buffer, and resuspend thoroughly. Place the centrifuge tube in liquid nitrogen for rapid freezing, then transfer it to a 37°C water bath for rapid thawing. Repeat this freeze-thaw process 3 times to achieve physical cell disruption; homogenize the frozen-thawed bacterial cells in a pre-cooled floor-standing centrifuge and centrifuge at 4°C and 12000 rpm for 15 min. Carefully aspirate the supernatant, which is the crude enzyme solution of the yeast complementary strain, and then perform enzyme activity determination and Western blotting analysis according to the method in step (1).

[0062] The results showed no significant difference in the expression abundance of full-length AtCINV1 (FL) and its truncated proteins (ΔN, ΔC, and ΔNC) in the crude enzyme solution of expressing yeast (Figure 3A). Enzyme activity analysis was performed under enzymatic reaction conditions of 35℃ and pH 8. The results of enzyme activity analysis of the crude enzyme solution were similar to those of the prokaryotic expressed proteins: AtCINV1 exhibited significant autoinhibition, with synergistic inhibition between its N-terminus and C-terminus. The enzyme activity of ΔNC was approximately 14 times that of FL, and the enzyme activity of ΔN was approximately 5 times that of ΔC. Figure 3 B).

[0063] SEY6210 is a yeast mutant lacking invertase function, unable to grow on plates with sucrose as the sole carbon source. Transgenic functional complementation phenotypic analysis was performed on this yeast strain using AtCINV1 and its different truncated proteins. Fresh cultures of each yeast transformant strain were adjusted to the same OD600 concentration, serially diluted, and then spotted onto selection (2% Suc) and non-selection (2% Glc + Frc) SD / -Ura solid medium. Results showed that the yeast strain transformed with ΔNC exhibited the best growth on the selection medium, while the yeast strain transformed with FL showed the weakest growth. The growth order of the complementary yeast strains was ΔNC (84-535 aa) > ΔN (84-551 aa) > ΔC (1-535 aa) > FL (1-551 aa) (Figure 3C). The growth performance of the strains was consistent with the enzyme activity assays of AtCINV1 and its different truncated proteins, further confirming the autoinhibition phenomenon and characteristics of AtCINV1 enzyme activity.

[0064] 2. Brazilian rubber tree ( Hevea brasiliensis HbNIN2 exhibits enzyme activity self-inhibition. (1) Enzyme activity analysis of full-length HbNIN2 and its different types of truncated proteins expressed in prokaryotes Analysis of the HbNIN2 domain showed that: Brazilian rubber tree ( Hevea brasiliensis The amino acid sequence of the alkaline convertase CINV (named HbNIN2) is shown in SEQ ID No. 11, with 1-91 aa being the N-terminus, 91-542 aa being the catalytic domain GH100 (i.e. HbGH100), and 542-557 aa being the C-terminus (Figure 1).

[0065] First, using the complete coding region of rubber tree HbNIN2 (CDS, SEQ ID No. 2, encoding the HbNIN2 protein shown in SEQ ID No. 11; nucleotides 1-273 from the 5' end of SEQ ID No. 2 encode the N-terminus of HbNIN2, nucleotides 274-1626 from the 5' end of SEQ ID No. 2 encode the catalytic active domain GF100 of HbNIN2, and nucleotides 1627-1674 from the 5' end of SEQ ID No. 2 encode the C-terminus of HbNIN2) as a template, we designed the full-length HbNIN2 (1-557 aa, FL), the C-terminal truncated form of HbNIN2 (HbNIN2 (1-542 aa, ΔC), the C-terminal and N-terminal truncated forms of HbNIN2 (91-542 aa, ΔNC), and the N-terminal truncated form of HbNIN2 (91-557 aa, ΔNC). ΔN)) primers, the sequences are as follows: HbNIN2 full-length (1-557 aa, FL) amplification primers: HbNIN2-FL-pMALc5E-F: 5′-GACGATGACAAGGTACCGCATATGATGGATGGGACTAAAGAGGTGGGACTTAG-3′; HbNIN2-FL-pMALc5E-R: 5′-ATTACCTGCAGGGAATTCGGATCCTCAATGGTGATGGTGATGATGGCAAGTCCAAGAAGAAGATC-3′.

[0066] C-terminal deletion truncated version of HbNIN2 (HbNIN2(1-542 aa, ΔC) amplification primers: HbNIN2-ΔC-pMALc5E-F: 5′-AAGGTACCGATGGATGGGACTAAAGAGGTGGGACTTAG-3′; HbNIN2-ΔC-pMALc5E-R: 5′-GTCGACTCAGTGATGATGATGATGATGGTCCTCTTCCAGGGAAATCATTCC-3′.

[0067] HbNIN2 C-terminal and N-terminal truncated variants (91-542 aa, ΔNC) amplification primers: HbNIN2-ΔNC-pMALc5E-F: 5′-AAGGTACCGATGGTGGCTGATGCCTGGGAAGCACTAAG-3′; HbNIN2-ΔNC-pMALc5E-R: 5′-GTCGACTCAGTGATGATGATGATGATGGTCCTCTTCCAGGGAAATCATTCC-3′.

[0068] Primers for amplification of the N-terminal truncated variant of HbNIN2 (91-557 aa, ΔN): HbNIN2-ΔN-pMALc5E-F: 5′-AAGGTACCGATGGTGGCTGATGCCTGGGAAGCACTAAG-3′; HbNIN2-ΔN-pMALc5E-R: 5′-GTCGACTCAGTGATGATGATGATGATGGCAAGTCCAAGAAGAAGATCTCTTAATC-3′.

[0069] Using rubber tree tissue cDNA as a template, and with the primers mentioned above, HbNIN2 full-length (1-557 aa, FL), HbNIN2 C-terminal truncated variant (HbNIN2(1-542 aa, ΔC), HbNIN2 C-terminal and N-terminal truncated variant (91-542 aa, ΔNC), and HbNIN2 N-terminal truncated variant (91-557 aa, ΔN)) were obtained by polymerase chain reaction (PCR).

[0070] The full-length HbNIN2 (1-557 aa, FL) obtained by PCR amplification was used... Nde I and BamH I double digestion inserted into pMALc5E plasmid Nde I and BamH Between the I enzyme recognition sites, a recombinant expression vector expressing the full length of HbNIN2 was obtained, named HbNIN2-FL-pMALc5E.

[0071] The truncated HbNIN2 variants (HbNIN2(1-542 aa, ΔC), HbNIN2(91-542 aa, ΔNC), and HbNIN2(91-557 aa, ΔN)) obtained by PCR amplification were double-digested with KpnI and SalI and inserted into the KpnI and SalI recognition sites of the pMALc5E plasmid, respectively. This yielded recombinant expression vectors expressing the C-terminal truncated HbNIN2 variant (HbNIN2(1-542 aa, ΔC)) (named HbNIN2-ΔC-pMALc5E), the C-terminal and N-terminal truncated HbNIN2 variant (91-542 aa, ΔNC) (named HbNIN2-ΔNC-pMALc5E), and the N-terminal truncated HbNIN2 variant (91-557 aa, ΔN) (91-557 aa, ΔN)). The recombinant expression vector of ΔN (named HbNIN2-ΔN-pMALc5E) was used.

[0072] The recombinant plasmid was transformed into a prokaryotic expression recombinant vector. BL21(DE3) competent cells were cultured in 2 mL centrifuge tubes containing 500 μL LB liquid medium (containing 100 mg / L carbenicillin) at 37 ℃ with shaking at 220 rpm until OD600≈0.4-0.6. The cells were collected and the prokaryotic expression recombinant fusion protein was enriched and purified using His-tag magnetic beads.

[0073] Four recombinant fusion proteins, HbNIN2 (full-length, approximately 108 kDa), HbNIN2 C-terminal truncated variants (1-542 aa, ΔC) (approximately 106 kDa), HbNIN2 C-terminal and N-terminal truncated variants (91-542 aa, ΔNC) (approximately 96 kDa), and HbNIN2 N-terminal truncated variants (91-557 aa, ΔN) (approximately 98 kDa), expressed and purified in prokaryotes, were analyzed for purity and integrity by SDS-PAGE. Image J was used to perform grayscale scanning of the expected size bands (red arrows), and the target protein concentration in HEPES buffer was calculated using a 6 μg BSA band as a standard (Figure 4A).

[0074] Enzyme activity was analyzed under enzymatic reaction conditions of 45℃ and pH 7.5. The results showed that the GH100 protein containing only the HbNIN2 catalytic domain (91-542 aa, ΔNC) exhibited the highest enzyme activity, while the full-length protein (1-557 aa, FL) showed the lowest activity, with a difference of nearly 8 times. The enzyme activity of the GH100+ C-terminal protein (91-557 aa, ΔN) was approximately twice that of the N-terminal+ GH100 protein (1-542 aa, ΔC). Figure 4 B). The above results indicate that the N-terminus and C-terminus of HbNIN2 have a significant inhibitory effect on the enzyme activity of its GH100 domain. Both the N-terminus and C-terminus are self-inhibitory regions of HbNIN2, with the inhibitory effect of the N-terminus being significantly greater than that of the C-terminus.

[0075] (2) Enzyme activity analysis of full-length HbNIN2 and its GH100 protein heterologous expression in yeast The enzyme activity analysis results of the above prokaryotic expression system confirmed that HbNIN2 has a self-inhibition phenomenon.

[0076] Primers were designed based on the complete reading frame of HbNIN2. Using the HbNIN2-FL-pMALc5E plasmid as a template, the target fragment was amplified by PCR. The double restriction enzyme sites for the vector used to insert the target gene were SpeI and SalI, respectively. The pDR196 yeast expression vectors of HbNIN2 and its truncated form HbNIN2 (91-542 aa, ΔNC) were constructed using the restriction enzyme ligation method. The primer sequences are as follows (wherein, the primers incorporate the vector restriction enzyme site sequences and the 1×FLAG tag coding sequence): HbNIN2 full-length (1-557 aa, FL) amplification primers: HbNIN2-FL-pDR196-F: 5′-ACTAGTATGGATGGGACTAAAGAGGTGGGACTTAGGAATGTG-3′; HbNIN2-FL-pDR196-R: 5′-GTCGACTCACTTGTCGTCGTCGTCTTTGTAGTCGCAAGTCCAAGAAGAAGATCTCTTAATC-3′.

[0077] HbNIN2 C-terminal and N-terminal truncated variants (91-542 aa, ΔNC) amplification primers: HbNIN2-ΔNC-pDR196-F: 5′-ACTAGTATGGTGGCTGATGCCTGGGAAGCACTAAGACGGTCC-3′; HbNIN2-ΔNC-pDR196-R: 5′-GTCGACTCACTTGTCGTCGTCGTCTTTGTAGTCGTCCTCTTCCAGGGAAATCATTCCCAAAT-3′.

[0078] To investigate this phenomenon, the full-length HbNIN2 and its GH100 protein were further expressed in SEY6210. Under the enzymatic reaction conditions of 45℃ and pH 7.5, the enzyme activity analysis results of the crude enzyme solution were similar to those of the prokaryotic expressed protein: HbNIN2 exhibited obvious autoinhibition, with synergistic inhibition between its N-terminus and C-terminus, and the enzyme activity of ΔNC was approximately 7 times that of FL (Figure 5).

[0079] 3. Rice ( Oryza sativa L.)OsCYT-INV1 exhibits enzyme activity self-inhibition. (1) Enzymatic activity analysis of prokaryotic expression of the full-length OsCYT-INV1 and its GH100 protein. The analysis results of the OsCYT-INV1 domain showed that rice ( Oryza sativa The amino acid sequence of the alkaline convertase CINV (named OsCYT-INV1) of L. is shown in SEQ ID No. 12, with 1-98 aa being the N-terminus, 98-544 aa being the catalytic domain GH100 (i.e., OsGH100), and 544-562 aa being the C-terminus. Figure 1 ).

