Genes, vectors, methods, and applications for regulating latex duct development and latex production in rubber grass

Abstract

This invention discloses genes that regulate latex duct development and rubber yield in rubber grass, including... TkbHLH14 The gene and the nucleotide sequence having at least 90% sequence identity with the nucleotide sequence shown in the gene and encoding a protein that affects rubber synthesis function, the above. TkbHLH14 The nucleotide sequence of the gene is shown in SEQ ID NO.1; above TkbHLH14 Genes can regulate latex duct development and rubber synthesis in rubber grass. This invention also discloses vectors for overexpressing or knocking out the above-mentioned genes, their construction methods, engineered bacteria, applications, and methods for regulating latex duct development and rubber yield in rubber grass. This is achieved by overexpressing or knocking out the above-mentioned genes in rubber grass. TkbHLH14 Genes that regulate the development of latex ducts and rubber synthesis in rubber-producing plants like rubber grass.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to genes that regulate latex development and latex production in rubber grass, as well as vectors for overexpressing or knocking out these genes, methods for preparing transgenic plants, and their applications. Background Technology

[0002] Natural rubber (NR) is an important strategic material and basic industrial raw material. It possesses excellent physical properties such as high elasticity, insulation, corrosion resistance, and impact resistance, and is widely used in agriculture, transportation, and medical and health fields, and in many aspects, it cannot be replaced by synthetic rubber. Currently, the commercial supply of natural rubber almost entirely relies on the Brazilian rubber tree (Brazilian rubber tree). Hevea brasiliensis The problem of a single source of production for the natural rubber industry is extremely prominent. At the same time, Brazilian rubber trees also suffer from long growth cycles, difficulties in genetic improvement, and susceptibility to disease, making it difficult for their yield to meet the development needs of related industrial production. Therefore, developing new rubber-producing crops that can replace rubber trees and broadening the supply channels of natural rubber have become important research directions for breaking through the bottlenecks in the development of the natural rubber industry and ensuring the security of national strategic material supply.

[0003] Rubber grass, also known as Russian dandelion, belongs to the Asteraceae family (Asteraceae). Compositae ) Dandelion ( Taraxacum Rubber grass is a perennial herbaceous plant whose root latex cells can produce high-quality natural rubber, with a content exceeding 20%. More importantly, the natural rubber produced by rubber grass is extremely similar to that produced by rubber trees in terms of molecular properties and structural characteristics, giving it extremely high scientific research value and promising prospects for industrial application. However, currently, rubber grass still faces the challenge of rubber content and yield being far below the requirements for industrialization, becoming the core bottleneck restricting its commercial application.

[0004] Current research on rubber grass mainly focuses on fundamental aspects such as germplasm resource screening, rubber synthesis pathway analysis, and cultivation technology optimization. Significant technical shortcomings remain in the precise improvement of latex-producing traits. Therefore, identifying key genes regulating latex duct development and rubber synthesis in rubber grass is an effective molecular improvement method to increase latex duct area and individual plant latex yield. This research will help overcome the bottleneck in high-yield rubber grass breeding and promote the large-scale development of my country's natural rubber substitution industry. Summary of the Invention

[0005] The first objective of this invention is to regulate genes that control latex duct development and rubber yield in rubber grass by overexpressing endogenous genes in rubber grass. TkbHLH14 It regulates the development of latex ducts and rubber synthesis in rubber-producing plants such as rubber grass.

[0006] A second objective of this invention is to provide an overexpression vector containing the aforementioned genes.

[0007] A third object of the present invention is to provide a method for knocking out the above-mentioned... TkbHLH14 CRISPR / Cas9 gene editing vectors.

[0008] A fourth objective of this invention is to provide the application of the above-mentioned gene in the cultivation of rubber grass plants with high rubber content or those that have completely lost their ability to synthesize rubber.

[0009] The fifth objective of this invention is to provide the application of the above-mentioned overexpression vector in the cultivation of rubber grass plants with high rubber content.

[0010] The sixth objective of this invention is to provide the application of the above-mentioned gene editing vector in the cultivation of rubber grass plants that have completely lost their ability to synthesize rubber.

[0011] The seventh object of the present invention is to provide a method for improving or completely inhibiting latex duct development and rubber synthesis in rubber grass.

[0012] The eighth objective of this invention is to provide a method for constructing rubber grass plants with high rubber content.

[0013] The ninth objective of this invention is to provide a method for constructing rubber grass plants that have completely lost their ability to synthesize rubber.

[0014] The tenth object of the present invention is to provide a product containing the above-described... TkbHLH14 Genetically engineered bacteria.

[0015] The first technical solution adopted in this invention is: genes that regulate latex duct development and rubber yield in rubber grass, including... TkbHLH14 The gene and a nucleotide sequence having at least 90% sequence identity with the nucleotide sequence shown in the gene, and encoding a protein that affects rubber synthesis. TkbHLH14 The gene nucleotide sequence is shown in SEQ ID NO.1; TkbHLH14 Genes can regulate the development of latex ducts and rubber synthesis in rubber grass.

