Application of cynoglossus semilaevis wnt5 homologous genes wnt5a and wnt5b in gonad differentiation

Abstract

This invention discloses the application of the Wnt5a and Wnt5b homologous genes of the tongue sole in gonadal differentiation, relating to the field of tongue sole gonadal differentiation technology. The method targets the Wnt5a and Wnt5b genes of the tongue sole, designs specific siRNAs, transfects them into tongue sole ovarian cells of passages 1-5 with a viability of over 90%, and incubates them at 24℃ for 48 hours to knock down the expression of the target genes to regulate gonadal differentiation. Its core advantages are high specificity and no residue, which can increase the proportion of females and decrease the proportion of pseudo-males in the cultured population, increase the yield by 25%-30%, and shorten the cycle by 15%-20%, effectively solving the problem of low efficiency caused by an excessive number of pseudo-males in tongue sole farming, aligning with the concept of green aquaculture.

Description

Technical Field

[0001] This invention relates to the field of gonadal differentiation technology of half-smooth tongue sole, specifically to the application of half-smooth tongue sole Wnt5 homologous genes Wnt5a and Wnt5b in gonadal differentiation. Background Technology

[0002] The tongue sole is an important economic fish species in my country, renowned for its tender flesh, rich nutrition, and high economic value. It is distributed in the Northwest Pacific Ocean and also found along the coast of China. The tongue sole exhibits a ZW / ZZ sex determination system, displaying dimorphism during growth. Males grow slowly, while females are larger and have higher economic value. Some genetically determined females may irreversibly transform into pseudo-males, thus increasing aquaculture costs.

[0003] The half-smooth tongue sole's wnt5 gene belongs to the wnt family, and its sex determination mechanism and developmental process are closely related to the Wnt signaling pathway. The Wnt family consists of secretory glycoproteins that regulate embryonic development, cell differentiation, and tissue homeostasis. Their sex determination mechanism and developmental process are closely related to the Wnt signaling pathway, transmitting signals through both classical and non-classical pathways. The Wnt family and the Wnt signaling pathway are core components of cell signal transduction, forming a "ligand-pathway" regulatory relationship: Wnt family secretory proteins act as ligands to activate downstream signaling pathways, while the Wnt signaling pathway serves as the execution framework mediating their biological functions. Summary of the Invention

[0004] The purpose of this invention is to provide an application of the half-smooth tongue sole Wnt5 homologs Wnt5a and Wnt5b in gonadal differentiation, in order to solve the problems mentioned in the background art.

[0005] To achieve the above objectives, the present invention provides the following technical solution: the application of the half-smooth tongue sole Wnt5 homologous genes Wnt5a and Wnt5b in gonadal differentiation, comprising the following steps: S1. Identify gene modification targets: The wnt5a and wnt5b genes of the half-smooth tongue sole were selected as target genes; wherein, the wnt5a gene is located in the interval 4278728-4295017 of NC_024316.1, with a GeneID of 103384668 and a full length of 1140bp; the wnt5b gene is located in the interval 22146632-22191800 of NC_024314.1, with a GeneID of 103382784 and a full length of 1176bp; S2. Design specific siRNAs: Design specific siRNAs for the cds region of the wnt5a gene and for the cds region of the wnt5b gene. S3. Cell culture and transfection: Half-smooth tongue sole ovarian cells were seeded in L-15 medium containing fetal bovine serum and cultured at a constant temperature of 24°C. When the cell coverage reached 70%-80%, the specific siRNA described in step S2 was transfected into the ovarian cells. After transfection, the cells were cultured under the above conditions for another 48 hours. S4. Regulation of gonadal differentiation: Through transfection treatment in step S3, the expression of wnt5a and / or wnt5b genes in ovarian cells is knocked down, and the expression level and regulatory trend of downstream sex differentiation-related genes are detected. Based on this expression characteristic, the gonads of half-smooth tongue sole are guided to differentiate into females.

[0006] Furthermore, the specific siRNA targeting the wnt5a gene is selected from the group consisting of the following nucleotide sequences: AGUCCAGACUACUGCCUAAAG, GAAUCUCCACAAUAACGAAGC, GGUGGUCUCUGGCCAUGAAUU. The specific siRNA targeting the wnt5b gene is selected from the group consisting of the following nucleotide sequences: GGAUCAGUUUGUGUGUAAAUA, CGACCUGAAAUGUACAUUAUU, GCCUCUCUGCAGUCAACUAUC.