[0080] The target gene fragment was cloned using rice root tissue cDNA (CDS, SEQ ID No. 3, encoding the OsCYT-INV1 protein shown in SEQ ID No. 12, with nucleotides 1-294 from the 5' end of SEQ ID No. 3 encoding the N-terminus of OsCYT-INV1, nucleotides 295-1632 from the 5' end of SEQ ID No. 3 encoding the catalytic active domain GF100 of OsCYT-INV1, and nucleotides 1633-1689 from the 5' end of SEQ ID No. 3 encoding the C-terminus of OsCYT-INV1) as a template. The pMALc5E protein expression vector for OsCYT-INV1 and its truncated form was constructed using the restriction enzyme digestion and ligation method. The restriction enzyme sites inserted into the vector were NdeI and SalI. The primer sequences are as follows: OsCYT-INV1 full-length primers: OsCYT-INV1-FL-pMALc5E-F: 5′-CATATGATGGAGCTGGCGGTGGGAGCGGGCGGGAT-3′; OsCYT-INV1-FL-pMALc5E-R: 5′-GTCGACTTAGTGATGATGATGATGATGGTTTGTCCATGAGGCAGACCTCTTC-3′.

[0081] OsCYT-INV1 catalytic domain GH100 (98-544 aa, ΔNC) primers: OsCYT-INV1-ΔNC-pMALc5E-F: 5′-CATATGATGGGCGACGCCTGGGAGGCGCTCCGCCG-3′; OsCYT-INV1-ΔNC-pMALc5E-R: 5′-GTCGACTTAGTGATGATGATGATGATGAGTGATATCATTCCGAGATGAGAAGGGT-3′.

[0082] Following the method described in step 1, the recombinant expression vectors described above were expressed in prokaryotes, and the two recombinant fusion proteins, OsCYT-INV1 (approximately 108 kDa) and OsCYT-INV1 (98-544 aa) (approximately 98 kDa), were purified. Their purity and integrity were then assessed by SDS-PAGE. ImageJ was used to perform grayscale scanning of the expected size bands (red arrows), and the target protein concentration in the HEPES buffer was calculated using a 5 μg BSA band as a standard. Figure 6 A).

[0083] Enzyme activity was analyzed under enzymatic reaction conditions of 40℃ and pH 7.5. The results showed that the enzyme activity of the GH100 protein containing only the OsCYT-INV1 catalytic domain (98-544 aa, ΔNC) was approximately 10 times that of the full-length protein (1-562 aa, FL). Figure 6 B). The above results indicate that the N-terminus and C-terminus of OsCYT-INV1 have a significant inhibitory effect on the enzyme activity of its GH100 domain, and both the N-terminus and C-terminus are self-inhibitory regions of OsCYT-INV1.

[0084] (2) Enzyme activity analysis of full-length OsCYT-INV1 and its GH100 protein heterologous expression in yeast The target gene fragment was cloned using the rice OsCYT-INV1-FL-pMALc5E plasmid as a template. The OsCYT-INV1 and its truncated form pDR196 yeast expression vectors were constructed using the restriction enzyme digestion and ligation method. The insertion restriction sites for the vectors were SpeI and SalI. The primer sequences are as follows: OsCYT-INV1-FL-pDR196-F: 5′-ACTAGTATGGAGCTGGCGGTGGGAGCGGGCGGGATGC-3′; OsCYT-INV1-FL-pDR196-R: GTCGACTTACTTGTCGTCGTCGTCTTTGTAGTCGTTTGTCCATGAGGCAGACCTCTTC.

[0085] OsCYT-INV1-ΔNC-pDR196-F: 5′-ACTAGTATGGGCGACGCCTGGGAGGCGCTCCGCCGCTC-3′; OsCYT-INV1-ΔNC-pDR196-R: 5′-GTCGACTTACTTGTCGTCGTCGTCTTTGTAGTCTAGTGATATCATTCCGAGATGAGAAGG-3′.

[0086] The enzyme activity analysis results of the above prokaryotic expression system confirmed that OsCYT-INV1 exhibits autoinhibition. To investigate this phenomenon, the full-length OsCYT-INV1 and its GH100 protein were further expressed in SEY6210. Under the enzymatic reaction conditions of 40℃ and pH 7.5, the enzyme activity analysis results of the crude enzyme solution were similar to those of the prokaryotic expressed protein: OsCYT-INV1 exhibited significant autoinhibition, with synergistic inhibition between its N-terminus and C-terminus, and the enzyme activity of ΔNC was approximately 5.5 times that of FL (where ΔNC is much higher than FL). Figure 7 ).

[0087] 4. Ginkgo ( Ginkgo biloba GbCINV1 exhibits enzyme activity autoinhibition. (1) Enzymatic activity analysis of GbCINV1 full-length expression and its GH100 protein in prokaryotes. The analysis results of the GbCINV1 domain showed that: Ginkgo biloba ( Ginkgo biloba The amino acid sequence of the alkaline convertase CINV (named GbCINV1) is shown in SEQ ID No. 13, with 1-113 aa being the N-terminus, 113-563 aa being the catalytic domain GH100 (i.e. GbGH100), and 563-578 aa being the C-terminus (Figure 1).

[0088] The target gene fragment was cloned using Ginkgo biloba leaf tissue cDNA (CDS, SEQ ID No. 4, encoding the GbCINV1 protein shown in SEQ ID No. 13, with nucleotides 1-339 from the 5' end of SEQ ID No. 4 encoding the N-terminus of GbCINV1, nucleotides 340-1692 from the 5' end of SEQ ID No. 4 encoding the catalytic active domain GF100 of GbCINV1, and nucleotides 1693-1737 from the 5' end of SEQ ID No. 4 encoding the C-terminus of GbCINV1) as a template. GbCINV1 and its truncated variant pMALc5E protein expression vectors GbCINV1-FL-pMALc5E and GbCINV1-ΔNC-pMALc5E were constructed using the restriction enzyme ligation method. The vector insertion restriction sites were KpnI and SalI. The primer sequences are as follows: GbCINV1 full-length amplification primers: GbCINV1-FL-pMALc5E-F: 5′-AAGGTACCGATGCCTCTAGACATGTGGAGCATTTCCAC-3′; GbCINV1-FL-pMALc5E-R: 5′-GTCGACTCAGTGATGATGATGATGATGGCATGTCCAAGACACTGATCTGGTGAGGTG-3′.

[0089] Primers for C-terminal and N-terminal deletion truncated variant amplification of GbCINV1: GbCINV1-ΔNC-pMALc5E-F: 5′-AAGGTACCGATGGTTGCCGATGCTTGGGAGACTTTGCG-3′; GbCINV1-ΔNC-pMALc5E-R: 5′-GTCGACTCAGTGATGATGATGATGATGGTCCTCCTCTAGTGATATCATGCCCAAGT-3′.

[0090] Following the method described in step 1, the recombinant expression vector prepared above was expressed in BL21(DE3) prokaryotes, and the two recombinant fusion proteins, GbCINV1 (approximately 109 kDa) and GbCINV1 (113-563 aa) (approximately 98 kDa), were purified. Their purity and integrity were detected by SDS-PAGE. Furthermore, ImageJ was used to perform grayscale scanning of the expected size bands (red arrows), and the target protein concentration in the HEPES reaction buffer was calculated using a 6 μg BSA band as a standard. Figure 8 A).

[0091] Enzyme activity was analyzed under enzymatic reaction conditions of 40℃ and pH 7.5. The results showed that the enzyme activity of the GH100 protein containing only the GbCINV1 catalytic domain (113-563 aa, ΔNC) was approximately 10 times that of the full-length protein (1-578 aa, FL). Figure 8 B). The above results indicate that the N-terminus and C-terminus of GbCINV1 have a significant inhibitory effect on the enzyme activity of its GH100 domain, and both the N-terminus and C-terminus are self-inhibitory regions of GbCINV1.

[0092] (2) Enzyme activity analysis of full-length GbCINV1 and its GH100 protein heterologous expression in yeast The target gene fragment was cloned using the GbCINV1-FL-pMALc5E plasmid as a template. The yeast expression vectors GbCINV1-FL-pDR196 and GbCINV1-ΔNC-pDR196, containing GbCINV1 and its truncated form, were constructed using the restriction enzyme digestion and ligation method. The restriction enzyme sites inserted into the vectors were SpeI and SalI. The primer sequences are as follows: GbCINV1 full-length amplification primers: GbCINV1-FL-pDR196-F: 5′-ACTAGTATGCCTCTAGACATGTGGAGCATTTCCACG-3′; GbCINV1-FL-pDR196-R: 5′-GTCGACTCACTTGTCGTCGTCGTCTTTGTAGTCGCATGTCCAAGACACTGATCTGGTGAG-3′.

[0093] Primers for C-terminal and N-terminal deletion truncated variant amplification of GbCINV1: GbCINV1-ΔNC-pDR196-F: 5′-ACTAGTATGGTTGCCGATGCTTGGGAGACTTTGCG-3′; GbCINV1-ΔNC-pDR196-R: 5′-GTCGACTCACTTGTCGTCGTCGTCTTTGTAGTCGTCCTCCTAGTGATATCATGCCCAAG-3′.

[0094] The enzyme activity analysis results of the above prokaryotic expression system confirmed that GbCINV1 exhibits autoinhibition. To investigate this phenomenon, the full-length GbCINV1 and its GH100 protein were further expressed in SEY6210. Under the enzymatic reaction conditions of 40℃ and pH 7.5, the enzyme activity analysis results of the crude enzyme solution were similar to those of the prokaryotic expressed protein: GbCINV1 exhibited obvious autoinhibition, with synergistic inhibition between its N-terminus and C-terminus, and the enzyme activity of ΔNC was approximately 5.7 times that of FL (Figure 9).

[0095] 5. Water fern ( Ceratopteris richardii ) CrCINV1 exhibits enzyme activity self-inhibition phenomenon (1) Enzyme activity analysis of full-length CrCINV1 and different types of truncated proteins expressed in prokaryotes Analysis of the CrCINV1 domain showed that: (The text abruptly ends here, likely due to an incomplete sentence or missing information.) Ceratopteris richardii The amino acid sequence of the alkaline convertase CINV (named CrCINV1) is shown in SEQ ID No. 14, with 1-101 aa being the N-terminus, 101-551 aa being the catalytic domain GH100 (i.e. CrGH100), and 551-564 aa being the C-terminus (Figure 1).

[0096] The target gene fragment was cloned using cDNA from *Fernonia aquatici* leaf tissue (CDS, SEQ ID No. 5, encoding the CrCINV1 protein shown in SEQ ID No. 14, with nucleotides 1-303 from the 5' end of SEQ ID No. 5 encoding the N-terminus of CrCINV1, nucleotides 304-1653 from the 5' end of SEQ ID No. 5 encoding the catalytic active domain GF100 of CrCINV1, and nucleotides 1654-1695 from the 5' end of SEQ ID No. 5 encoding the C-terminus of CrCINV1) as a template. The full-length CrCINV1 and its truncated pMALc5E protein expression vectors CrCINV1-FL-pMALc5E, CrCINV1-ΔN-pMALc5E, CrCINV1-ΔNC-pMALc5E, and CrCINV1-ΔC-pMALc5E were constructed using the restriction enzyme ligation method. The vector insertion restriction sites were KpnI and SalI. The primer sequences are as follows: Full-length (1-564 aa, FL) amplification primers for CrCINV1: CrCINV1-FL-pMALc5E-F: 5′-AAGGTACCGATGCCCTCAAATATGTTGGCCGATCGGAT-3′; CrCINV1-FL-pMALc5E-R: 5′-GTCGACTTAGTGATGATGATGATGATGGAAAGAAGCCGACCTGGTTAGAGTGGGC-3′.

[0097] C-terminal deletion truncated version of CrCINV1 (1-551 aa, ΔC) amplification primers: CrCINV1-ΔN-pMALc5E-F: 5′-AAGGTACCGATGCCCTCAAATATGTTGGCCGATCGGAT-3′; CrCINV1-ΔN-pMALc5E-R: 5′-GTCGACTTAGTGATGATGATGATGATGATGGAAAGAAGCCGACCTGGTTAGAGTGGGC-3′.