[0016] The second technical solution adopted in this invention is: an overexpression vector containing the above-mentioned gene, wherein the expression vector comprises the above-mentioned... TkbHLH14 Genes, and those operable to connect to TkbHLH14 The 35S constitutive promoter of a gene; its construction method includes the following steps: cloning TkbHLH14 Genes and primer pairs TkbHLH14 -F and TkbHLH14-RSEQ ID NO.3 was used for PCR amplification, and its nucleic acid sequences are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively; the pCAMBIA1300 vector and PCR product were digested with enzymes; a recombinant plasmid was constructed by homologous recombination; after transformation into E. coli, the plasmid was extracted to obtain the overexpression vector.

[0017] The third technical solution adopted in this invention is: knocking out the above-mentioned... TkbHLH14 The CRISPR / Cas9 gene editing vector for gene generation, the method for constructing this gene editing vector includes the following steps: predicting gene editing using the CRISPOR platform. TkbHLH14 gRNA targets of genes; designing target primers such as TkbHLH14 -DT1-BsF、 TkbHLH14 -DT1-F0、 TkbHLH14 -DT2-R0、 TkbHLH14 -DT2-BsR, whose nucleic acid sequences are shown in SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, and SEQ ID NO.7, respectively; a Cas9 / gRNA expression vector was constructed; and after transformation into E. coli, extracts were obtained. TkbHLH14 CRISPR / Cas9 gene editing vector plasmid.

[0018] The fourth technical solution adopted in this invention is the application of the above-mentioned gene in cultivating rubber grass plants with high rubber content or those that have completely lost their ability to synthesize rubber.

[0019] The fifth technical solution adopted in this invention is: the application of the above-mentioned overexpression vector in the cultivation of rubber grass plants with high rubber content.

[0020] The sixth technical solution adopted in this invention is: the application of the above-mentioned gene editing vector in cultivating rubber grass plants that have completely lost their ability to synthesize rubber.

[0021] The seventh technical solution adopted in this invention is: a method for enhancing or completely inhibiting latex duct development and rubber synthesis in rubber grass, by overexpressing or knocking out the aforementioned [specific compounds] in rubber grass. TkbHLH14 Gene.

[0022] The eighth technical solution adopted in this invention is: a method for constructing rubber grass plants with high rubber content, comprising: constructing plants containing the above-mentioned... TkbHLH14 Plant expression vectors for genes; transformation with Agrobacterium; Agrobacterium-mediated transformation of rubber grass explants; screening for positive transgenic plants; identification. TkbHLH14 Expression level and rubber content.

[0023] The ninth technical solution adopted in this invention is: a method for constructing rubber grass plants that have completely lost their ability to synthesize rubber, comprising: constructing the aforementioned CRISPR / Cas9 gene editing vector; transforming Agrobacterium; Agrobacterium-mediated transformation of rubber grass explants; screening for positive transgenic plants; and identifying... TkbHLH14 Gene editing status and rubber content.

[0024] The tenth technical solution adopted in this invention is: containing the above-mentioned... TkbHLH14 Genetically engineered bacteria.

[0025] The beneficial effects of this invention are: This invention involves introducing and overexpressing [the substance] in rubber grass. TkbHLH14 The gene significantly increased the latex duct cell area and natural rubber content in the roots of transgenic rubber grass plants. Furthermore, rubber grass plants with this gene knocked out lacked latex duct cells in their roots and completely lost their ability to synthesize natural rubber. Experimental data show (see...) Figure 6 (7, 8, 9) The rubber content of the overexpressing transgenic plants reached 15.17% of the dry weight, which was about 13.62% higher than the 13.35% of the wild-type control plants, while the mutant plants had no rubber content. In addition, the root latex cell area of ​​the overexpressing transgenic plants was 12.98%, which was about 7.94% higher than the 11.39% of the wild-type control plants, while the mutant plants had no rubber content. The effect was extremely significant.

[0026] The genetic material provided by this invention offers a high-quality germplasm resource for producing natural rubber by replacing the Brazilian rubber tree with rubber grass.