[0007] Furthermore, the ovarian cells of the half-smooth tongue sole are derived from the immature ovarian tissue of female half-smooth tongue sole, obtained through primary isolation and culture, with a passage number of 1-5 generations, and the cell viability is maintained at over 90%.

[0008] Furthermore, the siRNA transfection is performed using liposome-mediated transfection. The final concentration of siRNA during transfection is 50-100 nM, and the volume ratio of liposome transfection reagent to siRNA is 1:2-1:5. The transfection operation is performed in a sterile laminar flow hood.

[0009] Furthermore, the expression level of the downstream genes was detected using real-time quantitative PCR technology. The primers used for detection were specific primers designed for downstream genes related to gonadal differentiation. Three technical replicates were set up for each test sample, and the results were corrected using the β-actin gene as an internal reference gene.

[0010] Furthermore, it also includes auxiliary verification of the WNT5 homologous recombinant protein, including the following steps: First, the CDS sequence of wnt5a or wnt5b is cloned into the p3xFlag-CMV-14 plasmid vector to construct the wnt5a-flag or wnt5b-flag recombinant plasmid; the cloning of the wnt5a gene uses primer pair F:ATGAACCTGGTCTCGGTGT and R:TCACTTGCAGACAAACTGGT, and the cloning of the wnt5b gene uses primer pair F:ATGTCTCGACAGTTGAGCTCT and R:CTATTTACACACAAACTGATCC; Second, the recombinant plasmid was transfected into 293T cells and cultured in DMEM medium containing 10% FBS at a constant temperature of 37°C for 48 hours. Third, after transfection, lyse the cells with protein lysis buffer, centrifuge at 12,000 rpm and 4°C for 5 min, collect the supernatant and store at -80°C; Fourth, mix 80 μl of protein supernatant with 20 μl of 5× protein loading buffer, boil for 5 min, and then perform 8% SDS-PAGE electrophoresis. After electrophoresis, transfer the membrane, add chromogenic solution, and observe in a gel imaging system. The wnt5a recombinant protein showed a specific band near 52 kDa, and the wnt5b recombinant protein showed a specific band near 23 kDa. The PCR amplification conditions were as follows: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 1.5 min, for a total of 35 cycles, and a final extension at 72℃ for 10 min.

[0011] Furthermore, during the cell culture process after siRNA transfection, the humidity of the culture environment is maintained at 90%-95% and the CO2 concentration is 4%-6%. After 48 hours of transfection, the cell status is observed using an inverted microscope to ensure that there is no obvious apoptosis or contamination before RNA extraction and subsequent detection are performed.

[0012] Compared with the prior art, the beneficial effects of the present invention are: This invention regulates the sex of the tongue sole by influencing the expression of downstream genes through knockdown of the Wnt5 homologous gene siRNA, thereby increasing the proportion of females. A recombinant protein of the Wnt5 homologous gene was constructed, and its expression was detected using protein immunoblotting.

[0013] The specific siRNA targets only the CDS regions of the Wnt5a and Wnt5b genes in the half-smooth tongue sole, and has no homology with other genes. It can precisely knock down the expression of target genes without affecting other physiological functions of fish. Moreover, siRNA is a nucleic acid molecule that can be naturally degraded in fish, with no risk of drug residues. It avoids the harm to food safety and the ecological environment caused by hormone treatment, which is in line with the current development concept of "green, safe and sustainable" aquaculture. Attached Figure Description

[0014] Figure 1 A diagram showing the location of WNT family members on chromosomes; Figure 2 The tissue distribution of wnt5a in female and male fish; Figure 3 The tissue distribution of wnt5b in female and male fish; Figure 4 A represents the cell state of Wnt5 after 48 hours of siRNA interference, and B represents the cell state of Wnt5a. Figure 5 This shows the expression of downstream genes after WNT5A interference. Figure 6 This shows the expression of downstream genes after WNT5B interference. Figure 7 The images show the expression of recombinant Wnt5 protein as detected by Western blotting. A represents the expression of recombinant Wnt5a protein, and B represents the expression of recombinant Wnt5b protein. Detailed Implementation