[0098] C-terminal and N-terminal deletions of CrCINV1 truncated variants (101-551aa, ΔNC) amplification primers: CrCINV1-ΔNC-pMALc5E-F: 5′-AAGGTACCGATGCTAATTGATGCTTGGGAAGCTCTTAG-3′; CrCINV1-ΔNC-pMALc5E-R: 5′-GTCGACTTAGTGATGATGATGATGGTCCTCCTCCAAGGCAATCATGCCAAG-3′.

[0099] Amplification primers for the N-terminal deletion truncated form of CrCINV1 (101–564 aa, ΔN): CrCINV1-ΔC-pMALc5E-F: 5′-AAGGTACCGATGCCCTCAAATATGTTGGCCGATCGGAT-3′; CrCINV1-ΔC-pMALc5E-R: 5′-GTCGACTTAGTGATGATGATGATGGTCCTCCTCCAAGGCAATCATGCCAAG-3′.

[0100] Following the method described in step 1, the recombinant expression vector prepared above was expressed and purified in BL21(DE3) prokaryotes. The resulting four recombinant fusion proteins, CrCINV1 (approximately 109 kDa), CrCINV1(1-551 aa) (approximately 107 kDa), CrCINV1(101-551 aa) (approximately 96 kDa), and CrCINV1(101-564 aa) (approximately 97 kDa), were then analyzed for purity and integrity using SDS-PAGE. Furthermore, ImageJ was used to perform grayscale scanning of the expected size bands (red arrows), and the target protein concentration in the HEPES reaction buffer was calculated using a 6 μg BSA band as a standard. Figure 10 A).

[0101] Enzyme activity analysis was performed under enzymatic reaction conditions of 30℃ and pH 7.5. The results showed that the GH100 protein containing only the CrCINV1 catalytic domain (101-551 aa, ΔNC) exhibited the highest enzyme activity, while the full-length protein (1-564 aa, FL) showed the lowest activity, with a difference of nearly 10.5 times. The enzyme activity of the GH100 + C-terminal protein (101-564 aa, ΔN) was approximately 5.2 times that of the N-terminal + GH100 protein (1-551 aa, ΔC) (Figure 10B). These results indicate that the N-terminus and C-terminus of CrCINV1 significantly inhibit the enzyme activity of its GH100 domain; both the N-terminus and C-terminus are self-inhibitory regions of CrCINV1, with the N-terminus showing a significantly greater inhibitory effect than the C-terminus.

[0102] (2) Enzyme activity analysis of yeast heterologous expression of full-length CrCINV1 and its truncated protein The enzyme activity analysis results of the above prokaryotic expression system confirmed that CrCINV1 exhibits self-inhibition.

[0103] The target gene fragment was cloned using the CrCINV1-FL-pMALc5E plasmid as a template. Yeast expression vectors CrCINV1-FL-pDR196, CrCINV1-ΔN-pDR196, CrCINV1-ΔNC-pDR196, and CrCINV1-ΔC-pDR196 were constructed using the restriction enzyme digestion and ligation method. The vector insertion restriction sites were SpeI and SalI. The primer sequences are as follows: Full-length (1-564 aa, FL) amplification primers for CrCINV1: CrCINV1-FL-pDR196-F: 5′-ACTAGTATGCCCTCAAATATGTTGGCCGATCGGAT-3′; CrCINV1-FL-pDR196-R: 5′-GTCGACTTACTTGTCGTCGTCGTCTTTGTAGTCGAAAGAAGCCGACCTGGTTAGAGTGGGC-3′.

[0104] C-terminal deletion truncated version of CrCINV1 (1-550 aa, ΔC) amplification primers: CrCINV1-ΔN-pDR196-F: 5′-ACTAGTATGCTAATTGATGCTTGGGAAGCTCTTAGG-3′; CrCINV1-ΔN-pDR196-R: 5′-GTCGACTTACTTGTCGTCGTCGTCTTTGTAGTCGAAAGAAGCCGACCTGGTTAGAGTGGGC-3′.

[0105] C-terminal and N-terminal deletions of CrCINV1 truncated variants (101-551aa, ΔNC) amplification primers: CrCINV1-ΔNC-pDR196-F: 5′-ACTAGTATGCTAATTGATGCTTGGGAAGCTCTTAGG-3′; CrCINV1-ΔNC-pDR196-R: 5′-GTCGACTTACTTGTCGTCGTCGTCTTTGTAGTCGTCCTCCTCCAAGGCAATCATGCCAAG-3′.

[0106] Amplification primers for the N-terminal deletion truncated form of CrCINV1 (101–564 aa, ΔN): CrCINV1-ΔC-pDR196-F: 5′-ACTAGTATGCCCTCAAATATGTTGGCCGATCGGAT-3′; CrCINV1-ΔC-pDR196-R: 5′-GTCGACTTACTTGTCGTCGTCGTCTTTGTAGTCGTCCTCCTCCAAGGCAATCATGCCAAG-3′.

[0107] To investigate this phenomenon, CrCINV1 and its different truncated proteins were further expressed in SEY6210. The expression levels of the target proteins were detected by Western blotting using a 1× Flag tag added to the C-terminus of the recombinant proteins. The results showed no significant difference in the expression abundance of full-length CrCINV1 (FL) and its truncated proteins (ΔN, ΔC, and ΔNC) in the crude yeast enzyme solution. Figure 11A). Enzyme activity was analyzed under enzymatic reaction conditions of 30℃ and pH 7.5. The results of crude enzyme solution enzyme activity analysis were similar to those of prokaryotic expressed proteins: CrCINV1 exhibited significant autoinhibition, with synergistic inhibition between its N-terminus and C-terminus. The enzyme activity of ΔNC was approximately 9.5 times that of FL, and the enzyme activity of ΔN was approximately 2.3 times that of ΔC. Figure 11 B).

[0108] Transgenic functional complementation phenotype analysis of SEY6210 was performed using CrCINV1 and its different types of truncated proteins. Spotting results showed that the yeast strain transformed with ΔNC exhibited the best growth on the selection medium (2% Suc), while the yeast strain transformed with FL showed the weakest growth. The order of growth strength of the complementary yeast strains was ΔNC (101-551 aa) > ΔN (101-564 aa) > ΔC (1-551 aa) > FL (1-564 aa). Figure 11 C). The growth effect of the strain was consistent with the enzyme activity assay results of CrCINV1 and its different types of truncated proteins, further confirming the self-inhibition phenomenon and characteristics of CrCINV1 enzyme activity.

[0109] 6. Small bowl moss ( Physcomitrium patens PpCINV1 exhibits enzyme activity autoinhibition. (1) Enzyme activity analysis of full-length PpCINV1 and its GH100 protein expressed in prokaryotes Analysis of the PpCINV1 domain showed that: *Scleroderma purpurea* (… Physcomitrium patens The amino acid sequence of the alkaline convertase CINV (named PpCINV1) is shown in SEQ ID No. 15, with 1-104 aa being the N-terminus, 104-550 aa being the catalytic domain GH100 (i.e., PpGH100), and 550-567 aa being the C-terminus (Figure 1).

[0110] The target gene fragment was cloned using whole-tissue cDNA from *Vicia crassa* (CDS, SEQ ID No. 6, encoding the PpCINV1 protein shown in SEQ ID No. 15, with nucleotides 1-312 from the 5' end of SEQ ID No. 6 encoding the N-terminus of PpCINV1, nucleotides 313-1650 from the 5' end of SEQ ID No. 6 encoding the catalytic active domain GF100 of PpCINV1, and nucleotides 1651-1704 from the 5' end of SEQ ID No. 6 encoding the C-terminus of PpCINV1) as a template. The pMALc5E protein expression vectors PpCINV1-FL-pMALc5E and PpCINV1-ΔNC-pMALc5E, expressing the full-length PpCINV1 and its truncated form, were constructed using the restriction enzyme digestion and ligation method. The vector insertion restriction sites were NdeI and SalI. The primer sequences are as follows: PpCINV1 full-length (1-567 aa, FL) amplification primers: PpCINV1-FL-pMALc5E-F: 5′-CATATGATGAATATCTTTGGGAAAGCTCTCCTTGGAG-3′; PpCINV1-FL-pMALc5E-R: 5′-GTCGACTTAGTGATGATGATGATGAGCTGTCCAAGATGCAGATCTAGTGAG-3′.

[0111] PpCINV1 C-terminal and N-terminal truncated variants (10⁴-550 aa, ΔNC) amplification primers: PpCINV1-ΔNC-pMALc5E-F: 5′-CATATGATGGATGCATGGGAGAGACTTAGATTGTCTAT-3′; PpCINV1-ΔNC-pMALc5E-R: 5′-GTCGACTTAGTGATGATGATGATGATGCTCCTCTAGTCCGATCATTCCCAAG-3′.

[0112] Following the method described in step 1, the recombinant expression vector prepared above was expressed in BL21(DE3) prokaryotes, and the two recombinant fusion proteins, PpCINV1 (approximately 109 kDa) and PpCINV1 (104-550 aa) (approximately 96 kDa), were purified. Their purity and integrity were detected by SDS-PAGE. Image J was then used to perform grayscale scanning of the expected size bands (red arrows), and the concentration of the target protein in the HEPES reaction buffer was calculated using a 6 μg BSA band as a standard (Figure 12A).

[0113] Enzyme activity was analyzed under enzymatic reaction conditions of 30℃ and pH 7. The results showed that the enzyme activity of the GH100 protein containing only the PpCINV1 catalytic domain (104-550 aa, ΔNC) was approximately 5.4 times that of the full-length protein (1-567 aa, FL). Figure 12 B). The above results indicate that the N-terminus and C-terminus of PpCINV1 have a significant inhibitory effect on the enzyme activity of its GH100 domain, and both the N-terminus and C-terminus are self-inhibitory regions of PpCINV1.

[0114] (2) Enzyme activity analysis of full-length PpCINV1 and its GH100 protein heterologous expression in yeast The target gene fragment was cloned using the PpCINV1-FL-pMALc5E plasmid as a template. The pDR196 yeast expression vector containing PpCINV1 and its truncated form was constructed using the restriction enzyme digestion and ligation method. The insertion restriction sites were SpeI and SalI. The primer sequences are as follows: PpCINV1 full-length (1-567 aa, FL) amplification primers: PpCINV1-FL-pDR196-F: 5′-ACTAGTATGAATATCTTTGGGAAAGCTCTCTCTG-3′ (SEQ IDNo. ​​70); PpCINV1-FL-pDR196-R: 5′-GTCGACTTACTTGTCGTCGTCGTCTTTGTAGTCAGCTGTCCAAGATGCAGATCTAGTGAGAG-3′ (SEQ ID No. 71).

[0115] PpCINV1 C-terminal and N-terminal truncated variants (10⁴-550 aa, ΔNC) amplification primers: PpCINV1-ΔNC-pDR196-F: 5′-ACTAGTATGGATGCATGGGAGAGACTTAGATTGTCTAT-3′ (SEQ ID No. 72); PpCINV1-ΔNC-pDR196-R: 5′-GTCGACTTACTTGTCGTCGTCGTCTTTGTAGTCCTCCTCTAGTCCGATCATTCCCAAGTGG-3′ (SEQ ID No. 73).

[0116] The enzyme activity analysis results of the above prokaryotic expression system confirmed that PpCINV1 exhibits autoinhibition. To investigate this phenomenon, the full-length PpCINV1 protein and GH100 protein were further expressed in SEY6210. Under the enzymatic reaction conditions of 30℃ and pH 7, the enzyme activity analysis results of the crude enzyme solution were similar to those of the prokaryotic expressed protein: PpCINV1 exhibited obvious autoinhibition, and its GH100 (10⁴-550 aa, ΔNC) enzyme activity was approximately 4.3 times that of FL (…). Figure 13 ).