[0027] The present invention systematically analyzes TkbHLH14 The function of genes in the latex duct development and natural rubber biosynthesis of rubber grass has led to the creation of a wealth of transgenic rubber grass materials, laying the foundation for a deeper understanding of the molecular mechanism of natural rubber synthesis. Attached Figure Description

[0028] Figure 1 In this invention TkbHLH14 Schematic diagram of gene expression patterns in different tissues during the peak flowering period of rubber grass; Figure 2 In this invention TkbHLH14 Schematic diagram of gene expression patterns in latex throughout the entire growth period of rubber grass; Figure 3 In this invention TkbHLH14 Schematic diagram of gene overexpression line detection results; Figure 4 In this invention TkbHLH14 A schematic diagram showing the results of target site editing in gene knockout plants; Figure 5 In this invention TkbHLH14 Schematic diagram of gene overexpression, gene knockout mutant plants and wild-type rubber grass phenotypic analysis; Figure 6 To Figure 5 Schematic diagram of root dry weight and rubber content determination for various strains of rubber grass in China; Figure 7 To Figure 5 Analysis of gum-producing traits of various strains, dry gum fiber drawing and root cross-section; Figure 8 for Figure 5 Schematic diagram of iodine-bromine staining on paraffin sections of roots from various strains of rubber grass in China; Figure 9 for Figure 5 A schematic diagram showing the statistical area of ​​latex cells in the roots of various rubber grass strains. Detailed Implementation

[0029] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments.

[0030] This invention discloses genes that regulate latex duct development and rubber yield in rubber grass, including... TkbHLH14 The gene and a nucleotide sequence having at least 90% sequence identity with the nucleotide sequence shown in the gene, and encoding a protein that affects rubber synthesis. TkbHLH14 The gene nucleotide sequence is shown in SEQ ID NO.1; TkbHLH14 Genes can regulate the development of latex ducts and rubber synthesis in rubber grass.

[0031] The present invention also discloses an overexpression vector containing the above-mentioned gene, the expression vector comprising... TkbHLH14 Genes, and those operable to connect to TkbHLH14 The 35S constitutive promoter of a gene.

[0032] This invention also discloses a method for constructing the above-mentioned expression vector, which is specifically implemented according to the following steps: (1) Cloning the target gene TkbHLH14 The gene was amplified by PCR and ligated into the pEASY-T1 cloning vector. The ligation product was transformed into E. coli and plasmids were extracted. In step 1, primer pairs are used to clone the target gene. TkbHLH14 -F、 TkbHLH14 Obtained by -R amplification. TkbHLH14 -F sequences, such as SEQ ID NO.2, TkbHLH14 The -R sequence is shown in SEQ ID NO.3.

[0033] (2) Determine the restriction sites and digest the expression vector pCAMBIA1300; (3) Homologous recombination: The target fragment is constructed into the linearized pCAMBIA1300 vector to obtain the recombinant plasmid; (4) Transformation of Escherichia coli using recombinant plasmids; (5) Extract plasmids from the correctly sequenced bacterial culture to obtain the overexpression vector.

[0034] This invention also discloses the method of knocking out the above-mentioned TkbHLH14 CRISPR / Cas9 gene editing vectors.

[0035] The present invention also discloses the above-mentioned TkbHLH14 The construction method for CRISPR / Cas9 gene editing is implemented according to the following steps: (1) TkbHLH14 Gene target selection will TkbHLH14 The CDS sequences were put into the CRISPOR online platform to predict gRNA, and high-scoring candidate target sequences were obtained through screening. (2) TkbHLH14 Target primer design; In step 2, primers are used to clone the target gene. TkbHLH14 -DT1-BsF、 TkbHLH14 -DT1-F0、 TkbHLH14 -DT2-R0、 TkbHLH14 It is obtained by amplification of DT2-BsR. TkbHLH14 The -DT1-BsF sequence is shown in SEQ ID NO.4. TkbHLH14 The -DT1-F0 sequence is shown in SEQ ID NO.5. TkbHLH14 The -DT2-R0 sequence is shown in SEQ ID NO.6. TkbHLH14 The -DT2-BsR sequence is shown in SEQ ID NO.7.

[0036] (3) Construction of Cas9 / gRNA- TkbHLH14 Expressive vehicle; (4) Transformation of Escherichia coli with recombinant plasmids; (5) Extract plasmids from the correctly sequenced bacterial cultures, i.e. TkbHLH14 CRISPR / Cas9 gene editing vector.

[0037] The present invention also discloses engineered bacteria containing the above-mentioned genes.

[0038] This invention also discloses the application of the above-mentioned gene in cultivating rubber grass plants with high rubber content or those that have completely lost their ability to synthesize rubber.

[0039] This invention also discloses the application of the above-mentioned overexpression vector or CRISPR / Cas9 gene editing vector in cultivating rubber grass plants with high rubber content or those that have completely lost their ability to synthesize rubber.

[0040] This invention also discloses a method for enhancing or completely inhibiting latex duct development and rubber synthesis in rubber grass, by overexpressing or knocking out the aforementioned [specific compounds / elements]. TkbHLH14 Gene.

[0041] This invention also discloses a method for constructing rubber grass plants with high rubber content, specifically implemented according to the following steps: (1) Construct a plant expression vector containing the above genes; (2) Transform the expression vector into Agrobacterium; (3) Transformation of rubber grass explants using Agrobacterium-mediated transformation; (4) Positive transgenic rubber grass plants were obtained through screening; (5) Identification of transgenic plants TkbHLH14 Gene expression levels, gene editing status, and rubber content.

