SNP molecular marker related to ammonia-nitrogen tolerance trait of sika yellowfin seabream sik2 gene and application thereof

Abstract

This invention discloses a SNP molecular marker associated with ammonia nitrogen tolerance in the SIK2 gene of the yellowfin spiny seabream and its application. The SNP molecular marker is located in the yellowfin spiny seabream. SIK2 In the nucleotide sequence of the gene as shown in SEQ ID NO:1, the base N at position 526, starting from the 5' end, is either T or A; individuals carrying the A allele in the SNP molecular marker are used as candidate materials or preferred materials for ammonia nitrogen tolerance breeding; primers, kits, and methods for detecting SNP molecular markers related to ammonia nitrogen tolerance in the SIK2 gene of yellowfin spiny seabream are also disclosed; and the applications of the reagents, primers, kits, or methods for detecting the SNP molecular markers in identifying or assisting in identifying the ammonia nitrogen tolerance of yellowfin spiny seabream and in screening ammonia nitrogen-tolerant yellowfin spiny seabream breeding materials, parental selection, or conducting molecular-assisted selection of yellowfin spiny seabream.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker screening and molecular-assisted breeding technology for aquatic animals, specifically involving an SNP molecular marker related to ammonia nitrogen tolerance in the SIK2 gene of the yellowfin spiny seabream and its application. Background Technology

[0002] Yellowfin seabream (Acanthopagrus latus) is one of the important marine economic fish species along the southeastern coast of my country, characterized by its rapid growth, strong adaptability, and high aquaculture value. With the development of intensive, high-density aquaculture, the decomposition of uneaten feed, excrement, and organic matter in the aquaculture water easily leads to the accumulation of ammonia nitrogen. Ammonia nitrogen stress can cause decreased feed intake, stunted growth, tissue damage, enhanced immune inflammatory responses, and increased mortality in fish, making it one of the important environmental factors restricting the healthy aquaculture and breeding of superior varieties of yellowfin seabream. Traditional screening for ammonia nitrogen tolerance usually relies on stress tests and phenotypic determination, which has drawbacks such as long cycles, high labor intensity, significant influence from environmental factors, and difficulty in conducting non-destructive screening in the early stages of breeding. Molecular marker-assisted selection can predict the genetic background related to target traits through genotyping in the early stages of individual development, providing an efficient and stable auxiliary tool for the breeding of stress-resistant traits.

[0003] The SIK family (Salt-inducible kinase family) belongs to the AMPK-associated serine / threonine protein kinase family and plays an important role in energy metabolism regulation, stress signal transduction, ion homeostasis maintenance, and environmental adaptation. SIK2 (Salt-inducible kinase 2) is a member of the SIK family and participates in cellular energy metabolism, transcriptional regulation, and stress adaptation. Ammonia nitrogen stress can lead to increased metabolic load, oxidative stress, and tissue damage in fish. Therefore, the SIK2 gene, which is related to energy metabolism and stress regulation, has biological rationale as a candidate gene for ammonia nitrogen tolerance. Summary of the Invention

[0004] The first objective of this invention is to provide a molecular marker for an SNP associated with the ammonia nitrogen tolerance trait of the SIK2 gene in yellowfin spiny seabream, primers for detecting the SNP molecular marker associated with the ammonia nitrogen tolerance trait of the SIK2 gene in yellowfin spiny seabream, and a kit containing the primers.

[0005] Another objective of this invention is to provide a method for detecting the ammonia nitrogen tolerance of yellowfin seabream.

[0006] The final object of the present invention is to provide the application of the reagents, primers, kits or methods for detecting the SNP molecular markers described above in identifying or assisting in identifying the ammonia nitrogen tolerance of yellowfin seabream, or in screening ammonia nitrogen-tolerant yellowfin seabream breeding materials, screening ammonia nitrogen-tolerant breeding materials or conducting molecular-assisted selection of yellowfin seabream.