[0117] 7. The enzyme activity of SM algae (Spirogloea muscicola) SmCINV1 is self-inhibited. (1) Enzyme activity analysis of full-length SmCINV1 and its different types of truncated proteins expressed in prokaryotes Analysis of the SmCINV1 domain shows that: Spirogloea muscicola The amino acid sequence of CINV (named SmCINV1) is shown in SEQ ID No. 16, with 1-77 aa being the N-terminus, 77-525 aa being the catalytic domain GH100 (i.e., SmGH100), and 525-544 aa being the C-terminus. Figure 1 ).

[0118] The target gene fragment was synthesized by BGI Genomics (CDS of SmCINV1 from SM algae, SEQ ID No. 7, encoding the SmCINV1 protein shown in SEQ ID No. 16, with nucleotides 1-231 from the 5' end of SEQ ID No. 7 encoding the N-terminus of SmCINV1, nucleotides 232-1574 from the 5' end of SEQ ID No. 7 encoding the catalytic active domain GF100 of SmCINV1, and nucleotides 1575-1635 from the 5' end of SEQ ID No. 7 encoding the C-terminus of SmCINV1). The pMALc5E protein expression vectors SmCINV1-FL-pMALc5E and SmCINV1-ΔNC-pMALc5E, which express SmCINV1 and its truncated form, were constructed using the enzyme digestion and ligation method.

[0119] SmCINV1 full-length (1-544 aa, FL) amplification primers: SmCINV1-FL-pMALc5E-F: 5′- AAGGTACCGATGCTGGAGACCGTCAAGAGCTCCGACC -3′, SmCINV1-FL-pMALc5E-R: 5′- GGATCCTCAGTGATGATGATGATGATGGAAGACCCACGAGTTGGATCTGGTGAG-3.

[0120] SmCINV1 C-terminal and N-terminal deletion truncated variant ((77-525 aa, ΔNC)) Amplification primers: SmCINV1-ΔNC-pMALc5E-F: 5′-AAGGTACCGATGCTGGAGACCGTCAAGAGCTCCGACC-3′, SmCINV1-ΔNC-pMALc5E-R: 5′- GGATCCTCAGTGATGATGATGATGATGGATCGAGATCATTGTCAGCTGGGAGGGGTC-3′.

[0121] The N-terminal truncated variant of SmCINV1 (77-544 aa) was amplified using primers SmCINV1-ΔNC-pMALc5E-F and SmCINV1-FL-pMALc5E-R.

[0122] Following the method described in step 1, the recombinant expression vector prepared above was expressed and purified in BL21(DE3) prokaryotes. Four recombinant fusion proteins, SmCINV1 (approximately 106 kDa), SmCINV1 (1-525 aa) (approximately 104 kDa), SmCINV1 (77-525 aa) (approximately 96 kDa), and SmCINV1 (77-544 aa) (approximately 98 kDa), were then analyzed for purity and integrity using SDS-PAGE. Furthermore, ImageJ was used to perform grayscale scanning of the expected size bands (red arrows), and the target protein concentration in the HEPES reaction buffer was calculated using a 6 μg BSA band as a standard. Figure 14 A).

[0123] Enzyme activity was analyzed under enzymatic reaction conditions of 30℃ and pH 7. The results showed that the GH100 protein containing only the SmCINV1 catalytic domain (77-525 aa, ΔNC) exhibited the highest enzyme activity, while the full-length protein (1-544 aa, FL) showed the lowest activity, with a difference of nearly 3.2 times. The enzyme activity of the GH100+ C-terminal protein (77-544 aa, ΔN) was approximately 1.5 times that of the N-terminal+ GH100 protein (1-525 aa, ΔC). Figure 14 B). The above results indicate that the N-terminus and C-terminus of SmCINV1 have a significant inhibitory effect on the enzyme activity of its GH100 domain. Both the N-terminus and C-terminus are self-inhibitory regions of SmCINV1, with the inhibitory effect of the N-terminus being significantly greater than that of the C-terminus.

[0124] (2) Enzyme activity analysis of full-length SmCINV1 and its GH100 protein heterologous expression in yeast The target gene fragment was cloned using the SmCINV1-FL-pMALc5E plasmid as a template. The ppCINV1 and its truncated form of the yeast pDR196 expression vector were constructed using the restriction enzyme digestion and ligation method. The vector insertion restriction sites were SpeI and SalI. The primer sequences are as follows: SmCINV1 full-length (1-544 aa, FL) amplification primers: SmCINV1-FL-pDR196-F: 5′-ACTAGTATGCTGGAGACCGTCAAGAGCTCCGACC-3′; SmCINV1-FL-pDR196-R: 5′-GAATTCCTACTTGTCGTCGTCGTCTTTGTAGTCGAAGACCCACGAGTTGGATCTGGTGAG-3′.

[0125] SmCINV1 C-terminal and N-terminal truncated variant (77-525 aa, ΔNC) amplification primers: SmCINV1-ΔNC-pDR196-F: 5′- ACTAGTATGCCGCTTGTCAGCGAGGCCTGGGAAGCT -3′; SmCINV1-ΔNC-pDR196-R: 5′-GAATTCCTACTTGTCGTCGTCGTCTTTGTAGTCGATCGAGATCATTGTCAGCTGGGAGGGGT-3′.

[0126] The enzyme activity analysis results of the above prokaryotic expression system confirmed that SmCINV1 exhibits autoinhibition. To investigate this phenomenon, the full-length SmCINV1 protein and GH100 protein were further expressed in SEY6210. Under the enzymatic reaction conditions of 30℃ and pH 7, the enzyme activity analysis results of the crude enzyme solution were similar to those of the prokaryotic expressed protein: SmCINV1 exhibited significant autoinhibition, with synergistic inhibition between its N-terminus and C-terminus, and the enzyme activity of ΔNC was approximately 2.8 times that of FL. Figure 15 ).

[0127] (SEQ ID No. 83)>SmCINV1 complete coding region (CDS) sequence (blue highlights show the N-terminus and C-terminus respectively, and the middle region is the catalytic active domain GF100) 8. Kerria ( Klebsormidium nitens KnCINV1 exhibits enzyme activity autoinhibition. (1) Enzyme activity analysis of full-length KnCINV1 and its different truncated forms expressed in prokaryotes The target gene fragment was synthesized by BGI Genomics, and the pMALc5E protein expression vector of KnCINV1 and its truncated form was constructed by enzyme digestion and ligation method.

[0128] Analysis of the KnCINV1 structural domains shows that 1-131 aa is the N-terminus, 131-587 aa is the catalytic domain GH100 (i.e., KnGH100), and 587-607 aa is the C-terminus. Figure 1 ).

[0129] The target gene fragment was synthesized by BGI Genomics (CDS of KnCINV1, SEQ ID No. 8, encoding the KnCINV1 protein shown in SEQ ID No. 17, with nucleotides 1-393 from the 5' end of SEQ ID No. 8 encoding the N-terminus of KnCINV1, nucleotides 394-1761 from the 5' end of SEQ ID No. 8 encoding the catalytic active domain GF100 of KnCINV1, and nucleotides 1762-1824 from the 5' end of SEQ ID No. 8 encoding the C-terminus of KnCINV1). The pMALc5E protein expression vectors KnCINV1-FL-pMALc5E and KnCINV1-ΔNC-pMALc5E were constructed using the enzyme digestion and ligation method (double digestion with KpnI and BamHI).

[0130] KnCINV1 full-length (1-607aa, FL) amplification primers: KnCINV1-FL-pMALc5E-F: 5′- AAGGTACCGATGTTGTCGTCGGACGACAGCGACTTCCG -3′; KnCINV1-FL-pMALc5E-R: 5′-GGATCCTCAGTGATGATGATGATGATGAAGATTCATAAACCCGTTCCAGGAGAC-3′.

[0131] C-terminal and N-terminal deletion truncated variant of KnCINV1 ((131-587 aa, ΔNC) amplification primers: KnCINV1-ΔNC-pMALc5E-F: 5′- AAGGTACCGATGGGAATGCAGCACCCCATGGTCCAAGAAG-3′, KnCINV1-ΔNC-pMALc5E-R: 5′- GGATCCTCAGTGATGATGATGATGATGGTCCTCTTCTAGGCTGATGAGGCCCAAAT-3′.

[0132] N-terminal deletion truncated version of KnCINV1 ((131-607 aa, ΔN) amplification primers: KnCINV1-ΔN-pMALc5E-F: 5′- AAGGTACCGATGGGAATGCAGCACCCCATGGTCCAAGAAG-3′, KnCINV1-ΔN-pMALc5E-R: 5′-GGATCCTCAGTGATGATGATGATGATGAAGATTCATAAACCCGTTCCAGGAGAC-3′.

[0133] C-terminal deletion truncated version of KnCINV1 (1-587 aa, ΔC) amplification primers: KnCINV1-ΔC-pMALc5E-F: 5′-AAGGTACCGATGTTGTCGTCGGACGACAGCGACTTCCG-3′, KnCINV1-ΔC-pMALc5E-R: 5′- GGATCCTCAGTGATGATGATGATGATGGTCCTCTTCTAGGCTGATGAGGCCCAAAT-3′.

[0134] Following the method described in step 1, the recombinant expression vectors prepared above were expressed and purified in BL21(DE3) prokaryotes. The resulting four recombinant fusion proteins, KnCINV1 (approximately 110 kDa), KnCINV1 (1-587 aa) (approximately 108 kDa), KnCINV1 (131-587 aa) (approximately 97 kDa), and KnCINV1 (131-607 aa) (approximately 98.5 kDa), were then analyzed for purity and integrity using SDS-PAGE. Furthermore, ImageJ was used to perform grayscale scanning of the expected size bands (red arrows), and the target protein concentration in the HEPES reaction buffer was calculated using a 6 μg BSA band as a standard. Figure 16 A).

[0135] Enzyme activity analysis was performed under enzymatic reaction conditions of 30℃ and pH 7. The results showed that the GH100 protein containing only the KnCINV1 catalytic domain (131-587 aa, ΔNC) exhibited the highest enzyme activity, while the full-length protein (1-607 aa, FL) showed the lowest activity, with a difference of nearly 1.4 times. The enzyme activity of the GH100+ C-terminal protein (131-607 aa, ΔN) was approximately 1.1 times that of the N-terminal+ GH100 protein (1-587 aa, ΔC). Figure 16B). The above results indicate that the N-terminus and C-terminus of KnCINV1 have a significant inhibitory effect on the enzyme activity of its GH100 domain. Both the N-terminus and C-terminus are self-inhibitory regions of KnCINV1, with the inhibitory effect of the N-terminus being slightly greater than that of the C-terminus.

[0136] (2) Enzyme activity analysis of full-length KnCINV1 and its different types of truncated proteins expressed heterologously in yeast Using the KnCINV1-FL-pMALc5E plasmid as a template, the pDR196 yeast expression vector of KnCINV1 and its truncated form was constructed according to the restriction enzyme digestion and ligation method. The vector insertion restriction sites were SpelI and SmallI. The primer sequences are as follows: KnCINV1 full-length (1-607aa, FL) amplification primers: KnCINV1-FL-pDR196-F: 5′- ACTAGTATGTTGTCGTCGGACGACAGCGACTTCCG -3′; KnCINV1-FL-pDR196-R: 5′- CCCGGGTCACTTGTCGTCGTCGTCTTTGTAGTCAAGATTCATAAACCCGTTCCAGGAG-3′.

[0137] C-terminal and N-terminal deletion truncated variant of KnCINV1 ((131-587 aa, ΔNC) amplification primers: KnCINV1-ΔNC- pDR196-F: 5′-ACTAGTATGGGAATGCAGCACCCCATGGTCCAAGAAGC-3′, KnCINV1-ΔNC- pDR196-R: 5′- CCCGGGTCACTTGTCGTCGTCGTCTTTGTAGTCGTCCTCTTCTAGGCTGATGAGGCCCAAAT-3′.

[0138] N-terminal deletion truncated version of KnCINV1 ((131-607 aa, ΔN) amplification primers: KnCINV1-ΔN- pDR196-F: 5′-ACTAGTATGGGAATGCAGCACCCCATGGTCCAAGAAGC-3′, KnCINV1-ΔN-pMALc5E-R: 5′- CCCGGGTCACTTGTCGTCGTCGTCTTTGTAGTCAAGATTCATAAACCCGTTCCAGGAG-3′.