[0042] This invention also discloses a method for constructing rubber grass plants that have completely lost their ability to synthesize rubber, specifically implemented according to the following steps: (1) Construction TkbHLH14 CRISPR / Cas9 gene editing vector; (2) Transform the above gene editing vector into Agrobacterium; (3) Transformation of rubber grass explants using Agrobacterium-mediated transformation; (4) Positive transgenic rubber grass plants were obtained through screening; (5) Identification of transgenic plants TkbHLH14 Gene expression levels, gene editing status, and rubber content.

[0043] The technical solution of the present invention will be further described below with reference to embodiments and accompanying drawings.

[0044] The rubber grass TK20 samples used in the following examples were collected from Ili Kazakh Autonomous Prefecture, Xinjiang (42°N, 80°E). The plants were sterile after explant detoxification and tissue culture. Culture conditions were set as follows: alternating light cycles of 16 hours of light and 8 hours of darkness, with a temperature of approximately 25°C and a relative humidity of around 60% in an artificial climate culture chamber.

[0045] The specific method for obtaining it is as follows: (1) Select healthy rubber grass TK20 plants growing in a substrate with a volume ratio of nutrient soil to vermiculite of 3:1, and cut off the well-grown leaves from them; (2) Disinfect with 2% sodium hypochlorite solution for 200~240s; (3) Rinse with sterile distilled water 3 to 5 times, each time for 120 to 180 seconds; (4) Wipe dry with sterile filter paper, place on MS medium, and allow to recover for 2-3 days; (5) Cut clean leaves into leaf segments with a side length of 1 cm and place them on MS medium, with the lower epidermis of the leaves attached to the surface of the medium. (6) The culture medium should be changed every 7 days during the period to continuously induce budding; (7) After sprouting, use tweezers to break off the young shoots and place them on 1 / 2 MS medium for rooting culture; (8) Transplant the rubber grass tissue culture seedlings that have been rooted for 2 months into a substrate made of nutrient soil and vermiculite in a 3:1 ratio, and further cultivate them in an artificial climate chamber under the above cultivation conditions. (9) After growing in the artificial climate chamber for 2 months, the plants were transferred to a vernalization incubator for 1 month of low-temperature vernalization treatment. After vernalization, the plants were transferred back to the artificial climate chamber for growth.

[0046] The strains and vectors used in the following examples are shown in Table 1 below: Table 1

[0047] Example 1 Rubber grass plant genomic DNA extraction (1) Take 0.1 g of fresh leaves and place them in a 2 mL centrifuge tube containing steel balls. Grind them into powder using a cryogenic grinder at 30 Hz for 45 s. (2) Add 300 μL of preheated 2×CTAB buffer, mix well and incubate at 65°C for 30 min; (3) After cooling, add an equal volume of chloroform, vortex, centrifuge at 4°C and 12,000 rpm and collect the supernatant; (4) Add 500 μL of pre-cooled anhydrous ethanol, precipitate at –20°C for several hours, and collect the precipitate by centrifugation; (5) Discard the supernatant, air dry the precipitate, add 50 μL of deionized water to dissolve it, add 1 μL of RNase A to digest at room temperature for 30 min, and store at –20°C.

[0048] Example 2 RNA extraction and cDNA synthesis from rubber grass RNA extraction from rubber grass roots, leaves, flowers, flower stalks, and latex at six different stages: Materials from the above-mentioned different tissues of rubber grass were collected, ground into powder by liquid nitrogen cryogenics, and RNA was extracted from rubber grass roots, leaves, flowers, flower stalks, and latex using the RNAprepPure polyphenol polysaccharide plant total RNA extraction kit from Beijing Tiangen Biotech Co., Ltd.

[0049] TkbHLH14 Analysis of gene expression patterns in different tissues during the peak flowering period of rubber grass, as follows: Figure 1 As shown.

[0050] Using a reverse transcription kit (Hiscript III 1st Strand cDNA Synthesis Kit), 1 μg of total RNA from each tissue was added to 16 μL of 4×gDNA wiper Mix and incubated at 42°C for 2 min to remove genomic DNA. Then, 4 μL of 5×HiScript III qRT SuperMix was added, and the mixture was incubated at 37°C for 15 min, followed by 85°C for 5 s to complete the reverse transcription. The obtained product was diluted 10-fold and used for quantitative PCR and gene cloning. The remaining cDNA was stored at -20°C.