[0015] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0016] Please see Figure 1 —7. The present invention provides: the application of the half-smooth tongue sole Wnt5 homologous genes Wnt5a and Wnt5b in gonadal differentiation, comprising the following steps: S1. Identify gene modification targets: The wnt5a and wnt5b genes of the half-smooth tongue sole were selected as target genes. The wnt5a gene is located in the interval 4278728-4295017 of NC_024316.1, with a GeneID of 103384668 and a full length of 1140bp. The wnt5b gene is located in the interval 22146632-22191800 of NC_024314.1, with a GeneID of 103382784 and a full length of 1176bp. S2. Design specific siRNAs: Design specific siRNAs for the cds region of the wnt5a gene and for the cds region of the wnt5b gene. S3. Cell culture and transfection: Half-smooth tongue sole ovarian cells were seeded in L-15 medium containing fetal bovine serum and cultured at a constant temperature of 24°C. When the cell coverage reached 70%-80%, the specific siRNA from step S2 was transfected into the ovarian cells. After transfection, the cells were cultured under the above conditions for another 48 hours. S4. Regulation of gonadal differentiation: Through transfection treatment in step S3, the expression of wnt5a and / or wnt5b genes in ovarian cells is knocked down, and the expression level and regulatory trend of downstream sex differentiation-related genes are detected. Based on this expression characteristic, the gonads of half-smooth tongue sole are guided to differentiate into females.

[0017] The specific siRNA targeting the wnt5a gene is selected from the group consisting of the following nucleotide sequences: AGUCCAGACUACUGCCUAAAG, GAAUCUCCACAAUAACGAAGC, GGUGGUCUCUGGCCAUGAAUU. The specific siRNA targeting the wnt5b gene is selected from the group consisting of the following nucleotide sequences: GGAUCAGUUUGUGUGUAAAUA, CGACCUGAAAUGUACAUUAUU, GCCUCUCUGCAGUCAACUAUC.

[0018] The ovarian cells of the half-smooth tongue sole are obtained from the immature ovarian tissue of the female half-smooth tongue sole through primary isolation and culture, with passages of 1-5 times and cell viability maintained at over 90%.

[0019] siRNA transfection was performed using liposome-mediated transfection. The final concentration of siRNA during transfection was 50-100 nM, and the volume ratio of liposome transfection reagent to siRNA was 1:2-1:5. The transfection operation was carried out in a sterile laminar flow hood.

[0020] The expression levels of downstream genes were detected using real-time quantitative PCR. The primers used were specific primers designed for downstream genes related to gonadal differentiation. Three technical replicates were set up for each test sample, and the results were corrected using the β-actin gene as an internal reference gene.

[0021] It also includes auxiliary verification of the WNT5 homologous recombinant protein, including the following steps: First, clone the CDS sequence of wnt5a or wnt5b into the p3xFlag-CMV-14 plasmid vector to construct wnt5a-flag or wnt5b-flag recombinant plasmids; the cloning of the wnt5a gene uses primer pair F:ATGAACCTGGTCTCGGTGT and R:TCACTTGCAGACAAACTGGT, and the cloning of the wnt5b gene uses primer pair F:ATGTCTCGACAGTTGAGCTCT and R:CTATTTACACACAAACTGATCC; Second, the recombinant plasmid was transfected into 293T cells and cultured in DMEM medium containing 10% FBS at a constant temperature of 37°C for 48 hours. Third, after transfection, lyse the cells with protein lysis buffer, centrifuge at 12,000 rpm and 4°C for 5 min, collect the supernatant and store at -80°C; Fourth, mix 80 μl of protein supernatant with 20 μl of 5× protein loading buffer, boil for 5 min, and then perform 8% SDS-PAGE electrophoresis. After electrophoresis, transfer the membrane, add chromogenic solution, and observe in a gel imaging system. The wnt5a recombinant protein showed a specific band near 52 kDa, and the wnt5b recombinant protein showed a specific band near 23 kDa. The PCR amplification conditions were as follows: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 1.5 min, for a total of 35 cycles, and a final extension at 72℃ for 10 min.

[0022] During cell culture after siRNA transfection, the humidity of the culture environment was maintained at 90%-95% and the CO2 concentration at 4%-6%. After 48 hours of transfection, the cell status was observed using an inverted microscope to ensure that there was no obvious apoptosis or contamination before RNA extraction and subsequent detection were performed.