[0139] C-terminal deletion truncated version of KnCINV1 (1-587 aa, ΔC) amplification primers: KnCINV1-ΔC-pMALc5E-F: 5′- ACTAGTATGTTGTCGTCGGACGACAGCGACTTCCG-3′, KnCINV1-ΔC-pMALc5E-R: 5′- CCCGGGTCACTTGTCGTCGTCGTCTTTGTAGTCGTCCTCTTCTAGGCTGATGAGGCCCAAAT-3′.

[0140] The enzyme activity analysis results of the above prokaryotic expression system confirmed that KnCINV1 exhibits autoinhibition. To investigate this phenomenon, KnCINV1 and its different truncated proteins were further expressed in SEY6210. The expression level of the target protein was detected by Western blotting using a 1× Flag tag added to the C-terminus of the recombinant protein. The results showed that there was no significant difference in the expression abundance of full-length KnCINV1 (FL) and its truncated proteins (ΔN, ΔC, and ΔNC) in the crude enzyme solution of expressing yeast (Figure 17A). Enzyme activity analysis was performed under enzymatic reaction conditions of 30℃ and pH 7. The enzyme activity analysis results of the crude enzyme solution were similar to those of the prokaryotic expressed protein: KnCINV1 exhibited significant autoinhibition, with synergistic inhibitory effects between its N-terminus and C-terminus. The enzyme activity of ΔNC was approximately 2.6 times that of FL, and the enzyme activity of ΔN was approximately 1.6 times that of ΔC (Figure 17B).

[0141] 9. Chlorella vulgaris ( Chlorokybus atmophyticus CaCINV1 exhibits enzyme activity autoinhibition. (1) Enzyme activity analysis of full-length CaCINV1 and its GH100 protein expressed in prokaryotes Analysis of the CaCINV1 domain showed that: *Cyclocarya paliurus* ( Chlorokybus atmophyticus The amino acid sequence of the alkaline convertase CINV is shown in SEQ ID No. 18, where 1-219 aa is the N-terminus, 219-678 aa is the catalytic domain GH100 (i.e., CaGH100), and 678-717 aa is the C-terminus. Figure 1 ).

[0142] The target gene fragment (CDS of CaCINV1 from Alternaria greenis, SEQ ID No. 9, encoding the CaCINV1 protein shown in SEQ ID No. 18, with nucleotides 1-657 from the 5' end of SEQ ID No. 9 encoding the N-terminus of CaCINV1, nucleotides 658-2034 from the 5' end of SEQ ID No. 9 encoding the catalytic active domain GF100 of CaCINV1, and nucleotides 2035-2154 from the 5' end of SEQ ID No. 9 encoding the C-terminus of CaCINV1) was synthesized by BGI Genomics. The pMALc5E protein expression vector of CaCINV1 and its truncated form was constructed by enzyme digestion and ligation method.

[0143] CaCINV1 full-length (1-717 aa, FL) amplification primers: CaCINV1-FL-pMALc5E-F: 5′-AAGGTACCGATGAGGTTTGGCCTTCCGCTGATAGC-3′, CaCINV1-FL-pMALc5E-R: 5′-GTCGACTCAGTGATGATGATGATGATGATAGTAGTCAGCATCAGGTGACTTGGC-3′.

[0144] C-terminal and N-terminal deletion truncated version of CaCINV1 ((219-678aa, ΔNC)) Amplification primers: CaCINV1-ΔNC-pMALc5E-F: 5′-AAGGTACCGATGGCGTGGGATCTGCTGCGCAAGAGCAT-3′, CaCINV1-ΔNC-pMALc5E-R: 5′-GTCGACTCAGTGATGATGATGATGATGGAAGCACAGCATGTCAATGCGCCGCGGGT-3′.

[0145] Following the method described in step 1, the recombinant expression vector prepared above was expressed in BL21(DE3) prokaryotes, and the two recombinant fusion proteins CaCINV1 (approximately 119 kDa) and CaCINV1 (219-678 aa) (approximately 98 kDa) were purified. Their purity and integrity were detected by SDS-PAGE. Image J was then used to perform grayscale scanning of the expected size bands (red arrows), and the concentration of the target protein in the HEPES reaction buffer was calculated using a 6 μg BSA band as a standard (Figure 18A).

[0146] Enzyme activity was analyzed under enzymatic reaction conditions of 30℃ and pH 7. The results showed that the enzyme activity of the GH100 protein containing only the CaCINV1 catalytic domain (219-678 aa, ΔNC) was approximately 1.1 times that of the full-length protein (1-717 aa, FL) (Figure 18B). These results indicate that the N-terminus and C-terminus of CaCINV1 inhibit the enzyme activity of its GH100 domain, and both the N-terminus and C-terminus are self-inhibitory regions of CaCINV1.

[0147] (2) Enzyme activity analysis of full-length CaCINV1 and its GH100 protein heterologous expression in yeast The target gene fragment was cloned using the SmCINV1-FL-pMALc5E plasmid as a template. The ppCINV1 and its truncated form of the yeast pDR196 expression vector were constructed using the restriction enzyme digestion and ligation method. The vector insertion restriction sites were SpeI and SalI. The primer sequences are as follows: CaCINV1 full-length (1-717aa, FL) amplification primers: CaCINV1-FL-pDR196-F: 5′-ACTAGTATGAGGTTTGGCCTTCCGCTGATAGCTGT -3′; CaCINV1-FL-pDR196-R: 5′-GTCGACTCACTTGTCGTCGTCGTCTTTGTAGTCATAGTAGTCAGCATCAGGTGACTTG-3′.

[0148] C-terminal and N-terminal deletions of CaCINV1 truncated variants (219-678aa, ΔNC) amplification primers: CaCINV1-ΔNC-pDR196-F: 5′-ACTAGTATGGCGTGGGATCTGCTGCGCAAGAGCATC-3′; CaCINV1-ΔNC-pDR196-R: 5′-GTCGACTCACTTGTCGTCGTCGTCTTTGTAGTCGAAGCACAGCATGTCAATGCGCCGC-3′.

[0149] The enzyme activity analysis results of the above prokaryotic expression system confirmed that CaCINV1 exhibits autoinhibition. To investigate this phenomenon, the full-length CaCINV1 protein and GH100 protein were further expressed in SEY6210. Under the enzymatic reaction conditions of 30℃ and pH 7, the enzyme activity analysis results of the crude enzyme solution were similar to those of the prokaryotic expressed protein: CaCINV1 exhibits autoinhibition, with synergistic inhibition between its N-terminus and C-terminus, and the enzyme activity of ΔNC is approximately 1.7 times that of FL (where ΔNC is much higher). Figure 19).

[0150] Example 2: A conserved molecular switch mutation at the N-terminal 1 position in the C-terminal self-inhibition region of CINV affects the degree of self-inhibition of the C-terminal 6-peptide motif, thereby regulating enzyme activity. The degree of self-inhibition of CINV shows a gradually increasing trend with the progress of plant evolution. The inventors have experimentally confirmed that both the N-terminus and C-terminus of this type of enzyme can interact with its catalytic domain GH100, which is the fundamental reason for the self-inhibition phenomenon of CINV. There is a conserved molecular switch at the C-terminus, which is a polypeptide with a conserved motif composed of six peptides. In angiosperm CINV, the first amino acid residue at the N-terminus of this conserved molecular switch is mainly lysine (K), while in gymnosperms, bryophytes, and algae, this site is mainly threonine (T), and in ferns, it is mainly proline (P).

[0151] Among them, Arabidopsis thaliana ( Arabidopsis thaliana The conserved molecular switch sequence of AtCINV1 is KRSASW, which is the amino acid sequence from the N-terminus of sequence SEQ ID No. 10, positions 543-548; (Brazilian rubber tree ( Hevea brasiliensis The conserved molecular switch sequence of HbNIN2 is KRSSSW, which is the amino acid sequence from the N-terminus of sequence SEQ ID No. 11, positions 550-555; rice ( Oryza sativa The conserved molecular switch sequence of L.)OsCYT-INV1 is KRSASW, which is the amino acid sequence from the N-terminus of sequence SEQ ID No. 12, positions 555-560; Ginkgo ( Ginkgo biloba The conserved molecular switch sequence of GbCINV1 is TRSVSW, which is the amino acid sequence from the N-terminus of sequence SEQ ID No. 13, positions 571-576; *Adiantum capillus-veneris* (Water Fern) Ceratopteris richardii The conserved molecular switch sequence of CrCINV1 is TRSASF, which is the amino acid sequence from the N-terminus of sequence SEQ ID No. 14, positions 559-564; *Sclerotium spp.* Physcomitrium patens The conserved molecular switch sequence of PpCINV1 is TRSASW, which is the amino acid sequence from the N-terminus of sequence SEQ ID No. 15, positions 560-565; SM algae ( Spirogloea muscicola The conserved molecular switch sequence of SmCINV1 is TRSNSW, which is the amino acid sequence from the N-terminus of sequence SEQ ID No. 16, positions 537-542; Kerria ( Klebsormidium nitens The conserved molecular switch sequence of KnCINV1 is TRSVSW, which is the amino acid sequence from the N-terminus of sequence SEQ ID No. 17, positions 596-601.

[0152] Therefore, the K site was mutated to T or the T site was mutated to K, and the effects of the mutation on the interaction between the C-terminus of CINV and GH100 protein and CINV enzyme activity were analyzed.

[0153] 1. The conserved molecular switch hexapeptide motif, with the first amino acid from the N-terminus being the core site for regulating CINV enzyme activity. In the core self-inhibitory region (Motif13) at the C-terminus of CINV, the conserved molecular switch hexapeptide conserved motif contains a conserved motif whose N-terminal first position corresponds to amino acid 543 of the full-length AtCINV1 protein and amino acid 537 of the full-length SmCINV1 protein.

[0154] Therefore, the lysine (K) at position 543 of sequence 10 in AtCINV1 Motif13 (amino acids 538-548 from the N-terminus of sequence 10) was site-directed to threonine (T), resulting in the mutant AtMotif13K543T; The recombinant vector pGADT7-AtMotif13K543T expressing AtMotif13K543T was constructed as follows: Chemically synthesized SmMotif13 sense and antisense oligonucleotides were mixed in equimolar ratios, annealed to form a double-stranded DNA fragment, and then cloned into the pGADT7 vector using homologous recombination. The sequences of the sense and antisense strands are as follows: AtCINV1-Motif13-pGADT7-F (sense strand 5'-3'): GCCATGGAGGCCAGTGAATTCATGAAACCAGTCATCAAGCGATCTGCGTCTTGGTGA GGGATCCATCGAGCTCGAGCT, AtCINV1- Motif13-pGADT7-F (antisense strand 5'-3'): AGCTCGAGCTCGATGGATCCCTCACCAAGACGCAGATCGCTTGATGACTGGTTTCATGAATTCACTGGCCTCCATGGC.

[0155] The threonine (T) at position 537 of sequence 16 in SmCINV1 Motif13 (amino acids 532-542 from the N-terminus of sequence 16) was site-directed to lysine (K) to obtain the mutant SmMotif13T537K.

[0156] The construction method of pGADT7-SmMotif13T537K, which expresses SmMotif13T537K, is as follows: The SmMotif13T537K construct on the pGADT7 vector synthesizes double strands through homologous recombination into the vector, using EcoRI (forward primer) and BamHI (reverse primer) as the two restriction enzyme sites.

[0157] Chain of Justice: 5'-GCCATGGAGGCCAGTGAATTCATGCTCCGGCCAGCTCTCAAGAGATCCAACTCGTGGTGAGGGATCCATCGAGCTCGAGCT-3'; Complementary strand: 5'-CGGTACCTCCGGTCACTTAAGTACGAGGCCGGTCGAGAGTTCTCTAGGTTGAGCACCACTCCCTAGGTAGCTCGAGCTCGA-3'.