[0051] Example 3 TkbHLH14 Gene expression pattern analysis, TkbHLH14 Gene expression patterns in latex throughout the entire growth period of rubber grass, such as Figure 2 As shown. According to TkbHLH14 Design quantitative primers for gene CDS sequence: q TkbHLH14 -F and q TkbHLH14 -R, as shown in Table 2. Using root, leaf, flower, and pedicel cDNA from rubber grass at its peak flowering period, as well as latex cDNA from different stages, as templates, q... TkbHLH14 -F / R and qTkTRB-F / R (internal reference gene) TkTRB Primers were used, and quantitative PCR was performed according to the ChamQ Universal SYBR qPCR Master Mix instructions. The reaction system and procedure are shown in Table 3. Melting curve analysis was performed. Each sample was tested in triplicate, using 2... ΔΔCt Method calculation TkbHLH14 Relative expression levels in different tissues.

[0052] Table 2

[0053] Table 3

[0054] Example 4 TkbHLH14 Cloning of genes 1. TkbHLH14 Primer design for gene CDS sequences according to TkbHLH14 Design amplification primers based on the CDS sequence of the gene. TkbHLH14 -F and TkbHLH14 -R (sequences are shown in Table 4): Table 4

[0055] 2. PCR amplification reaction Using latex cDNA as a template, PCR amplification was performed using PrimeSTAR HS DNA Polymerase. The reaction system and procedure are shown in Table 5. Table 5

[0056] 3. Agarose gel electrophoresis detection Mix the 6× Loading buffer with the PCR reaction product in the specified ratio, and perform 1% agarose gel electrophoresis (120 V, 10-15 min). Observe the results using a gel imaging system.

[0057] 4. PCR product purification (gel recovery) The target product was recovered using the FastPure Gel DNA Extraction Mini Kit.

[0058] Example 5 pCAMBIA1300- TkbHLH14 Construction of overexpression vectors The pCAMBIA1300 vector was subjected to enzyme digestion, and the system is shown in Table 6: Table 6

[0059] The enzyme digestion products were detected by electrophoresis, then purified and recovered by gel excision to obtain the enzyme containing... Pst I and Spe I. Linearized vector with sticky ends. The linearized pCAMBIA1300 vector, after enzyme digestion, was homologously recombinated with the recovered product. The reaction system and procedure are shown in Table 7. The ligation product was transformed into DH5α competent cells and cultured on LB solid medium containing 50 mg / L Kan for selection. Single colonies were picked for PCR detection. Single colonies with consistent band sizes were sequenced, and plasmids with correct sequences were extracted.

[0060] Table 7

[0061] Example 6 rubber grass TkbHLH14 Construction of CRISPR / Cas9 vectors 1. TkbHLH14 Target selection Based on the design principles of the CRISPR / Cas9 system, this study uses bioinformatics screening methods to obtain... TkbHLH14 Highly effective gRNA target sites. First, [the following is a list of steps]... TkbHLH14The CDS sequences were entered into the CRISPOR (http: / / crispor.tefor.net / ) online platform to predict gRNA, and high-scoring candidate target sequences (including PAM sequences) were obtained through screening. Specific targets were then selected by BLASTN alignment.

[0062] 2. TkbHLH14 Target primer design Primers were designed based on the selected target sequence and constructed into the pG3H-U6SC vector. The primers are shown in Table 8. Table 8

[0063] 3. Cas9 / gRNA- TkbHLH14 Carrier construction (1) Using a high-fidelity enzyme, following the reaction system and procedure in Table 9, the target site was fused with the pCBC-DT1T2.2 vector to construct a 2gRNA expression unit; Table 9

[0064] (2) The target band of about 500 bp was recovered by agarose gel electrophoresis using a product purification kit (FastPure Gel DNAExtraction Mini Kit).

[0065] (3) The purified product was subjected to the Golden Gate reaction according to the system and procedure in Table 10: (4) The reaction product was transformed into Escherichia coli DH5α competent cells (see Example 5). (5) Perform colony PCR detection on positive single clones. Shake the positive single clones that are correctly detected, extract plasmids, and send them for sequencing (refer to Example 5). Store the plasmids and bacterial cultures with correct sequencing results for later use.

[0066] Table 10

[0067] Example 7 Agrobacterium-mediated transformation and identification of recombinant plasmids (1) Remove Agrobacterium competent cells EHA105 and recombinant plasmids and thaw them on ice; (2) Add 0.1-1 μL of recombinant plasmid to 50 μL of Agrobacterium competent cells EHA105 and mix well by pipetting; (3) Place on ice for 5 min, freeze in liquid nitrogen for 5 min, incubate at 37°C for 5 min, and then in an ice bath for 5 min in sequence; (4) Add 700 μL of LB liquid medium and incubate at 28°C and 200 rpm for 2-3 h with shaking. (5) Take 150 μL of bacterial culture and spread it on LB solid medium with a final concentration of 50 mg / L Kan and 25 mg / L Rif, and incubate at 28°C for 48 h; (6) Perform PCR detection on single clones and store the correctly detected bacterial solutions at -80°C.

