Plant epidermal hair development regulatory genes, targeting agents thereof, mutants and applications thereof

Abstract

This invention relates to a gene regulating plant epidermal trichome development, its targeting reagent, mutants, and their applications, aiming to solve the technical problems in existing tobacco breeding where single-gene regulation of glandular trichome density is limited and there is a lack of precise bidirectional regulation of epidermal trichome types. This invention clones a gene from tobacco. MTR2 and MTR3 Genes were used to construct single-gene knockout vectors and transform them into tobacco to obtain... MTR2 Knockout strains and MTR3 Knockout lines were obtained through hybridization. MTR2 and MTR3 A homozygous mutant line with two genes. Identification showed that... MTR2 and MTR3 Both genes negatively regulate the development of long-stalked glandular trichomes in tobacco, and simultaneous inactivation mutations of both genes resulted in a significant synergistic increase in long-stalked glandular trichome density and a significant decrease in non-secretory epidermal trichome density, demonstrating a synergistic effect. Further investigation using the two genes... MTR2 , MTR3 The aggregation mutation strategy can optimize the composition and structure of tobacco leaf epidermal hairs, and is especially suitable for the genetic improvement of tobacco varieties and agricultural production.

Description

Technical Field

[0001] This invention relates to the field of molecular-assisted breeding technology, specifically to a gene regulating plant epidermal hair development, its targeting reagent, mutants, and their applications. Background Technology

[0002] Many terrestrial plants have a layer of epidermal hairs on the surface of their above-ground parts, which play an important role in plant growth and development and in responding to various biotic and abiotic stresses. Tobacco ( Nicotiana tabacum As an important economic crop, tobacco leaves are covered with abundant epidermal hairs. Based on morphology and secretion capacity, tobacco epidermal hairs can be divided into secretory epidermal hairs (glandular hairs) and non-secretive epidermal hairs. Among them, glandular hairs are further subdivided into long-stalked glandular hairs and short-stalked glandular hairs. Long-stalked glandular hairs are distinguished from short-stalked glandular hairs, which contain multiple glandular stalk cells, by containing only a single stalk cell.

[0003] Glandular trichomes hold significant economic value for tobacco production, primarily in two aspects: First, trichome secretions enhance the tobacco plant's resistance to abiotic stresses such as herbivorous insects, pathogenic microorganisms, and high temperatures and drought, thereby stabilizing tobacco yield. Second, components in these secretions, such as cephalosporin diterpenes, lysine diterpenes, and sucrose esters, are key aroma precursors. During tobacco curing, aging, and smoking, these secretions degrade to produce solanone, ambergris-like substances, and various small-molecule acids and esters, significantly improving the sensory quality and industrial usability of tobacco leaves. Long-stalked glandular trichomes are the main sites of synthesis and storage for these secretions. Therefore, increasing the density of long-stalked glandular trichomes in tobacco leaves is crucial for enhancing the plant's stress resistance and improving leaf quality.

[0004] Glandular trichomes differentiate from tobacco leaf epidermal cells, and their development is controlled by a sophisticated and complex molecular regulatory network. With the development of molecular genetics and functional genomics, some genes involved in regulating tobacco glandular trichome formation have been identified. For example, patent document (CN117660472A) discloses… NtJAZ15 A gene, when mutated, significantly increases the number of long-stalked glandular hairs on tobacco leaves; similarly, NtJAZ9, NtJAZ11, NtWOX, NtLFS, NtMIXTAGenes such as [list of genes] have also been found to participate in the occurrence and development of glandular trichomes. However, the number of regulatory genes reported so far is limited, and the regulatory mechanisms they reveal are still incomplete. The technical system for targeted and precise improvement of glandular trichome density through molecular breeding is still imperfect. In particular, existing technologies have limited effectiveness in increasing glandular trichome density by regulating a single target gene, and often fail to achieve differentiated and synergistic regulation of different types of epidermal trichomes. For example, in existing studies, overexpression or knockout of a single positive or negative regulatory factor usually only results in a small change in the density of long-stalked glandular trichomes, and such operations often have undesirable effects on the density of non-secreting epidermal trichomes, or at least fail to achieve beneficial synergistic regulation of both. For tobacco, where long-stalked glandular trichomes are the main secretory component and non-secreting epidermal trichomes are a non-target trait, how to significantly increase the density of long-stalked glandular trichomes while inhibiting or at least not increasing the occurrence of non-secreting epidermal trichomes constitutes a pressing technical problem to be solved in this field. Furthermore, there are no precedents in the literature that have been reported in order to obtain synergistic phenotypes that go beyond the simple superposition of single-gene effects by simultaneously manipulating two or more target genes.