[0007] The first objective of the present invention can be achieved by the following technical solution: a SNP molecular marker related to the ammonia nitrogen tolerance trait of the yellowfin spiny seabream SIK2 gene, wherein the SNP molecular marker is located in the nucleotide sequence of the yellowfin spiny seabream SIK2 gene as shown in SEQ ID NO:1, and the base N at position 526 starting from the 5' end of the nucleotide sequence shown in SEQ ID NO:1 is T or A.

[0008] Based on the functional characteristics of SIK family genes and the results of research on the ammonia nitrogen stress response of yellowfin spiny seabream, this invention selects the SIK2 gene as a candidate gene for the ammonia nitrogen tolerance trait in yellowfin spiny seabream, and performs PCR amplification, Sanger sequencing, and genotyping verification on the target fragment of the SIK2 gene. The results show that a T / A polymorphic site exists in the target fragment of the SIK2 gene, corresponding to the 526th position from the 5' end of the nucleotide sequence shown in SEQ ID NO.1, which is denoted in this application as the SIK2 gene 526th T / A site, i.e., the SIK2 gene 526T>A site. The genotype distribution and allele frequency of this site are significantly correlated with the ammonia nitrogen tolerance trait of yellowfin spiny seabream. The application of this SIK2 gene-related SNP site in the identification of ammonia nitrogen tolerance and molecular-assisted breeding of yellowfin spiny seabream has not been disclosed in the prior art, therefore it has value for development as a molecular marker.

[0009] Specifically, the nucleotide sequence shown in SEQ ID NO: 1 is 1028 bp in length, with N representing the 526th position from the 5' end, where N is either T or A; where T is the reference allele and A is the variant allele.

[0010] The genotyping statistics in some examples show that the genotype distribution and allele distribution of the SIK2 gene 526T>A site are significantly associated with the ammonia nitrogen tolerance trait of the yellowfin spiny seabream; individuals carrying the A allele are significantly enriched in the tolerance group and can be preferentially retained as candidate materials for ammonia nitrogen tolerance breeding.

[0011] Therefore, preferably, individuals carrying the A allele in the SNP molecular marker are used as candidate materials or preferred materials for ammonia nitrogen tolerance breeding.

[0012] The present invention also provides primers for detecting SNP molecular markers related to ammonia nitrogen tolerance in the SIK2 gene of yellowfin spiny seabream. The primers include an upstream primer and a downstream primer. The sequence of the upstream primer is shown in SEQ ID NO: 2, and the sequence of the downstream primer is shown in SEQ ID NO: 3.

[0013] Specifically, the sequences of the upstream and downstream primers described in this invention are as follows:

[0014] Upstream primer (SIK2-F): CGCCTCTCAGAGAATACTAAATG (SEQ ID NO: 2);

[0015] Downstream primer (SIK2-R): CCAACAACAGGTGAGGAACG (SEQ ID NO: 3).

[0016] The present invention further provides a kit for detecting SNP molecular markers related to ammonia nitrogen tolerance in the SIK2 gene of yellowfin spiny seabream, the kit comprising the primers described above.

[0017] Preferably, the kit further includes one or more of the following: PCR amplification reagents, sequencing reagents, genotyping probes, positive controls, and negative controls.

[0018] Furthermore, the kit may also include a product instruction manual.

[0019] The second objective of this invention can be achieved through the following technical solution: a method for detecting the ammonia nitrogen tolerance trait of the yellowfin seabream, comprising the following steps:

[0020] (1) Extract genomic DNA from individual yellowfin seabream to be tested;

[0021] (2) Perform PCR amplification on the extracted genomic DNA using the primers or the kit described above;

[0022] (3) Sequencing or typing the amplification products to determine the genotype of the SNP locus;

[0023] (4) The ammonia nitrogen tolerance of the individual to be tested can be determined based on the genotype.

[0024] In the above methods for detecting the ammonia nitrogen tolerance trait of the yellowfin seabream:

[0025] Preferably, after the amplification product in step (3) passes the agarose gel electrophoresis test, the genotype is determined by Sanger sequencing, KASP typing, TaqMan probe typing, high-resolution melting curve analysis or other SNP typing methods.