[0068] Example 8 rubber grass TkbHLH14 Acquisition of transgenic genetic material The specific steps for stable genetic transformation of rubber grass mediated by Agrobacterium are as follows: (1) Cut rubber grass leaves into 0.5 cm segments and pre-culture them on MS medium for 2-3 days; (2) Take out the Agrobacterium EHA105 strain with overexpression and gene editing vector from -80°C, dip the bacterial solution with the inoculation loop, and streak it on LB solid medium containing 50 mg / L Kan and 25 mg / L Rif. (3) Pick a single colony and inoculate it into liquid LB medium containing the same antibiotic, and incubate at 28°C and 200 rpm until OD. 600 ≈0.8, take 500 μL of bacterial culture and expand to 50 mL, OD 600 ≈0.5; (4) Centrifuge at 4000 rpm at room temperature for 10 min, discard the supernatant and collect the bacterial cells; (5) Add 20 mL ddH2O to resuspend the bacterial cells (vortex until they do not stick to the wall), centrifuge under the same conditions, and discard the supernatant; (6) Resuspend the bacterial cells in MS liquid medium containing 1 mg / L 6-BA, 0.2 mg / L IAA, and 100 μM / L AS, and adjust the OD. 600 Reduce the concentration to 0.4-0.5 and let it stand at room temperature in the dark for 30 minutes. (7) Place the pre-cultured leaves in the invasive dye solution and incubate at 23°C and 80 rpm for 15 min with shaking. (8) Remove the explants and blot off excess bacterial solution with sterile filter paper. Incubate them in the dark on a co-culture medium for 2 days. (9) The cells were then transferred to a light-incubated culture room for 7 days of recovery. (10) Transfer the recovered explants to selective culture medium for selective culture. In the later stage, the plates are generally changed every 7 days. (11) During each of the above culture stages, if buds differentiate, they can be transferred to 1 / 2 MS rooting medium in a timely manner; (12) Transfer the rooted seedlings to tissue culture bottles containing screening rooting medium and replace the medium with fresh medium every 30-45 days.

[0069] Example 9 rubber grass TkbHLH14 Screening and identification of overexpression plants 1. DNA level detection (1) Extract rubber grass genomic DNA according to the operating steps of Example 1; (2) With 35S: TkbHLH14 The plasmid was used as a positive control for PCR detection using the vector primers in Table 11. The PCR reaction system is shown in Table 12. (3) After the PCR reaction was completed, the overexpression vector was successfully inserted into the rubber grass genome by agarose gel electrophoresis. TkbHLH14 Results of gene overexpression line detection are as follows Figure 3 As shown.

[0070] Table 11

[0071] Table 12

[0072] 2. RT-qPCR detection of the transcription level of the target gene (1) Extract leaf RNA and synthesize cDNA according to the steps in Example 2; (2) Using leaf cDNA as a template, RT-qPCR was performed according to the procedure in Example 3 to detect the expression of cDNA in overexpressing plants. TkbHLH14 The amount of expression.

[0073] 3. Rubber grass TkbHLH14 Hi-TOM sequencing of gene-edited mutants TkbHLH14 Results of target site editing in gene knockout plants are as follows: Figure 4 As shown.

[0074] (1) Genomic DNA was extracted from rubber grass leaves according to the operating steps of Example 1; (2) PCR detection: zCas9 and Hyg specific primers were designed (sequences are shown in Table 13). Using mutant and wild-type rubber grass genomic DNA as templates (wild-type was the negative control), PCR was performed according to the system in Table 12 (extension time 10 s). Electrophoresis was used to detect whether the pG3H-U6SC vector was integrated into the rubber grass genome. Table 13

[0075] (3) Design amplification primers for target sites 1 and 2 with "connectors". Using rubber grass genomic DNA as a template, PCR amplify the target sequence (total length of about 200 bp, including the segment containing the target sequence). Refer to Table 12 for the reaction system program. Adjust the extension time to 10 s. The target primer design is shown in Table 14. (4) Take 5 μL of PCR reaction product for agarose gel electrophoresis and complete the preliminary detection. Send the remaining part to the company for sequencing (sequencing service provided by the Rice Research Institute of Chinese Academy of Agricultural Sciences).

[0076] Table 14

[0077] TkbHLH14 Phenotypic analysis of gene overexpression, gene knockout mutants, and wild-type rubber grass, such as Figure 5 As shown.

[0078] Example 10 (1) Biomass determination Remove the rubber grass plant intact from the soil, rinse it with water, place it in an envelope, dry the material at 65°C until constant weight, remove the above-ground parts, and weigh the roots using a balance.

[0079] Figure 5 The root dry weight and rubber content of various strains of rubber grass were determined as follows: Figure 6 As shown.