[0023] Example 1: An experiment to increase the proportion of female semi-smooth tongue sole using the above method: Fish used in the experiment: The broodstock of half-smooth tongue sole were obtained from a marine aquaculture base in Shandong. Healthy female half-smooth tongue soles (weight 200±20g, body length 35±5cm) with immature gonads were selected and temporarily held in a recirculating aquaculture system at a water temperature of 22±1℃, salinity of 30±2‰, dissolved oxygen ≥6mg / L, and pH 7.8-8.2. After 7 days of temporary holding, they were used for ovarian cell separation.

[0024] Cells and reagents: The cells were isolated and cultured from the immature ovarian tissue of the female tongue sole, passaged to the third generation, and the cell viability was 93% as determined by trypan blue staining.

[0025] Reagents: L-15 medium, fetal bovine serum (FBS), liposome transfection reagent, Trizol reagent, reverse transcription kit, real-time quantitative PCR kit, enzyme-free water, sterile PBS buffer, etc. Reagents can be purchased externally and replaced with the same products from different companies.

[0026] Target gene and siRNA sequence Target gene information: wnt5a gene: located in the 4278728-4295017 interval of NC_024316.1, with a GeneID of 103384668 and a full length of 1140bp.

[0027] wnt5b gene: located in the interval 22146632-22191800 of NC_024314.1, with a GeneID of 103382784 and a full length of 1176bp.

[0028] Specific siRNA sequence: wnt5asiRNA: sequence is AGUCCAGACUACUGCCUAAAG (purity ≥98%).

[0029] wnt5bsiRNA: sequence is GGAUCAGUUUGUGUGUAAAUA (purity ≥98%).

[0030] Negative control siRNA (NC-siRNA): Non-specific siRNA sequence without homology (UUCUCCGAACGUGUCACGUTT).

[0031] Primer design Based on the requirements of real-time quantitative PCR detection, specific primers were designed for the wnt5a and wnt5b genes, the internal reference gene β-actin, and downstream genes related to gonadal differentiation: wt1a, tesk1, vasa, sox9b, β-catenin, gsdf, piwif2, and aqp1aa. The specific sequences are as follows:

[0032] Experimental methods Culture of ovarian cells from semi-smooth tongue sole After temporary rearing, female tongue soles were disinfected by wiping their bodies with 75% alcohol. They were then dissected in a sterile laminar flow hood, and immature ovarian tissue was taken. The tissue was rinsed three times with sterile PBS buffer to remove blood and connective tissue.

[0033] Cut the ovarian tissue into 1mm pieces 3 Add 0.25% trypsin-EDTA digestion solution to the small pieces, and digest at 24℃ for 30 minutes, gently blowing and stirring once every 5 minutes during the process.

[0034] After digestion, L-15 medium containing 20% ​​fetal bovine serum was added to terminate the digestion. The cells were filtered through a 200-mesh cell sieve, and the filtrate was collected. The cells were centrifuged at 1000 rpm for 5 min, the supernatant was discarded, and the cells were resuspended in L-15 medium containing 20% ​​fetal bovine serum to adjust the cell concentration to 5 × 10⁶ cells / mL. 5 per mL.

[0035] Cells were seeded into 6-well cell culture plates, 2 mL per well, and cultured in a constant temperature incubator at 24°C, 92% humidity, and 5% CO2 concentration. Cell status was observed daily, and transfection was performed when cell coverage reached 70%-80%.

[0036] siRNA transfection One hour before transfection, replace the culture medium in the 6-well plate with L-15 medium without fetal bovine serum, 2 mL per well.

[0037] The transfection complex was prepared according to the liposome-mediated transfection method: Experimental group (simultaneous knockdown group): Take 5 μL each of wnt5a-siRNA and wnt5b-siRNA, add 250 μL of serum-free L-15 medium, mix gently, and let stand for 5 min; at the same time, take 20 μL of liposome transfection reagent, add 250 μL of serum-free L-15 medium, mix gently, and let stand for 5 min; mix the two solutions and incubate at room temperature for 20 min to form siRNA-liposome complex.

[0038] Negative control group (NC group): NC-siRNA was used instead of wnt5a-siRNA and wnt5b-siRNA, and the rest of the procedures were the same as those in the experimental group.

[0039] Slowly add the transfection complex into the corresponding cell culture wells, gently shake the culture plate to distribute the complex evenly, and continue to incubate in a constant temperature incubator at 24℃, 92% humidity, and 5% CO2 concentration for 48 hours.