[0026] Preferably, in step (4), when the A allele is detected, the individual to be tested is used as a candidate material or a preferred material for ammonia nitrogen tolerance breeding.

[0027] The last objective of the present invention can be achieved by the following technical solution: the application of the reagent for detecting the SNP molecular marker, the primer, the kit, or the method described above in identifying or assisting in the identification of the ammonia nitrogen tolerance of yellowfin seabream.

[0028] This invention also provides reagents for detecting the SNP molecular markers, the primers, the kits, or the methods described herein for screening ammonia-tolerant yellowfin seabream breeding materials, screening ammonia-tolerant breeding materials, or conducting molecular-assisted selection of yellowfin seabream.

[0029] The present invention has the following advantages:

[0030] (1) This invention is the first to use the T / A site at position 526 of the SIK2 gene of the yellowfin spiny seabream for molecular marker detection of ammonia nitrogen tolerance. The SIK2 gene 526T>A site provided by this invention (the base N at position 526 of the nucleotide sequence shown in SEQ ID NO: 1, starting from the 5' end, is T or A, which is significantly associated with the ammonia nitrogen tolerance trait of the yellowfin spiny seabream and can be used as a candidate marker for molecular detection of ammonia nitrogen tolerance and screening of breeding materials;

[0031] (2) This invention provides clear detection primers and genotyping methods, which can be detected by conventional PCR amplification combined with Sanger sequencing or other SNP genotyping platforms. The operation is simple and the results are intuitive.

[0032] (3) This invention can help identify individuals carrying ammonia nitrogen-related alleles in the early stages of breeding, reduce the screening cost of relying solely on stress tests, and improve the screening efficiency of ammonia nitrogen-resistant materials. Attached Figure Description

[0033] The present invention will now be further described with reference to the accompanying drawings and embodiments.

[0034] Figure 1 The Sanger sequencing peak diagrams for the T / A site at position 526 of the SIK2 gene in Examples 3 and 4 are shown. The target site for the TT genotype shows a single T peak, while the target site for the AT genotype shows a double A / T peak. Detailed Implementation

[0035] The technical solution of the present invention will be described in detail below with reference to specific embodiments, so that those skilled in the art can better understand and implement the technical solution of the present invention. The following embodiments and drawings are for illustrative purposes only and should not be construed as limiting the present invention. Unless otherwise specified, the reagents or materials used in the embodiments are all from commercial sources. Unless otherwise specified, the experimental instruments used are all conventional laboratory instruments.

[0036] Example 1: Construction of an extreme phenotype population of yellowfin spiny seabream under acute ammonia nitrogen stress

[0037] One thousand healthy, uniformly sized individuals of the yellowfin seabream were subjected to acute ammonia nitrogen stress treatment. Based on previous acute toxicity tests, the LC50 of the yellowfin seabream at 24h, 48h, 72h, and 96h was [not specified]. 50 The concentrations were 12.66 mg / L, 5.37 mg / L, 5.01 mg / L, and 4.51 mg / L, respectively. Formal stress experiments were conducted using 96-hour LC-1250. 50 High-concentration ammonia nitrogen stress conditions were set up. During the experiment, continuous aeration and no feeding were carried out, and the time of death and survival status of each individual were continuously observed and recorded. The criteria for death were quiescence, cessation of gill cover movement, and no response to external stimuli. Based on the order of death, the first 100 individuals to die were defined as the ammonia nitrogen sensitive group (HS), and the last 100 individuals to die or those showing strong survival ability were defined as the ammonia nitrogen tolerant group (HT), which were used for candidate gene locus amplification, sequencing, and SNP genotyping verification.