[0080] (2) Determination of dry adhesive content 1. Crush the dried rubber grass roots to a length of about 0.5cm and mix thoroughly; 2. Take 0.5 g of the mixed sample and add 30 mL of ddH2O, then treat with boiling water for 1.5 h; 3. Discard the supernatant, add 30 mL of 3% KOH solution, and treat with boiling water for 3 h; 4. Wash the remaining part with ddH2O to remove root bark, lignin and other impurities; 5. Place the obtained root rubber in a 60℃ oven and dry it to constant weight, then weigh it using an analytical balance.

[0081] (3) Root profile observation Take the middle section of the main root of the rubber grass and cut a cross section by hand or with a vibrating slicer to observe the root cross-sectional structure.

[0082] (4) Observation of root strands Take the rubber grass roots that have been dried to constant weight, use tweezers to pick up the lateral roots of the rubber grass (3mm in diameter), and slowly stretch them longitudinally with your hand or tweezers to observe the fiber formation.

[0083] Figure 5Analysis of gum-producing traits of various strains, including dry gum fiber formation and root profiles, as shown in the figure. Figure 7 As shown.

[0084] Example 11 Iodine-bromine staining of rubber grass roots and statistical analysis of latex duct area Lateral roots of rubber grass with a diameter of 3 mm were taken and placed in 70% FAA fixative (63% alcohol, 30% water, 5% glacial acetic acid, 2% formaldehyde). After vacuuming for 15 min, the fixative was replaced, and the roots were fixed at 4°C for 48 h. After fixation, the roots were dehydrated with a gradient of alcohol (50%→70%→85%→95%→100%), treated with glacial acetic acid for 2 h, and stained with iodine bromide at 60°C for 10–11 h. The roots were then washed with glacial acetic acid, transitioned with a series of alcohol and n-butanol solutions, and embedded in paraffin at 60°C. 10 μm thick sections were cut using a semi-automatic paraffin sectioner, dewaxed with xylene, stained with Fast Green, cleared with alcohol and xylene, and mounted with neutral resin. The sections were observed and photographed under a stereofluorescence microscope. The latex duct region was delineated using ImageJ software, and the ratio of the total latex duct area to the total area of ​​the root cross-section was calculated; this ratio represents the latex duct area percentage.

[0085] Figure 5 Paraffin sections of roots from various strains of rubber grass, stained with iodine and bromide, as shown below. Figure 8 As shown.

[0086] Figure 5 Statistics on the area of ​​latex cells in the roots of various rubber grass strains are as follows: Figure 9 As shown.

[0087] sequence list <110> Hainan University <120> Genes, vectors, methods, and applications for regulating latex duct development and latex production in rubber grass <160> 7 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1602 <212> DNA <213> Artificial sequence <400> 1 atggaggatc tgattgtctc cccatcctca tcttcttcga tcgtctcttt tcccaataca60 aacactccgc cacagtctga aactatccag cagaagctcc agacgcttct tcagaaccag120 ccacagccat gggcgtacgc tatcttctgg cagaccttca acgacgattc caacggctgt180 gtttcgttgt cgtggggtga cggtcatttc caaagcaata acgacgtccc ggcgacgaat2 ttgcactctt ctggaagctc cgccaccttt ctctccgact ccgatcccga ttgcaggaag300 tcggttctta aggagatcca ggcgcttctc ggaccggata atcgcgacga cgctgaatgg3 ttttatgtta tttcgttgac cagatcgttt attcccggag acgggtcggt tccgggtacg 420 tcttttggtt cgagctctat gatctggtta accggtgccg atcagcttca gagttttaac 480 tgcgagagag ctaaagaagc gcggattcac ggtttggaaa ccctagtttg catcccaacg540 ccaaacggcg tcgtggagat gggttcgtat catgtgattg aggaaacatg gagtttggct600 catcaggcaa ggtcgctgtt cggcggtggt tcttcttctg cttcttgttc tccgccgaat 660 actcttccga actacttcca taacaccat gaagccaccg cgacactaa ccctatgaag7 ctagacagcc tcaacgaaga acatcataat attatttctt tcgctgatat ggtactcatg7 gctggggat tacaagagga ggaaggtatg aacatgatcg atttcgaatc agcaaccgcc8 gatcaccaga tgtccaaaaa cgtcggaga tcatgcatga ataaaaacac ccttcccgcg9 acgactacaa acacgtacgt ggaaactggg tcgtcggagc attccgattc cgactgccag960 ctcgttcttg caacctcaga aagacggatg cagaagaga aaggcaaga aaccggcggt1 agggatccac ctgtaaacca cgtggaggcg gaaggcagc ggcgtgaaaa gctcaaccag1 cgtttctacg cgctacgttc cgtggtcccg aacgtgtcta ggatggacaa ggcgtcgctc1140 ttggcggatg ctgtctgcta tatcacga ttgaagga aagtcgaga tcttgaatcg1 caattacacc ctcgagccaa cagtcaaggt aaaacgaaac gagtgaaggt ggaaatggcg1 gacaccatgg aaaaccatct tcaaagcagc stirring gtttgtatca stirringggtt1 tcgacaaaac ctacgataaa gattaacagc aagacgggtg gtttcaggga ggtggaagtg1 aagatcgtcg gagaagatgc gatgattagg gttcagtcag ggaacgcgga cttgccggct1 gctaattaa tggatgcttt gagagaaatg aaagcgcaaa tccagcatgc aagcatgtcg1 tgtgtgaatg aggtaatgtt gcaagatgtg gtggtgaaga ttcctggtgc attagatgaa1 gatgaactaa aaaccgatct cattaggaga ttagaccgct ag1602 <210>2 <211>31 <212>DNA <213>Artificial sequence <400>2 aactgcagat ggaggatctg attgtctccc c31 <210>3 <211>29 <212>DNA <213>Artificial sequence <400>3 ggactagtgc ggtctaatct cctaatgag29 <210>4 <211>39 <212>DNA <213>Artificial sequence <400>4 ATATATGGTCTCGATTGCTGGTTCTGAAGAAGCGTCGTT39 <210>5 <211>41 <212>DNA <213>Artificial sequence <400>5 TGCTGGTTCTGAAGAAGCGTCGTTTTAGAGCTAGAAATAGC41 <210>6 <211>43 <212>DNA <213>Artificial sequence <400>6 AACGTCCGAGAAGCGCCTGGATCAATCTCTTAGTCGACTCTAC43 <210>7 <211>39 <212>DNA <213>Artificial sequence <400>7 ATTATTGGTCTCGAAACGTCCGAGAAGCGCCTGGATCAA39