[0005] Therefore, discovering and identifying new functional genes that regulate the development of tobacco glandular trichomes, and developing technical solutions that can synergistically increase the density of long-stalked glandular trichomes while inhibiting the development of non-secretory epidermal trichomes, is of great theoretical significance and practical value for molecular breeding of tobacco stress resistance and quality.

[0006] The information disclosed in this background section is intended only to enhance the understanding of the background technology of this disclosure and should not be construed as an admission or in any way implying that the information constitutes prior art known to those skilled in the art. Summary of the Invention

[0007] To address the limitations of existing tobacco breeding techniques that rely on single-gene regulation to increase glandular trichome density and lack precise bidirectional regulation of epidermal trichome types, this invention is based on two novel genes that have been identified and isolated by the inventors for the first time, possessing negative regulatory functions on tobacco glandular trichome development— MTR2 Genes and MTR3 Genes were constructed using CRISPR / Cas9 gene editing technology. MTR2 and MTR3 Gene knockout vectors were used to transform tobacco and obtain corresponding single-gene loss-of-function mutant lines; further, two single-mutant lines were combined through hybridization breeding to create new strains. MTR2 and MTR3 Tobacco lines with simultaneous mutations in two genes. Experimental identification showed that... MTR2 and MTR3Both genes negatively regulate the occurrence of long stalk glandular trichomes in tobacco (increasing by 1.57 times and 2.17 times respectively compared to wild type), and both genes showed a significant synergistic increase in long stalk glandular trichome density after simultaneous inactivation mutation (increasing by 5.63 times compared to wild type) and a significant decrease in epidermal trichome density in non-secretory type (reduced by 43%).

[0008] The first aspect disclosed in this application provides an isolated nucleic acid molecule that has the function of negatively regulating the occurrence of plant glandular trichomes, which is at least one of the following: (a) Tobacco as shown in SEQ ID NO: 1 MTR2 Gene; or nucleotide sequence encoding the protein shown in SEQ ID NO: 2; (b) Tobacco as shown in SEQ ID NO: 3 MTR3 Gene; or nucleotide sequence encoding the protein shown in SEQ ID NO: 4; (c) A nucleotide sequence that hybridizes with the nucleotide sequence defined in (a) or (b) under highly stringent conditions and encodes a protein having the same function; (d) A nucleotide sequence that has at least 90% identity with the nucleotide sequence defined in (a), (b) or (c) and encodes a protein having the same function.

[0009] The second aspect disclosed in this application provides a biological material, which is any one of the following: (1) A recombinant vector containing the aforementioned nucleic acid molecule, or containing a specific target MTR2 Genes and / or MTR3 Gene editing systems; (2) The host cell or transgenic cell line contains the nucleic acid molecule or the recombinant vector.

[0010] The third aspect disclosed in this application provides an isolated protein that negatively regulates the generation of tobacco glandular trichomes, wherein the protein is at least one of the following: (a) The amino acid sequence is as shown in SEQ ID NO: 2, or is derived from tobacco as shown in SEQ ID NO: 1. MTR2 Proteins encoded by genes; (b) The amino acid sequence is as shown in SEQ ID NO: 4, or is derived from the tobacco shown in SEQ ID NO: 3. MTR3 Proteins encoded by genes; (c) Proteins with the same function as the amino acid sequence shown in SEQ ID NO: 2 or SEQ ID NO: 4, which have been substituted, deleted or added with one or more amino acid residues.