[0038] Example 2: SIK2 candidate gene selection, target fragment amplification, and SNP site discovery

[0039] This invention, based on differential analysis between ammonia nitrogen-tolerant and susceptible populations of yellowfin seabream, screened for SNP loci associated with ammonia nitrogen tolerance in the SIK2 gene fragment. Different genotypes at these loci showed differential distributions in the tolerant and susceptible populations, indicating a potential correlation with ammonia nitrogen tolerance in yellowfin seabream. These loci can serve as candidate markers for molecular marker-assisted selection of ammonia nitrogen tolerance traits in yellowfin seabream, providing a technical basis for the breeding of stress-resistant new strains and marker-assisted breeding.

[0040] Based on reports of the functions of SIK family genes in energy metabolism, stress regulation, and environmental adaptation, and combined with the expression response results of SIK family genes during ammonia nitrogen stress in yellowfin spiny seabream, the SIK2 gene was selected as a candidate gene for ammonia nitrogen tolerance in yellowfin spiny seabream. Using the yellowfin spiny seabream reference genome and SIK2 gene sequence information, primer pairs were designed to amplify the target fragment of the SIK2 gene. The upstream primer was CGCCTCTCAGAGAATACTAAATG (SEQ ID NO.2), and the downstream primer was CCAACAACAGGTGAGGAACG (SEQ ID NO.3).

[0041] Fin tissues were collected from individuals in the HS and HT groups in Example 1, and genomic DNA was extracted using the Trelief™ AnimalGenomic DNA Kit (Beijing Qingke). After extraction, DNA integrity was assessed by 1.0% agarose gel electrophoresis, and DNA purity and concentration were determined using a NanoDrop micro-spectrophotometer. Samples with intact DNA bands, no significant degradation, and acceptable purity were selected as PCR amplification templates.

[0042] The PCR amplification reaction system was 25 μL: 12.5 μL of 2×Taq PCR Master Mix, 0.5 μL of 10 μmol / L upstream primer, 0.5 μL of 10 μmol / L downstream primer, 1.0 μL of genomic DNA template, and ddH2O to bring the total volume to 25 μL.

[0043] The PCR reaction program was as follows: 94℃ pre-denaturation for 4 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 30 cycles; 72℃ final extension for 2 min.

[0044] The PCR product showed a single, clear band upon 1.5% agarose gel electrophoresis, indicating that the primers shown in SEQ ID NO.2 and SEQ ID NO.3 could specifically amplify the target fragment of the SIK2 gene. Subsequently, Sanger sequencing was performed on the PCR amplification product, and the sequencing results were compared with the reference sequence. A T / A polymorphism site was found in the target fragment of the SIK2 gene. This site is located at position 526 from the 5' end of the nucleotide sequence shown in SEQ ID NO.1, denoted by N, where N represents T or A; T is the reference allele, and A is the variant allele.

[0045] The nucleotide sequence of the T / A site at position 526 of the SIK2 gene is shown in SEQ ID NO.1, with a sequence length of 1028 bp.

[0046] The nucleotide sequence of the 526T>A site in the SIK2 gene is shown in SEQ ID NO.1, with a sequence length of 1028 bp; the 526th position from the 5' end is represented by N, where N is T or A; where T is the reference allele and A is the variant allele.

[0047]

[0048] Example 3: Association analysis between the SIK2 gene 526T>A site and ammonia nitrogen tolerance trait.

[0049] The samples in this embodiment were derived from the ammonia nitrogen-sensitive group (HS) and ammonia nitrogen-tolerant group (HT) constructed in Example 1. The SIK2 gene target fragment was amplified by PCR and Sanger sequencing was performed using the method described in Example 2, and the genotype was determined based on the sequencing peak diagram of the target site. Figure 1 As shown, the specific criteria are as follows: a single T peak at the target locus indicates the TT genotype, a double A / T peak indicates the AT genotype, and a single A peak indicates the AA genotype. Samples with poor sequencing peak quality or those that cannot be accurately interpreted are not included in subsequent statistical analysis.

[0050] After typing, 65 effective typing samples were obtained in the sensitive group and 47 effective typing samples were obtained in the tolerant group.