[0158] To construct the recombinant plasmid, equimolar amounts of SmMotif13 sense and antisense oligonucleotides were mixed and heated at 95°C for 5 min in a PCR instrument. The mixture was then slowly cooled to 25°C at a rate of 0.1°C / s to complete the annealing reaction, yielding a double-stranded DNA insert. Subsequently, this fragment was inserted into the linearized pGADT7 vector using homologous recombination (e.g., the ClonExpress® II One-Step Cloning Kit, Vazyme), following the manufacturer's instructions.

[0159] The amplified fragments were constructed into the prey expression vector pGADT7 of the yeast two-hybrid system to obtain recombinant plasmids pGADT7-AtMotif13K543T and pGADT7-SmMotif13T537K.

[0160] AtCINV1-GH100 was constructed by adding pGBKT7 to obtain pGBKT7-AtGH100. The primers for amplifying AtCINV1-GH100 were: forward primer AtCINV1-GH100-pGBKT7-F: 5'-GGAATTCATGATGGCTGAAGCTTGGGAGGC-3', and reverse primer AtCINV1-GH100-pGBKT7-R: 5'-ACGCGTCGACTCAGTCTTCTTCAAGAGAGATCATACCAAT-3', with EcoRI and SaII restriction sites, respectively.

[0161] SmGH100 was constructed into pGBKT7, pGBKT7-SmGH100, using NdeI (forward primer) and BamHI (reverse primer) restriction sites. The SmGH100 amplification primers are as follows: F: 5'-GGAATTCCATATGATGCCGCTTGTCAGCGAGGCCTGGGAAG-3'; R: 5'-CGCGGATCTCAGATCGAGATCATTGTCAGCTGG-3'.

[0162] The amplified fragments were constructed into the prey expression vector pGADT7 of the yeast two-hybrid system, resulting in recombinant plasmids pGADT7-AtMotif13K543T and pGADT7-SmMotif13T537K. Protein-protein interaction analyses were then performed with GH100 proteins of their respective species (pGBKT7-SmGH100 and pGBKT7-SmGH100). Wild-type proteins served as controls.

[0163] Protein-protein interaction analysis was performed using the yeast two-hybrid system. Recombinant plasmids (pGADT7-AtMotif13K543T and pGBKT7-AtGH100, or pGADT7-SmMotif13T537K and pGBKT7-SmGH100) that were verified by sequencing were co-transformed into Y2H Gold competent yeast cells using a PEG / LiAc chemical transformation method. The specific steps are as follows: (1) Take out the Y2H Gold bacterial culture stored in glycerol from the -80℃ freezer, dip a small amount of bacterial culture into the sterilized pipette tip, streak it on the YPDA solid medium plate, and incubate it upside down in a 28℃ constant temperature incubator for 48 h. Pick a single colony with good growth and inoculate it into a 2 mL centrifuge tube containing 500 μL of YPDA liquid medium. Place the centrifuge tube in a 28℃ shaker and incubate it at 220 rpm for 2 days (to activate to OD600 ≈ 0.4-0.6); (2) In a clean bench, take 20 μL of activated Y2H Gold yeast culture and transfer it to a 50 mL Erlenmeyer flask containing 20 mL of fresh YPDA liquid culture medium. Incubate at 28℃ and 220 rpm for 16-20 h with shaking until the OD of the culture is reached. 600 Approximately 0.8. Transfer 1 mL of bacterial culture to a sterile 1.5 mL centrifuge tube, centrifuge at 5000 rpm for 3 min, and discard the supernatant. Add 1 mL of sterile ddH2O to resuspend the bacterial cells, wash, centrifuge again at 5000 rpm for 3 min, discard the supernatant, and place the centrifuge tube on ice for later use; (3) In a centrifuge tube containing Y2H Gold competent cells, add the following reagents in sequence: 2-5 μg of pre-cooled plasmid to be transformed, 10 μL of salmon sperm DNA (which needs to be denatured twice before use: heat at 95℃ for 5 min and then immediately place on ice, repeat once), and finally add 1 mL of yeast transformation solution. Gently pipette and mix the system thoroughly. (4) Incubate in a 30°C water bath for 30 min (invert and mix 6-8 times every 15 min), then heat shock in a 42°C metal bath for 15 min (invert and mix 6-8 times every 7.5 min), and finally let stand at room temperature for 16 h. (5) Centrifuge at 5000 rpm for 3 min, discard the supernatant, resuspend the precipitated yeast cell block in 1 mL ddH2O, centrifuge at 5000 rpm for 3 min, discard the supernatant. Resuspend the precipitated yeast cell block in 200 μL ddH2O, and take 80 μL of each and spread them on non-selective solid medium (SD / -Trp-Leu, DDO) and selection solid medium (SD / -Trp-Leu-Ade-His, QDO), respectively. Incubate at 28 ℃ for 3-5 days. (6) Referring to the positive and negative controls, the protein-protein interactions were preliminarily determined (growth on QDO screening medium indicates interaction, no growth indicates no interaction). ImageJ software was used to count the number of single colonies of each pair of interacting proteins on DDO and QDO media, and the percentage of QDO and DDO colonies was calculated to reflect the strength of the protein-protein interactions; (7) Pick single colonies that have been identified as positive by yeast colony PCR from DDO plates and inoculate them into 50 mL Erlenmeyer flasks containing 20 mL of DDO liquid medium. Incubate at 28°C and 220 rpm for 3-5 days with shaking. Take the activated yeast culture and perform α-galactosidase activity detection according to the Clontech instructions to assess the strength of protein-protein interactions. (8) Take a single colony from a DDO plate that has been identified as positive by yeast colony PCR, inoculate it into DDO liquid medium, and incubate at 28℃ and 220 rpm for 3-5 days with shaking. Adjust the OD values ​​of all bacterial cultures from the same batch to the same level. 600 Then, perform 10-fold serial dilutions using sterile ddH2O (10... 0 10 -1 10 -2 10 -3 10 -4 Spot bacterial cultures of various dilutions onto a plate and assess the strength of protein interactions by observing the growth of yeast on the selection medium.

[0164] The results showed that the interaction strength between AtMotif13K543T and AtGH100 was significantly weakened compared to wild-type AtMotif13. Figure 20 A); Compared with wild-type SmMotif13, the interaction strength between SmMotif13T537K and SmGH100 is significantly enhanced ( Figure 20 B).

[0165] 2. Mutations at key amino acid sites of conserved molecular switches can significantly alter the enzyme activity level of CINV. A mutation at the N-terminal first amino acid of the conserved molecular switch significantly affects the interaction strength between the self-inhibitory core domain Motif13 and the catalytic domain GH100 at the C-terminus, suggesting that this mutation may affect the enzyme activities of AtCINV1 and SmCINV1. Therefore, the AtCINV1K543T and SmCINV1T537K mutants were expressed in yeast SEY6210, and the crude enzyme solutions were extracted for enzyme activity determination.

[0166] To achieve heterologous expression in yeast, the pDR196 recombinant vectors of AtCINV1, SmCINV1, and their conserved molecular switch mutants from the N-terminal 1 amino acid were constructed using a double enzyme digestion method. The specific construction procedure is as follows: AtCINV1 was used to construct pDR196 to obtain pDR196-AtCINV1. The amplification primers for pDR196-AtCINV1 were: forward primer AtCINV1-pDR196-F: ACTAGTATGGAAGGTGTTGGACTAAGAGCTGTAGGAT, and reverse primer AtCINV1-pDR196-R: GTCGACTCACTTGTCGTCGTCGTCTTTGTAGTCGAGTTGTGGCCAAGACGCAGATCGCTTGATGACTG. The restriction sites were Spell and Sal, respectively. AtCINV1-K543T was used to construct pDR196 to obtain pDR196-AtCINV1-K543T and pDR196-AtCINV1-K537T amplification primers: forward primer AtCINV1-K543T-pDR196-F: ACTAGTATGGAAGGTGTTGGACTAAGAGCTGTAGGAT, reverse primer AtCINV1-K543T-pDR196-R: GTCGACTCACTTGTCGTCGTCGTCTTTGTAGTCGAGTTGTGGCCAAGACGCAGATCGGGTGAT, with restriction sites of Spell and Sal respectively; SmCINV1 was used to construct pDR196 to obtain pDR196-SmCINV1. The primers for amplifying pDR196-SmCINV1 were: forward primer SmCINV1-pDR196-F: ACTAGTATGCTGGAGACCGTCAAGAGCTCCGACC, and reverse primer SmCINV1-pDR196-R: GAATTCCTACTTGTCGTCGTCGTCTTTGTAGTCGAAGACCCACGAGTTGGATCTGGTGAG. The restriction sites were Spell and EcoRI, respectively. SmCINV1-T537K was constructed into pDR196 to obtain pDR196-SmCINV1-T537K. The amplification primers for pDR196-SmCINV1-T537K are: forward primer SmCINV1-T537K-pDR196-F: ACTAGTATGCTGGAGACCGTCAAGAGCTCCGACC, and reverse primer SmCINV1-T537K-pDR196-R: GAATTCCTACTTGTCGTCGTCGTCTTTGTAGTCGAAGACCCACGAGTTGGATCTCTTGAGAGC. The restriction enzyme sites are Spell and EcoRI, respectively.

[0167] CINV activity in protein extracts was determined using a modified protocol based on a previously reported method (Hyun TK, Eom SH, Kim J S. Genomic analysis and gene structure of the two invertase families in the domesticated apple (Malus× domestica Borkh.) [J]. Plant Omics, 2011, 4(7): 391-399.).

[0168] The reaction system (100 µL) contained 50 mM HEPES-NaOH buffer (pH 8.0 or a specified pH), 5 mM MgCl2, 1 mM EDTA, 100 mM sucrose, and enzyme extract. After incubation at 30°C (or a specified temperature) for 1 hour, the reduced hexose produced was quantified by adding 900 µL of DNS (Zhu JH, Qi JY, Fang YJ, et al. Characterization of sugar contents and sucrose metabolizing enzymes in developing leaves of Hevea brasiliensis[J]. Frontiers in Plant Science, 2018,9: 58). The control group underwent the same procedure using an equal volume of heat-inactivated enzyme extract.

[0169] Enzyme activity calculation: The hexose content in the reaction mixture was calculated based on the hexose concentration standard curve. The enzyme activity of the purified protein after prokaryotic expression was analyzed. CINV activity was expressed as μmol hexose·mg -1 protein·min -1 Calculations are performed in units.

[0170] The results showed that, compared with the wild-type AtCINV1, the crude enzyme activity of the mutant AtCINV1K543T was increased by approximately 40%. Figure 21 A); Compared to SmCINV1, the crude enzyme activity of the mutant SmCINV1T537K was reduced by approximately 12% ( Figure 21 B).

[0171] To verify this phenomenon at the functional level, we also conducted functional complementarity phenotypic analysis of AtCINV1 and SmCINV1 and their conserved molecular switches transformed from the N-terminal 1st single amino acid mutant to SEY6210.

[0172] (1) Take out the invertase-deficient yeast mutant SEY6210 glycerol bacteria stored in the laboratory from the -80℃ ultra-low temperature freezer, dip a sterile pipette tip into the bacterial solution and streak it on a YPDA solid medium plate. Invert the plate and incubate it in a constant temperature incubator at 28℃ for 2 days. After the colonies grow, pick a single colony with good morphology and inoculate it into a 2mL centrifuge tube containing 1mL of YPDA liquid medium. Seal the tube opening with sealing film, fix the centrifuge tube on a floating plate, and place it in a shaker at 28℃ and 220 rpm for 24-48 h. (2) Take the activated SEY6210 yeast culture and transfer it to a 50 mL Erlenmeyer flask containing 30 mL YPDA liquid culture medium. Incubate at 28℃ and 220 rpm for 24-48 h with shaking. (3) Centrifuge the cultured bacterial solution at 8000 rpm for 5 min in a floor centrifuge to collect the bacterial cells. Resuspend and wash the bacterial cells with ddH2O, centrifuge again to collect the cells, and discard the supernatant. Transform the correctly sequenced pDR196 / pDR195 recombinant plasmid into the yeast mutant SEY6210 competent cells using the PEG / LiAc method. After transformation, the bacterial solution is plated on the selection medium SD / -Ura (containing 2% sucrose, which must be filtered through a 0.22 μm aqueous syringe filter for sterilization) solid plate and incubated at 28℃ for 2-3 days; (4) Pick a single yeast colony on SD / -Ura + 2% sucrose solid medium, and after the colony PCR is positive, inoculate it into a centrifuge tube containing 1 mL of SD / -Ura + 2% sucrose liquid medium and culture at 28℃ and 220 rpm for 48-72 h. (5) Take 800 μL of activated positive clone bacterial culture and transfer it to 300 mL of SD / -Ura + 2% sucrose liquid medium. Incubate at 28℃ and 220 rpm for 48-72 h with shaking until the bacterial concentration reaches OD500. 600 ≈1.0; After adjusting the bacterial concentration of each transformed yeast strain to the same OD600 value, serial dilutions were performed, followed by spot culture on selective (2% Suc) and non-selective (2% Glc + Frc) SD / -Ura solid medium. Results showed that yeast transformed with AtCINV1K543T exhibited better growth than AtCINV1; however, yeast transformed with SmCINV1T537K showed worse growth than SmCINV1. Figure 22 This is consistent with the results of the previous determination of enzyme activity in crude enzyme solution of transformed yeast cells.