[0011] The fourth aspect disclosed in this application provides a method for inactivating or inhibiting the activity of tobacco. MTR2 Genes and / or MTR3 The application of gene expression substances in regulating tobacco traits, including: (a) Synergistically increases the density of glandular trichomes on tobacco stalks; and / or (b) Inhibit the development of non-secretory epidermal hairs in tobacco.

[0012] The fifth aspect disclosed in this application provides a tobacco mutant plant or a portion thereof, wherein the endogenous MTR2 Genes and / or MTR3 Gene expression or function is specifically reduced or eliminated, and the tobacco plant exhibits the following phenotype: (i) Compared with wild-type tobacco, the density of long-stalked glandular trichomes is significantly increased; (ii) Compared with wild-type tobacco, the density of epidermal hairs in non-secretory type tobacco is significantly reduced.

[0013] Preferably, at least one of gene editing technology and RNA interference technology is used to achieve the desired effect. MTR2 Genes and MTR3 Knockout or knockdown of gene expression, either individually or simultaneously.

[0014] Preferably, the knockout is performed using a CRISPR / Cas gene editing system, which includes specific targeting... MTR2 sgRNA and / or specific targeting of genes MTR3 The sgRNA of the gene contains the nucleotide sequences shown in SEQ ID NO:5 and SEQ ID NO:6, respectively, as its target sequence.

[0015] The sixth aspect of this application discloses a method for detecting tobacco. MTR2 Genes and / or MTR3 Primer pair combinations for gene mutation states include: Used for detection MTR2 The first primer pair for gene mutation has the upstream primer sequence shown in SEQ ID NO: 7 and the downstream primer sequence shown in SEQ ID NO: 8; Used for detection MTR3 The second primer pair for gene mutation has the upstream primer sequence shown in SEQ ID NO: 9 and the downstream primer sequence shown in SEQ ID NO: 10.

[0016] The seventh aspect disclosed in this application provides a kit comprising the above-described sgRNA combination and / or, as described above, a primer pair combination.

[0017] The eighth aspect disclosed in this application involves using the nucleic acid molecule, the biological material, the protein, the tobacco plant or a portion thereof, the primer pair combination, or the kit for at least one of the following purposes: (a) Increases the content of glandular trichome secretions in tobacco leaves; (b) Improve the stress resistance or insect resistance of tobacco plants; (c) Improve the quality of tobacco leaves; (d) Molecular breeding of tobacco.

[0018] One or more technical solutions provided in the embodiments of this application have at least the following technical effects or advantages: 1. Synergistic enhancement of glandular trichome density: the first manifestation of simultaneous inactivation MTR2 and MTR3 Genes can produce a synergistic effect in tobacco. Experimental results show that... MTR2 Single-gene mutants and MTR3 The density of long-stalked glandular trichomes in the single-gene mutant strain was approximately 1.57-fold and 2.17-fold higher than that in the wild type, respectively; and further, MTR2 and MTR3 The aggregated line with simultaneous mutations of two genes showed an increase of approximately 5.63 times in the density of stalked glandular trichomes compared to the wild type. This increase far exceeded the simple mathematical sum of the increases in the two single-gene mutant lines, indicating a significant synergistic effect between the two in regulating the occurrence of stalked glandular trichomes.

[0019] 2. Non-secretory epidermal trichome synchronization inhibition: In MTR2 and MTR3 In polymorphic lines with simultaneous mutations in both genes, the density of non-secretory trichomes was reduced by approximately 43% compared to the wild type; while... MTR2 or MTR3 In isolated mutant lines, the density of non-secretory trichomes did not show statistically significant changes. This result indicates that... MTR2 and MTR3 Simultaneous inactivation not only produced a synergistic effect in quantity, but also endowed the double mutant with a new function that does not exist in the single mutant—namely, a significant inhibitory ability on the development of non-secretory epidermal hairs, achieving a synergistic and optimized regulation of "one increase and one decrease" in beneficial glandular hairs (long-stalked glandular hairs) and non-target epidermal hairs (non-secretory epidermal hairs).