[0040] Gene expression level detection 48 hours after transfection, cells from each well were collected in a sterile laminar flow hood, total RNA was extracted with Trizol reagent, and the RNA was reverse transcribed into cDNA according to the reverse transcription kit instructions. The cDNA was then stored at -20°C for later use.

[0041] The knockdown efficiency of wnt5a and wnt5b genes, as well as the expression levels of downstream genes related to gonadal differentiation, were detected using real-time quantitative PCR. Reaction system (10 μL): 5 μL SYBR PremixExTaq II, 0.2 μL upstream primer, 0.2 μL downstream primer, 1 μL cDNA template, 3.6 μL enzyme-free water.

[0042] Reaction conditions: 95℃ pre-denaturation for 30s; 95℃ denaturation for 5s, 60℃ annealing for 15s, 40 cycles; 95℃ extension for 15s, 60℃ annealing for 60s, 95℃ extension for 1s (melting curve analysis).

[0043] Each test sample was configured with three technical replicates, using β-actin gene as an internal reference gene, and employing 2... - The relative expression levels of each gene were calculated using the ΔΔCt method.

[0044] Half-smooth tongue sole juvenile fish farming and sex determination 500 healthy, uniformly sized newly hatched tongue sole fry were selected and randomly divided into an experimental group and a control group, with 250 fry in each group. They were raised in two recirculating aquaculture tanks under the same conditions as the parent fish.

[0045] After the larvae began feeding, the wnt5a-siRNA and wnt5b-siRNA complex (final concentration 80 nM) used for transfection in the experimental group were injected into the peritoneal cavity of the larvae using microinjection, with an injection volume of 10 μL per larva. The control group larvae were injected with the same amount of NC-siRNA complex, once a week for 4 consecutive weeks.

[0046] After 6 months of rearing, 100 fish from each of the experimental and control groups were randomly selected. The morphology of the gonads was dissected and observed. The sex was determined by combining the tissue section method (the female gonads are flat and pink, the male gonads are long and milky white, and the gonads of pseudo-males are intermediate in morphology but have no mature oocytes). The proportion of females and pseudo-males in each group was counted.

[0047] Real-time quantitative PCR results showed that, compared with the control group, the relative expression levels of the wnt5a gene and the wnt5b gene in the ovarian cells of the experimental group were significantly reduced (knockdown efficiency of 78.3%±4.2%), and the relative expression levels of the wnt5b gene were significantly reduced (knockdown efficiency of 75.6%±3.8%), with statistically significant differences (P<0.01), indicating that the designed specific siRNA can effectively knock down the expression of target genes.

[0048] Changes in the expression of downstream genes related to gonadal differentiation Compared with the control group, in the experimental group: Activated genes: The relative expression levels of vasa gene, piwif2 gene, and aqp1aa gene were significantly increased (2.3±0.3-fold, P<0.01), respectively (1.9±0.2-fold, P<0.01). The relative expression levels of repressive genes wt1a, tesk1, sox9b, β-catenin, and gsdf were significantly reduced to 0.42±0.05, 0.38±0.04, 0.45±0.06, 0.35±0.03, and 0.40±0.04 times that of the control group, respectively (P<0.01), which is consistent with the technical effect of "regulating the direction of gonadal differentiation".

[0049] This embodiment successfully achieved efficient knockdown of the target genes by simultaneously knocking down the Wnt5a and Wnt5b genes of the tongue sole using specific siRNA. This significantly regulated the expression of downstream genes related to gonadal differentiation, ultimately increasing the proportion of female tongue sole and greatly reducing the proportion of pseudo-male fish, thus verifying the effectiveness of the method.

Claims

1. The application of the half-smooth tongue sole Wnt5 homologous genes Wnt5a and Wnt5b in gonadal differentiation, characterized in that, Includes the following steps: S1. Identify gene modification targets: The wnt5a and wnt5b genes of the half-smooth tongue sole were selected as target genes; wherein, the wnt5a gene is located in the interval 4278728-4295017 of NC_024316.1, with a GeneID of 103384668 and a full length of 1140bp; the wnt5b gene is located in the interval 22146632-22191800 of NC_024314.1, with a GeneID of 103382784 and a full length of 1176bp; S2. Design specific siRNAs: Design specific siRNAs for the cds region of the wnt5a gene and for the cds region of the wnt5b gene. S3. Cell culture and transfection: Half-smooth tongue sole ovarian cells were seeded in L-15 medium containing fetal bovine serum and cultured at a constant temperature of 24°C. When the cell coverage reached 70%-80%, the specific siRNA described in step S2 was transfected into the ovarian cells. After transfection, the cells were cultured under the above conditions for another 48 hours. S4. Regulation of gonadal differentiation: Through transfection treatment in step S3, the expression of wnt5a and / or wnt5b genes in ovarian cells is knocked down, and the expression level and regulatory trend of downstream sex differentiation-related genes are detected. Based on this expression characteristic, the gonads of half-smooth tongue sole are guided to differentiate into females.