[0173] Example 3: Promoting Arabidopsis growth using CINV Further research revealed that the C-terminus of CINV in all plants contains a conserved 6-amino acid sequence: [K / R / A / P / T]RSXSW. This sequence interacts with both the 14-3-3 protein and the active site GH100, with the interaction strength gradually increasing with the evolution of higher plants, thus leading to a gradual increase in autoinhibition. Replacing the hexamer in the CINV of higher plants with that of lower plants increases enzyme activity. Conversely, replacing the hexamer in the CINV of lower plants with that of higher plants inhibits enzyme activity.

[0174] To verify this finding, we conducted stable transformation experiments in Arabidopsis thaliana. First, we used published mutants lacking AtCINV1 and AtCINV2. cinv1;2 (It is known that the root system is short and growth and development are inhibited. Pignocchi C, Ivakov A, Feil R, et al. Restriction of cytosolic sucrose hydrolysis profoundly alters development, metabolism, and gene expression in Arabidopsisroots[J]. Journal of Experimental Botany, 2021, 72(5): 1850-1863.), on this basis, the full length of a single AtCINV1 (FL), the GH100s removed from both ends, and the conserved molecular switch of AtCINV1 (KRSASW, which is a version of T edited from the first position of the N-terminus (the 543rd amino acid sequence of the N-terminus of the sequence SEQ ID No. 10) (K543T) were added back.

[0175] Using the Novita Sodium Homologous Recombination Kit (catalog number: C112), the full-length AtCINV1, point mutant (K543T), and truncated form (GH100) were cloned into the pCAMBIA1300 plant expression vector via homologous recombination. The primer sequences are as follows (where bold and highlighted bases are vector homologous arm sequences, and red text indicates introduced mutant bases): AtCINV1 full-length (FL) primers: AtCINV1-1300-F: 5′-GCGTCGACATGGAAGGTGTTGGACTAAGAGCTGTAGGATCACACTGTTCTTTATC-3′; AtCINV1-1300-R: 5′-CGAGCTCTCAGAGTTGTGGCCAAGACGCAGATCGCTTGAT-3′.

[0176] Truncated form (GH100) primers: AtCINV1-GH100-1300-F: 5′-GCGTCGACATGATGGCTGAAGCTTGGGAGGCTTTAAGAAGGTCAATGGTCTTCTT-3′; AtCINV1-GH100-1300-R: 5′-CGAGCTCTCAGTCTTCTTCAAGAGAGATCATACCAATGTG-3′.

[0177] Primers for the point mutant (K543T): AtCINV1-K543T-1300-F: 5′-CTGTTGATACATATGCCCGTCGACATGGAAGGTGTTGGACTAAGAGC-3′, AtCINV1-K543T-1300-R 5′-CTCGCCCTTGCTCACCATGGATCCTCAGAGTTGTGGCCAAGACGCAGATCGCGTGATGAC-3′.

[0178] The amplified fragments were cloned into the pCAMBIA1300 plant expression vector to obtain the recombinant vector pCAMBIA1300-FL expressing the full-length AtCINV1 (FL), the recombinant vector pCAMBIA1300-GH100 expressing GH100, and the recombinant vector pCAMBIA1300-K543T expressing the point mutation (K543T) AtCINV1.

[0179] In order to carry out cinv1;2 Complementation experiments and crude enzyme activity analysis of the double mutants were performed. The recombinant plasmids pCAMBIA1300-FL, pCAMBIA1300-GH100, and pCAMBIA1300-K543T were transformed into Arabidopsis mutants using the flower-dip method. cinv1;2 The specific steps to obtain transgenic plants are as follows: (1) Transform the correctly sequenced plant recombinant expression vector into GV3101 Agrobacterium competent cells, plate them on LB agar plates containing rifampicin and kanamycin, and incubate at 28°C for 48 h. Pick single colonies that are positive by colony PCR and inoculate them into 2 mL centrifuge tubes containing 1 mL LB liquid medium (with the corresponding antibiotics), and incubate at 28°C and 220 rpm with shaking to activate them for later use; (2) Take 300 μL of activated Agrobacterium culture and transfer it to 300 mL of LB liquid medium containing rifampicin and kanamycin. Incubate overnight at 28°C and 220 rpm with shaking until the bacterial concentration reaches OD500. 600 ≈ 0.8; (3) Place the cultured bacterial solution in a floor centrifuge and centrifuge at 5000 rpm for 8 min at room temperature. Discard the supernatant and collect the bacterial precipitate. (4) Add an appropriate amount of the prepared infection solution (formulation: 2.2 g MS salt, 50 g sucrose, dissolved in ddH2O to 1 L; add 300 μL of surfactant Silwet L-77 before use) to resuspend the bacterial precipitate and adjust the bacterial concentration to OD. 600 ≈1.0; (5) Pour the resuspended bacterial solution into the lid of an 18 mm glass culture dish. Select Arabidopsis inflorescences with the open flowers and siliques removed in advance, and immerse the inflorescences completely in the staining solution for 1 min 30 s; (6) Wrap the soaked plants with plastic wrap to keep them moist, place them flat on a tray lined with damp paper towels, cover them with another tray to maintain humidity, and incubate in the dark overnight. (7) Remove the plastic wrap and transfer the plant to a plant light incubator to continue normal cultivation; (8) Collect the seeds of the infected Arabidopsis thaliana plants (T0 generation) and place them in a 1.5 mL centrifuge tube. Add an appropriate amount of 70% ethanol, shake well to mix, centrifuge at 3000 rpm for 2 min, and discard the supernatant. Wash twice with sterile ddH2O; (9) Add 10% sodium hypochlorite solution, vortex and mix for 3 min, then wash 6 times with sterile ddH2O. Wrap the centrifuge tubes in aluminum foil to protect them from light and place them in a 4 ℃ refrigerator for vernalization for 3 days; (10) Spread the vernalized seeds evenly on 1 / 2 MS solid medium containing 25 μg / mL hygromycin B, dry them in a clean bench, and then transfer them to a plant light incubator for culture. (11) After two weeks of cultivation, select the positive seedlings that have grown true leaves and transplant them into the soil to continue growing; (12) Harvest seeds of T1 generation plants and repeat steps (8)-(11) for further screening. The obtained T2 generation transgenic plants are used for subsequent crude enzyme extraction and enzyme activity analysis.

[0180] Extraction of crude enzyme solution from transgenic Arabidopsis thaliana The insertion of AtCINV1 and its catalytic domain GH100 into the target structure was successfully confirmed. cinv1;2 The complementary lines in the double mutant genome can be used for subsequent crude enzyme extraction and enzyme activity analysis. Crude enzyme extraction was performed using the widely adopted HEPES-NaOH method for extracting soluble proteins from root tissue, with slight adjustments. The specific steps are as follows: (1) Take 1 g of root tissue from a 40-day-old Atcinv1cinv2 double mutant transgenic plant (negative control and functional complementary line), rinse it with ddH2O, and place it in a pre-cleaned and autoclaved mortar. Add an appropriate amount of liquid nitrogen for quick freezing and grind it into a fine powder. (2) Quickly transfer the ground powder to a pre-chilled 2 mL centrifuge tube using a small spatula and place it on ice. Add 1 mL of pre-chilled HEPES-NaOH reaction buffer (50 mM, pH 8.0, containing Beyotime PMSF protease inhibitor ST560 and Tianenze plant-specific protease inhibitor 130528-1), mix thoroughly, and let stand on ice for 10 min; (3) Filter the homogenate through a nylon mesh with a pore size of 20-30 μm and collect the filtrate into a new 2 mL centrifuge tube. Centrifuge the filtrate at 4℃ and 14000 rpm for 10 min, carefully transfer the supernatant to a new centrifuge tube, and repeat the centrifugation once to remove as many impurities as possible; (4) Transfer the supernatant after impurity removal to a 3 kDa molecular weight cutoff Millipore ultrafiltration centrifuge tube (2 mL), add an equal volume of HEPES-NaOH buffer containing protease inhibitors, and centrifuge at 4°C and 14,000 rpm for 8 min. Repeat this ultrafiltration step until small molecule proteins are completely removed and buffer replacement is completed. The supernatant retained after ultrafiltration is the crude enzyme solution, which can be used for subsequent enzyme activity analysis.

[0181] CINV activity assay: The reaction system (100 µL) contained 50 mM HEPES-NaOH buffer (pH 8.0 or specified pH), 5 mM MgCl, 1 mM EDTA, 100 mM sucrose, and enzyme extract. After incubation at 30°C (or specified temperature) for 1 hour, the generated reducing hexose was quantified by adding 900 µL DNS. The control group underwent the same procedure using an equal volume of heat-inactivated enzyme extract.

[0182] Enzyme activity calculation: The hexose content in the reaction mixture was calculated based on the hexose concentration standard curve. The enzyme activity of the purified protein after prokaryotic expression was analyzed. CINV activity was expressed as μmol hexose·nmol -1 protein·min -1 Calculations were performed in units of hexose. The crude enzyme activity of the heterologous expression (SEY6210) and Atcinv1cinv2 double mutant complementary lines was analyzed in μmol hexose·mg. -1 protein·min -1 Expressed in units.

[0183] RNA was extracted using the FastPure Plant Total RNA Isolation Kit (Vazyme, Nanjing, China) according to the manufacturer's instructions. The RNA was then reverse transcribed into cDNA using the PrimeScript™ RT reagent Kit (Takera, Dalian, China). (Refer to TB Green). ® The reaction system was prepared according to the Premix Ex Taq™ II Fast qPCR kit instructions, and then qPCR detection was performed using the StepTwoPlus™ Real-Time PCR System. Arabidopsis plant identification was performed using... AtActin8 As an internal reference gene.

[0184] The primer sequences are as follows: For Arabidopsis AtCINV1 Specific primers for quantitative fluorescence detection were designed based on the GH100 catalytic active domain of the gene. AtCINV1-F: 5′-AAGACAGGGAGACCGCAG-3′; AtCINV1-R: 5′-GCAACATTTTCGCCACTA-3′.

[0185] At the same time, Arabidopsis thaliana was selected. ACT8 As an internal reference gene (housekeeping gene), its primer sequences are as follows: ACT8-F: 5′-CACTTTCCAGCAGATGTGGATC-3′; ACT8-R: 5′-AATGCCTGGACCTGCTTCAT-3′.

[0186] Sow the seeds on 1 / 2 MS medium plates. Sterilize the Arabidopsis seeds with alcohol and vernalize them at 4°C for 2-3 days. Wild-type (Col-0) and double-stripe (…) seeds were then sown… cinv1;2 Seedlings were sown on antibiotic-free 1 / 2 MS medium. Hygromycin-resistant genotypes (FL, GH100, and K543T) were sown on hygromycin-resistant 1 / 2 MS medium and cultured at 25°C under a 16-hour light / 8-hour dark cycle (screen reading 150). After 5 days, germinated and rooted seedlings were transferred to fresh medium and cultured for 4 days. Roots were photographed after vertical growth, and imaging was performed on day 9 after germination. Root length was quantified using ImageJ software. Each sample consisted of 3 lines, and each line consisted of 3 independent plants (n=9).