[0020] 3. Key target genes and genetic manipulation tools with significant industrial application value were created: For the first time, key target genes and genetic manipulation tools were identified and isolated. MTR2 and MTR3 The gene was identified and its central role as a negative regulator in the regulatory network of tobacco glandular trichome development was confirmed. Based on this, the gene was targeted and knocked out using the CRISPR / Cas9 gene editing system. MTR2 and / or MTR3Genes were used to synergistically improve the glandular trichome trait in tobacco; to address the challenges of editing and screening polyploid genes in tobacco, specific targeting mechanisms were designed. MTR2 and MTR3 The sgRNA combinations and gene editing vectors for these genes exhibit high target specificity and low off-target risk. Furthermore, dedicated mutation detection primer pairs and kits are provided, enabling breeders to rapidly and accurately identify genotypes in segregating populations of hybrid offspring, efficiently screening for bigenic mutants and significantly shortening the molecular breeding cycle. In addition, these detection tools can provide intuitive and conclusive technical means for subsequent protection of the mutant varieties' variety rights and for obtaining evidence of market infringement.

[0021] 4. Comprehensive Enhancement of Tobacco Leaf Economic Value: Based on the aforementioned synergistic optimization and regulation of glandular trichome phenotypes, this invention ultimately achieves the following at the industrial level: By significantly increasing the density of long-stalked glandular trichomes, the total content of glandular trichome secretions such as cephalosporin diterpenes, lysine diterpenes, and sucrose esters in tobacco leaves is significantly enhanced, thereby simultaneously strengthening the field resistance of tobacco plants to biotic and abiotic stresses, and improving the aroma quality and industrial usability of cured tobacco leaves. Simultaneously, the reduction in the density of non-secreting epidermal trichomes further optimizes the trichome structure on the tobacco leaf surface, enhancing the proportion and overall competitiveness of beneficial secretory glandular trichomes. Attached Figure Description

[0022] Figure 1 As shown in one embodiment of this application MTR2 and MTR3 Gene cloning.

[0023] Figure 2 As shown in one embodiment of this application MTR2 and MTR3 Schematic diagram of gene knockout vector structure.

[0024] Figure 3 As shown in one embodiment of this application MTR2 and MTR3 Gene knockout vector bacterial culture PCR identification.

[0025] Figure 4 As shown in one embodiment of this application MTR2 and MTR3 Molecular identification of gene knockout plants.

[0026] Figure 5 This is a schematic diagram of the structure of the overexpression vector pC2300-35S-GFP-rbcs in one embodiment of this application.

[0027] Figure 6 As shown in one embodiment of this application MTR2 (A) and MTR3 (B) Detection of the expression level of the corresponding gene in the overexpressing plant.

[0028] Figure 7 As shown in one embodiment of this application MTR2, MTR3 Epidermal hair density analysis of gene overexpression, single mutation, and double mutation plants; where A is an observation image of epidermal hairs; B is the statistical analysis of epidermal hair density. Detailed Implementation

[0029] The following examples illustrate specific implementations of the present invention. However, these examples are merely for illustrative purposes and do not limit the scope of the invention in any way.

[0030] Unless otherwise specified, the instruments and equipment involved in the following embodiments are all conventional instruments and equipment; unless otherwise specified, the reagents and materials involved are all commercially available conventional products; unless otherwise specified, the test and detection methods involved are all conventional methods.

[0031] Example 1: MTR2, MTR3 Cloning of genes Obtained from the tobacco genome database MTR2, MTR3 The gene sequences of the genes were analyzed, and specific amplification primers were designed for each of the two genes. MTR2 The upstream and downstream primer sequences for the gene are as follows: F: ATGAACTACAGAAGGGAGAG, R:TCAATTCTTTGAATTGTTGA; MTR3 The upstream and downstream primer sequences for the gene are as follows: F:ATGAGCAGGAAGAATGGAAATG R:TTAAGTGAGCTTTCTCCTAG.