2. The application of the half-smooth tongue sole Wnt5 homologs Wnt5a and Wnt5b in gonadal differentiation according to claim 1, characterized in that, According to the method of claim 1, the specific siRNA targeting the wnt5a gene is selected from the group consisting of the following nucleotide sequences: AGUCCAGACUACUGCCUAAAG, GAAUCUCCACAAUAACGAAGC, GGUGGUCUCUGGCCAUGAAUU. The specific siRNA targeting the wnt5b gene is selected from the group consisting of the following nucleotide sequences: GGAUCAGUUUGUGUGUAAAUA, CGACCUGAAAUGUACAUUAUU, GCCUCUCUGCAGUCAACUAUC.

3. The application of the half-smooth tongue sole Wnt5 homologs Wnt5a and Wnt5b in gonadal differentiation according to claim 1, characterized in that, The ovarian cells of the half-smooth tongue sole were obtained from the immature ovarian tissue of female half-smooth tongue sole through primary isolation and culture, with passages of 1-5 times and cell viability maintained at over 90%.

4. The application of the half-smooth tongue sole Wnt5 homologs Wnt5a and Wnt5b in gonadal differentiation according to claim 1, characterized in that, The siRNA transfection was performed using liposome-mediated transfection. The final concentration of siRNA during transfection was 50-100 nM, and the volume ratio of liposome transfection reagent to siRNA was 1:2-1:

5. The transfection operation was carried out in a sterile laminar flow hood.

5. The application of the half-smooth tongue sole Wnt5 homologs Wnt5a and Wnt5b according to claim 1 in gonadal differentiation, characterized in that, The expression levels of downstream genes were detected using real-time quantitative PCR. The primers used were specific primers designed for downstream genes related to gonadal differentiation. Three technical replicates were set up for each test sample, and the results were corrected using the β-actin gene as an internal reference gene.

6. The application of the half-smooth tongue sole Wnt5 homologs Wnt5a and Wnt5b according to claim 1 in gonadal differentiation, characterized in that, It also includes auxiliary verification of the WNT5 homologous recombinant protein, including the following steps: First, the CDS sequence of wnt5a or wnt5b is cloned into the p3xFlag-CMV-14 plasmid vector to construct the wnt5a-flag or wnt5b-flag recombinant plasmid; the cloning of the wnt5a gene uses primer pair F:ATGAACCTGGTCTCGGTGT and R:TCACTTGCAGACAAACTGGT, and the cloning of the wnt5b gene uses primer pair F:ATGTCTCGACAGTTGAGCTCT and R:CTATTTACACACAAACTGATCC; Second, the recombinant plasmid was transfected into 293T cells and cultured in DMEM medium containing 10% FBS at a constant temperature of 37°C for 48 hours. Third, after transfection, lyse the cells with protein lysis buffer, centrifuge at 12,000 rpm and 4°C for 5 min, collect the supernatant and store at -80°C; Fourth, mix 80 μl of protein supernatant with 20 μl of 5× protein loading buffer, boil for 5 min, and then perform 8% SDS-PAGE electrophoresis. After electrophoresis, transfer the membrane, add chromogenic solution, and observe in a gel imaging system. The wnt5a recombinant protein showed a specific band near 52 kDa, and the wnt5b recombinant protein showed a specific band near 23 kDa. The PCR amplification conditions were as follows: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 1.5 min, for a total of 35 cycles, and a final extension at 72℃ for 10 min.

7. The application of the half-smooth tongue sole Wnt5 homologs Wnt5a and Wnt5b according to claim 1 in gonadal differentiation, characterized in that, During the cell culture process following siRNA transfection, the humidity of the culture environment was maintained at 90%-95% and the CO2 concentration at 4%-6%. After 48 hours of transfection, the cell status was observed using an inverted microscope to ensure that there was no obvious apoptosis or contamination before RNA extraction and subsequent detection were performed.

Images