[0187] The results are shown in Table 1 and Figure 23 As shown.

[0188] Table 1: Comparison of root length during the seedling stage [Root length was quantized using ImageJ software; data is the mean ± standard deviation (n = 9)]

[0189] like Figure 23 As shown in Table 1, compared to the FL recombinant line, the GH100 recombinant line can increase invertase activity and promote root growth in the seedling stage, but cannot promote the growth of mature plants. The K543T recombinant line can promote both root growth in the seedling stage and the growth of mature plants.

[0190] At the transcriptional level, the expression of the CINV gene was significantly increased in the three independent transformation lines of each complementation type compared to the mutant. Figure 23 A) In terms of enzyme activity, the reinjected lines also showed a significant increase compared to the mutants. Figure 23 B). During the seedling stage, GH100, FL, and K543T all restored the root-shortening phenotype of the double mutant, with GH100 and K543T lines showing better restoration effects than FL. Figure 23 C). At maturity (before flowering), GH100, FL, and K543T can all restore the growth-inhibited phenotype of the double mutant plants to some extent, with K543T being significantly better than FL, and FL being significantly better than GH100. Figure 23 D). Schematic diagram (E) shows that CINV, a higher plant modified with an ancestral hexapeptide mutant, can reduce its autoinhibition, thereby simultaneously enhancing enzyme activity and promoting plant growth in Arabidopsis thaliana.

[0191] The above description represents preferred embodiments of the present invention and is used only to illustrate specific implementations of the invention. It is not intended to limit the scope of protection of the invention. Any reasonable modifications, equivalent substitutions, or technical extensions made without departing from the principles of the invention are considered to be within the scope of protection of the invention.

Claims

1. A conserved molecular switch for the plant cytoplasmic alkaline invertase CINV, comprising a continuous hexapeptide at the C-terminus of the C-terminal self-inhibition domain of the plant cytoplasmic alkaline invertase CINV, characterized in that, The sequence consists of 6 consecutive amino acids: [K / R / A / P / T]RSXSW, where X represents any amino acid.

2. The conservative molecular switch according to claim 1, characterized in that, Arabidopsis thaliana ( Arabidopsis thaliana The conserved molecular switch sequence of AtCINV1 is KRSASW, which is the amino acid sequence from the N-terminus of sequence SEQ ID No. 10, positions 543-548; (Brazilian rubber tree ( Hevea brasiliensis The conserved molecular switch sequence of HbNIN2 is KRSSSW, which is the amino acid sequence from the N-terminus of sequence SEQ ID No. 11, positions 550-555; rice ( Oryza sativa The conserved molecular switch sequence of L.)OsCYT-INV1 is KRSASW, which is the amino acid sequence from the N-terminus of sequence SEQ ID No. 12, positions 555-560; Ginkgo ( Ginkgo biloba The conserved molecular switch sequence of GbCINV1 is TRSVSW, which is the amino acid sequence from the N-terminus of sequence SEQ ID No. 13, positions 571-576; *Adiantum capillus-veneris* (Water Fern) Ceratopteris richardii The conserved molecular switch sequence of CrCINV1 is TRSASF, which is the amino acid sequence from the N-terminus of sequence SEQ ID No. 14, positions 559-564. Small bowl moss ( Physcomitrium patens The conserved molecular switch sequence of PpCINV1 is TRSASW, which is the amino acid sequence from the N-terminus of sequence SEQ ID No. 15, positions 560-565; SM algae ( Spirogloea muscicola The conserved molecular switch sequence of SmCINV1 is TRSNSW, which is the amino acid sequence from the N-terminus of sequence SEQ ID No. 16, positions 537-542; *Ceratophyllum demersum* (… Klebsormidium nitens The conserved molecular switch sequence of KnCINV1 is TRSVSW, which is the amino acid sequence from the N-terminus of sequence SEQ ID No. 17, positions 596-601.

3. The application of the conserved molecular switch of cytoplasmic alkaline convertase CINV as described in claim 1 in regulating the activity of cytoplasmic alkaline convertase CINV, wherein the application is to mutate the first position from the N-terminus of the conserved molecular switch, causing it to mutate from T to K, or from K to T.

4. A method for increasing the activity of the alkaline invertase CINV in plant cytoplasm, characterized in that, This is achieved by relieving the self-inhibition of CINV in plants, selected from any one or more of the following: (1) The N-terminal self-inhibition region of CINV in plants is missing. (2) The C-terminal self-inhibition region of CINV in plants is missing. (3) The N-terminal and C-terminal self-inhibition regions of CINV in plants are missing, while the complete GH100 catalytic domain is preserved; (4) The conserved molecular switch of claim 1 or 2 in the plant CINV is mutated from threonine T to lysine K at the first position from the N-terminus.

5. The method according to claim 4, characterized in that, The plants include Arabidopsis thaliana ( Arabidopsis thaliana Brazilian rubber tree () Hevea brasiliensis ), rice ( Oryza sativa L.), Ginkgo ( Ginkgo biloba ), water fern ( Ceratopteris richardii ), Small bowl moss ( Physcomitrium patens ), SM algae ( Spirogloea muscicola ), Kryptospira ( Klebsormidium nitens ) and Chlorella vulgaris ( Chlorokybus atmophyticus One of them.

6. The method according to claim 5, characterized in that, Arabidopsis thaliana ( Arabidopsis thaliana The amino acid sequence of CINV of SEQ ID No. 10 is shown in SEQ ID No. 10, wherein amino acid residues 1-84 from the N-terminus of SEQ ID No. 10 constitute the N-terminal self-inhibition region, amino acid residues 84-535 from the N-terminus of SEQ ID No. 10 constitute the GH100 catalytic domain, and amino acid residues 535-551 from the N-terminus of SEQ ID No. 10 constitute the C-terminal self-inhibition region; Brazilian rubber tree ( Hevea brasiliensis The amino acid sequence of CINV of rice is shown in SEQ ID No.

11. The N-terminal amino acid residues 1-91 of SEQ ID No. 11 constitute the N-terminal self-inhibition region, the N-terminal amino acid residues 91-542 of SEQ ID No. 11 constitute the GH100 catalytic domain, and the N-terminal amino acid residues 542-557 of SEQ ID No. 11 constitute the C-terminal self-inhibition region. Oryza sativa The amino acid sequence of CINV of Ginkgo biloba (L.) is shown in SEQ ID No.

12. The N-terminal amino acid residues 1-98 of SEQ ID No. 12 constitute the N-terminal self-inhibition region, the N-terminal amino acid residues 98-544 of SEQ ID No. 12 constitute the GH100 catalytic domain, and the N-terminal amino acid residues 544-562 of SEQ ID No. 12 constitute the C-terminal self-inhibition region. Ginkgo biloba The amino acid sequence of CINV of ) is shown in SEQ ID No.

13. The N-terminal amino acid residues 1-113 of SEQ ID No. 13 constitute the N-terminal self-inhibition region, the N-terminal amino acid residues 113-563 of SEQ ID No. 13 constitute the GH100 catalytic domain, and the N-terminal amino acid residues 563-578 of SEQ ID No. 13 constitute the C-terminal self-inhibition region; (Water fern ( ) Ceratopteris richardii The amino acid sequence of CINV of SEQ ID No. 14 is shown in SEQ ID No.

14. The first 101 amino acid residues from the N-terminus of SEQ ID No. 14 constitute the N-terminal self-inhibition region, the 101-551 amino acid residues from the N-terminus of SEQ ID No. 14 constitute the GH100 catalytic domain, and the 551-564 amino acid residues from the N-terminus of SEQ ID No. 14 constitute the C-terminal self-inhibition region. (Note: The last part about *Moss sphaerocephala* appears to be unrelated and likely refers to another part of the text.) Physcomitrium patens The amino acid sequence of CINV is shown in SEQ ID No.

15. The first 104 amino acid residues from the N-terminus of SEQ ID No. 15 constitute the N-terminal self-inhibition region, the 104-550 amino acid residues from the N-terminus of SEQ ID No. 15 constitute the GH100 catalytic domain, and the 550-567 amino acid residues from the N-terminus of SEQ ID No. 15 constitute the C-terminal self-inhibition region. Spirogloea muscicola The amino acid sequence of CINV is shown in SEQ ID No.

16. The N-terminal amino acid residues 1-77 of SEQ ID No. 16 constitute the N-terminal self-inhibition region, the N-terminal amino acid residues 77-525 of SEQ ID No. 16 constitute the GH100 catalytic domain, and the N-terminal amino acid residues 525-544 of SEQ ID No. 16 constitute the C-terminal self-inhibition region; *Ceratophyllum demersum* (… Klebsormidium nitens The amino acid sequence of CINV of SEQ ID No. 17 is shown in SEQ ID No.

17. The N-terminal amino acid residues 1-131 of SEQ ID No. 17 constitute the N-terminal self-inhibition region, the N-terminal amino acid residues 131-587 of SEQ ID No. 17 constitute the GH100 catalytic domain, and the N-terminal amino acid residues 587-607 of SEQ ID No. 17 constitute the C-terminal self-inhibition region; *Chlorella vulgaris* ( Chlorokybus atmophyticus The amino acid sequence of CINV is shown in SEQ ID No.

18. The N-terminal amino acid residues 1-219 of SEQ ID No. 18 are the N-terminal self-inhibition region, the N-terminal amino acid residues 219-678 of SEQ ID No. 17 are the GH100 catalytic domain, and the N-terminal amino acid residues 678-717 of SEQ ID No. 17 are the C-terminal self-inhibition region.

7. A highly active alkaline invertase in plant cytoplasm, characterized in that, Selected from: (1) A truncated protein of plant cytoplasmic alkaline invertase CINV that lacks the N-terminal self-inhibition region and / or the C-terminal self-inhibition region and retains the GH100 catalytic domain; (2) The conserved molecular switch of the C-terminal self-inhibition region of the plant cytoplasm alkaline invertase CINV as described in claim 1 or 2, wherein the N-terminal first position is lysine K.

8. The conserved molecular switch of plant cytoplasmic alkaline invertase CINV as described in claim 1 or 2, the application as described in claim 3, the method as described in any of claims 4-6, and the application of the highly active cytoplasmic alkaline invertase as described in claim 7 in crop genetic improvement, improving sucrose utilization efficiency, promoting growth and development, enhancing stress resistance, and increasing biomass or yield.

9. The application according to claim 8, characterized in that, The plants mentioned include Arabidopsis thaliana, rice, Brazilian rubber tree, ginkgo, water fern, small bowl moss, corn, wheat, potato, vegetables and fruit trees.

10. A method for promoting plant growth, characterized in that: Includes any one or more of the following steps: (1) Edit the plant endogenous CINV gene to make its N-terminal self-repressed region and / or self-repressed region, C-terminal repression region missing, or perform gene editing on the conserved molecular switch of the C-terminal self-repressed region of the plant cytoplasm alkaline invertase CINV as described in claim 1 or 2; (2) Overexpression of the highly active plant cytoplasmic alkaline invertase as described in claim 7 in plants; Preferably, the plant is Arabidopsis thaliana, Arabidopsis thaliana ( Arabidopsis thaliana The amino acid sequence of CINV of Arabidopsis thaliana is shown in SEQ ID No. 10, wherein amino acid residues 1-84 from the N-terminus of SEQ ID No. 10 constitute the N-terminal self-inhibition region, amino acid residues 84-535 from the N-terminus of SEQ ID No. 10 constitute the GH100 catalytic domain, and amino acid residues 535-551 from the N-terminus of SEQ ID No. 10 constitute the C-terminal self-inhibition region; Arabidopsis thaliana The conserved molecular switch sequence of CINV is KRSASW, which is the amino acid sequence from the N-terminus of sequence SEQ ID No. 10, positions 543-548.

Images