[0032] PCR amplification was performed using genomic DNA from K326 tobacco leaves as a template, and the desired DNA was successfully obtained. MTR2 and MTR3 The gene sequences are shown in SEQ ID NO.1 and SEQ ID NO.3, and the amino acid sequences deduced from them are shown in SEQ ID NO.2 and SEQ ID NO.4. MTR2 and MTR3 The amplified band sizes were 327 bp and 369 bp, respectively. Figure 1 ).

[0033] Example 2: MTR2, MTR3 Creation of gene knockout plants and acquisition of double gene-polymerized plants Using CRISPR / Cas9 gene editing technology to respectively MTR2 and MTR3Gene knockout was performed. Specific sgRNA targets were designed for each of the two genes, among which... MTR2 The target sequence of the gene is: GCTAAACTTATCTCCACCA(SEQ ID NO.5); MTR3 The target sequence of the gene is: GATGCTGTCAATGACCTGTT (SEQ ID NO. 6).

[0034] Nucleotide fragments of the target sequence were obtained using chemical synthesis and ligated into the BGK012 knockout vector. Figure 2 The ligation product was transformed into *E. coli* DH5α competent cells, and single colonies were picked. PCR identification was performed using the HYG gene knockout detection primers (F: CGAGAGCCTGACCTATTGCAT, R: CTGCTCCATACAAGCCAACCAC) on the knockout vector. Figure 3 The selected single clones were verified by sequencing, and the final construct was successfully completed. MTR2 and MTR3 Gene knockout vectors.

[0035] The above MTR2 and MTR3 The gene knockout vector was transferred into Agrobacterium GV3101 competent cells using the heat shock method. Tobacco K326 leaves were then infected using the Agrobacterium-mediated leaf disc transformation method. The infected leaves were placed on MS medium containing hygromycin for culture, and redifferentiated candidate knockout plants were obtained through tissue culture.

[0036] Genomic DNA was extracted from each candidate plant and used... MTR2 The upstream and downstream primer sequences of the gene (F: ATGAACTACAGAAGGGAGAG, SEQ ID NO.7; R: TCAATTCTTTGAATTGTTGA, SEQ ID NO.8) and MTR3 The upstream and downstream primer sequences of the gene were (F: ATGAGCAGGAAGAATGGAAATG, SEQ ID NO.9; R: TTAAGTGAGCTTTCTCCTAG, SEQ ID NO.10). Using the extracted genomic DNA as a template, PCR amplification and sequencing detection were performed.

[0037] The results showed that ( Figure 4 ), a tobacco plant MTR2 A single base insertion occurred in the gene, while in another tobacco plant... MTR3 A single base deletion occurred in the gene, and the two mutation types caused... MTR2and MTR3 Frameshift mutations in genes cause the target gene to lose its function.

[0038] Using the above-mentioned creation MTR2 and MTR3 Tobacco plants with isolated gene deletions were hybridized, and the resulting strains were selected from the F2 segregating population. MTR2 and MTR3 Aggregate plants with mutations in both genes.

[0039] Example 3: MTR2, MTR3 Creation of gene overexpression materials Construction of the overexpression vector: Based on the overexpression vector pC2300-35S-GFP-rbcS ( Figure 5 Multiple cloning sites and MTR2, MTR3 Primers containing restriction enzyme adaptors were designed based on the restriction enzyme sites contained in the CDS sequences of the two genes. MTR2 The upstream and downstream primer sequences for gene amplification are as follows: F: GAGCTCGGTACCCGGGGATCCATGAACTACAGAAGGGAGAGTAGTGATC, R: CTTGCTCACCATGGTGTCGACATTCTTTGAATTGTTGATTCTATCCTCG; MTR3 The upstream and downstream primer sequences for gene amplification are as follows: F: GAGCTCGGTACCCGGGGATCCATGAGCAGGAAGAATGGAAATGG, R: CTTGCTCACCATGGTGTCGACAGTGAGCTTTCCTAGTAGTAGTAGTAGTAGTG.