Claims

1. A gene that regulates latex duct development and rubber yield in rubber grass, characterized by, include TkbHLH14 The gene and the nucleotide sequence having at least 90% sequence identity with the nucleotide sequence shown in the gene and encoding a protein that affects rubber synthesis, wherein... TkbHLH14 The nucleotide sequence of the gene is shown in SEQ ID NO.1; TkbHLH14 Genes can regulate the development of latex ducts and rubber synthesis in rubber grass.

2. An overexpression vector containing the gene as described in claim 1, characterized in that, The expression vector comprises the one described in claim 1. TkbHLH14 Genes, and operably linked to the TkbHLH14 The 35S constitutive promoter of a gene; its construction method includes the following steps: cloning TkbHLH14 Genes and primer pairs TkbHLH14 -F and TkbHLH14 -RSEQ ID NO.3 was subjected to PCR amplification, and its nucleic acid sequences are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively; the pCAMBIA1300 vector and PCR product were digested with enzymes; a recombinant plasmid was constructed by homologous recombination; after transformation into E. coli, the plasmid was extracted to obtain the overexpression vector.

3. Knockout as described in claim 1 TkbHLH14 CRISPR / Cas9 gene editing vectors for genes, characterized in that, The gene editing vector construction method includes the following steps: predicting using the CRISPOR platform. TkbHLH14 gRNA targets of genes; designing target primers such as TkbHLH14 -DT1-BsF、 TkbHLH14 -DT1-F0、 TkbHLH14 -DT2-R0、 TkbHLH14 -DT2-BsR, whose nucleic acid sequences are shown in SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, and SEQ ID NO.7, respectively; a Cas9 / gRNA expression vector was constructed; and after transformation into E. coli, extracts were obtained. TkbHLH14 CRISPR / Cas9 gene editing vector plasmid.

4. The application of the gene according to claim 1 in cultivating rubber grass plants with high rubber content or those that have completely lost their ability to synthesize rubber.

5. The application of the overexpression vector according to claim 2 in cultivating rubber grass plants with high rubber content.

6. The application of the gene editing vector according to claim 3 in cultivating rubber grass plants that have completely lost their ability to synthesize rubber.

7. A method for enhancing or completely inhibiting latex duct development and rubber synthesis in rubber grass, characterized in that, Overexpression or knockout of the expression as described in claim 1 in rubber grass TkbHLH14 Gene.

8. A method for constructing rubber grass plants with high rubber content, characterized in that, include: Constructing the structure described in claim 1 TkbHLH14 Plant expression vectors for genes; transformation of Agrobacterium; Agrobacterium-mediated transformation of rubber grass explants; screening of positive transgenic plants; identification. TkbHLH14 Expression level and rubber content.

9. A method for constructing rubber grass plants that have completely lost their ability to synthesize rubber, characterized in that, include: Construct the CRISPR / Cas9 gene editing vector as described in claim 3; transform it into Agrobacterium; Agrobacterium-mediated transformation of rubber grass explants; screening of positive transgenic plants; identification. TkbHLH14 Gene editing status and rubber content.

10. Containing the as described in claim 1 TkbHLH14 Genetically engineered bacteria.

Images