[0040] Using the primers described above, PCR amplification was performed on cDNA from tobacco leaves. The PCR amplification products were recovered from an agarose gel and then double-digested with the empty vector pC2300-35S-GFP-rbcS using BamHI and SalI, respectively. The PCR amplification products and the digested products of the pC2300-35S-GFP-rbcS empty vector were recovered from the agarose gel and then ligated using T4 DNA ligase. MTR2 and MTR3 The gene fragments were ligated with the digested empty vector. The ligation product was transformed into competent E. coli cells, and the desired gene was successfully obtained through sequencing screening. MTR2, MTR3 Positive monoclonal vectors for overexpression of two genes.

[0041] Obtaining overexpressing plants: Extracting from the above-mentioned positive monoclonal bacterial cultures... MTR2, MTR3Overexpression vector plasmids of the two genes were used to infect leaves of tobacco variety K326 using Agrobacterium-mediated transformation. MTR2 Six positive transgenic plants were successfully obtained. MTR3 Five positive transgenic plants were successfully obtained. RNA was extracted from the positive transgenic plants and detected by real-time quantitative PCR. MTR2, MTR3 The expression levels of the two genes. Among them, MTR2 The upstream and downstream primer sequences for quantitative PCR of genes are as follows: F: CCATCTTCTTCGATGGAAAG, R: CACTTTGGATCATCCACTG; MTR3 The upstream and downstream primer sequences for gene amplification are as follows: F: CAGTACATTAACCAACATCC, R: GCCCACAAGAACCATAGATG.

[0042] The results showed that the expression levels of the target genes in each positive plantlet were significantly higher than those in the control. Figure 6 The single plants with the highest relative expression levels were selected for subsequent experiments.

[0043] Example 4: MTR2, MTR3 Observation and density statistics of epidermal hairs in gene-overexpressing, single-mutant, and double-mutant plants The above-mentioned creation MTR2 and MTR3 The morphology of epidermal hairs on tobacco leaves was observed using a super depth-of-field microscope at the six-leaf-one-heart stage in plants with gene overexpression, single mutation, and double mutation. The results showed ( Figure 7 Compared to wild tobacco, MTR2 and MTR3 The type of glandular trichomes on the leaf surface remained unchanged in plants with gene overexpression, single mutation, and double mutation, all containing three types: long-stalked glandular trichomes, short-stalked glandular trichomes, and non-secretory epidermal trichomes, but their densities differed significantly. MTR2 and MTR3 Compared with wild type, the overexpression of the gene in long-stalked glandular trichomes was reduced by 93.3% and 86.7%, respectively. There was no significant difference in the density of short-stalked glandular trichomes, and the density of non-secretory epidermal trichomes was also significantly reduced. MTR2 and MTR3 The density of long-stalked glandular trichomes in single-mutant plants was 1.57 times and 2.17 times higher than that in wild-type plants, respectively, while the density of short-stalked glandular trichomes and non-secreting epidermal trichomes showed no significant difference; however, when MTR2 and MTRWhen both genes mutated simultaneously, the density of long-stalked glandular hairs increased by 5.63 times compared to the wild type, while the density of non-secretory epidermal hairs decreased by 43%, and the density of short-stalked glandular hairs did not change significantly.

[0044] The above results indicate that MTR2 and MTR3 Both genes can negatively regulate the occurrence of stalked glandular hairs in tobacco, and the density of stalked glandular hairs can be significantly increased after both are mutated simultaneously. In addition, although individual mutations of either gene do not affect the density of non-secretory epidermal hairs, simultaneous mutations of both genes can inhibit the occurrence of non-secretory epidermal hairs.

[0045] Although some preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments as well as all changes and modifications falling within the scope of the invention.

Claims

1. An isolated nucleic acid molecule that negatively regulates the development of plant glandular trichomes, characterized in that, It is at least one of the following: (a) Tobacco as shown in SEQ ID NO: 1 MTR2 Gene; or nucleotide sequence encoding the protein shown in SEQ ID NO: 2; (b) Tobacco as shown in SEQ ID NO: 3 MTR3 Gene; or nucleotide sequence encoding the protein shown in SEQ ID NO: 4; (c) A nucleotide sequence that hybridizes with the nucleotide sequence defined in (a) or (b) under highly stringent conditions and encodes a protein having the same function; (d) A nucleotide sequence that has at least 90% identity with the nucleotide sequence defined in (a), (b) or (c) and encodes a protein having the same function.

2. A biomaterial, characterized in that, It is any of the following: (1) A recombinant vector containing the nucleic acid molecule of claim 1, or containing a specific target MTR2 Genes and / or MTR3 Gene editing systems; (2) A host cell or a transgenic cell line containing the nucleic acid molecule of claim 1 or the recombinant vector of claim 1.

3. An isolated protein that negatively regulates the development of tobacco glandular trichomes, characterized in that, It is at least one of the following: (a) The amino acid sequence is as shown in SEQ ID NO: 2, or is derived from tobacco as shown in SEQ ID NO:

1. MTR2 Proteins encoded by genes; (b) The amino acid sequence is as shown in SEQ ID NO: 4, or is derived from the tobacco shown in SEQ ID NO:

3. MTR3 Proteins encoded by genes; (c) Proteins with the same function as the amino acid sequence shown in SEQ ID NO: 2 or SEQ ID NO: 4, which have been substituted, deleted or added with one or more amino acid residues.

4. A method for inactivating or inhibiting the activity of tobacco... MTR2 Genes and / or MTR3 The application of gene expression substances in regulating tobacco traits, including: (a) Synergistically increases the density of glandular trichomes on tobacco stalks; and / or (b) Inhibit the development of non-secretory epidermal hairs in tobacco.

5. A tobacco mutant plant or a part thereof, characterized in that, Its endogenous MTR2 Genes and / or MTR3 Gene expression or function is specifically reduced or eliminated, and the tobacco plant exhibits the following phenotype: (i) Compared with wild-type tobacco, the density of long-stalked glandular trichomes is significantly increased; (ii) Compared with wild-type tobacco, the density of epidermal hairs in non-secretory type tobacco is significantly reduced.

6. The method for creating the tobacco mutant plant according to claim 5, characterized in that, Using at least one of gene editing technology and RNA interference technology, to achieve [the following] MTR2 Genes and MTR3 Knockout or knockdown of gene expression, either individually or simultaneously.

7. The method of creation according to claim 6, characterized in that, Knockout was performed using a CRISPR / Cas gene editing system, which includes specific targeting... MTR2 sgRNA and / or specific targeting of genes MTR3 The sgRNA of the gene contains the nucleotide sequences shown in SEQ ID NO:5 and SEQ ID NO:6, respectively, as its target sequence.

8. A device for detecting tobacco MTR2 Genes and / or MTR3 Primer pair combinations for gene mutation states, characterized in that, include: Used for detection MTR2 The first primer pair for gene mutation has the upstream primer sequence shown in SEQ ID NO: 7 and the downstream primer sequence shown in SEQ ID NO: 8; Used for detection MTR3 The second primer pair for gene mutation has the upstream primer sequence shown in SEQ ID NO: 9 and the downstream primer sequence shown in SEQ ID NO:

10.

9. A reagent kit, characterized in that, It includes the sgRNA combination as described in claim 7, and / or the primer pair combination as described in claim 8.

10. Use of the nucleic acid molecule of claim 1, the biological material of claim 2, the protein of claim 3, the tobacco plant or a portion thereof of claim 5, the primer pair combination of claim 8, or the kit of claim 9 in at least one of the following aspects: (a) Increases the content of glandular trichome secretions in tobacco leaves; (b) Improve the stress resistance or insect resistance of tobacco plants; (c) Improve the quality of tobacco leaves; (d) Molecular breeding of tobacco.

Images