[0051] Based on the Sanger sequencing genotyping results, the genotype and allele frequencies of the SIK2 gene 526T>A locus were statistically analyzed in the sensitive and tolerant groups. Table 1 shows the genotype frequency distribution of the 526T>A locus in the sensitive and tolerant groups, and Table 2 shows the allele frequency distribution of this locus between the two groups in the same batch of valid genotyped samples. The χ² test was used to analyze the differences in genotype and allele frequencies between the sensitive and tolerant groups.

[0052] The results showed that the proportion of individuals containing the A allele in the tolerant group was significantly higher than that in the sensitive group, indicating that this locus can serve as a candidate marker for molecular detection of ammonia nitrogen tolerance in yellowfin seabream, early screening of breeding materials, and molecular-assisted selection.

[0053] Table 1. Genotype frequency distribution of the 526T>A locus in the SIK2 gene.

[0054] 526T>A TT 62 (95.38) 33 (70.21) 13.424 <0.001 AT 3 (4.62) 14 (29.79) AA 0 (0.00) 0 (0.00)

[0055] Note: No homozygous AA was detected in the sample of this study; due to the low frequency of A allele, the absence of AA does not affect the judgment of the association between AT genotype and A allele and ammonia nitrogen tolerance trait.

[0056] Table 2. Allele frequency distribution of the 526T>A locus in the SIK2 gene.

[0057] 526T>A T 127 (97.69) 80 (85.11) 12.322 <0.001 A 3 (2.31) 14 (14.89)

[0058] As shown in Table 1, in the valid genotyping samples, the proportion of the TT genotype in the sensitive group was 95.38% (62 / 65), and the proportion of the AT genotype was 4.62% (3 / 65); in the tolerant group, the proportion of the TT genotype was 70.21% (33 / 47), and the proportion of the AT genotype was 29.79% (14 / 47). The proportion of individuals carrying the AT genotype with the A allele in the tolerant group was significantly higher than that in the sensitive group, and the difference in genotype distribution reached a significant level (χ²=13.424, P<0.001).

[0059] Table 2 shows that the frequency of the A allele in the sensitive group was 2.31% (3 / 130), while the frequency in the tolerant group was 14.89% (14 / 94). The frequency of the A allele in the tolerant group was significantly higher than that in the sensitive group, and the difference in allele frequency reached a statistically significant level (χ²=12.322, P<0.001). These results indicate that the genotype distribution and allele frequency at the 526th T / A locus of the SIK2 gene are significantly associated with the ammonia nitrogen tolerance trait in the yellowfin spiny seabream, and the A allele is a candidate favorable allele associated with stronger ammonia nitrogen tolerance.

[0060] Example 4

[0061] To further verify the reproducibility of the detection results at the T / A site at position 526 of the SIK2 gene, 1000 yellowfin seabream were selected and subjected to ammonia nitrogen stress challenge according to the experimental parameters in Example 1. The samples were then resampled and sequenced for verification. Each sample was bidirectionally sequenced using primers shown in SEQ ID NO.2 and SEQ ID NO.3. Sequencing details showed that successful sequencing in at least one sequencing direction was considered a valid sequencing criterion. A total of 131 valid sequencing samples were obtained in this reproducibility test, including 65 sensitive samples and 66 tolerant samples.

[0062] Repeat sequencing results showed that... Figure 1 As shown, all successfully sequenced samples yielded interpretable sequencing peak profiles. Genotypes were determined based on the peak pattern at the target site: a single T peak indicated the TT genotype, a double A / T peak indicated the AT genotype, and a single A peak indicated the AA genotype. These results demonstrate that the primers shown in SEQ ID NO.2 and SEQ ID NO.3 can stably amplify the fragment containing the T / A site at position 526 of the SIK2 gene. This site can be repeatedly detected and genotype determined using Sanger sequencing.

[0063] Table 3 shows the genotype frequency distribution of the 526T>A locus in the sensitive and tolerant groups, and Table 4 shows the allele frequency distribution of this locus between the two groups in the same batch of valid genotyping samples. The χ² test was used to analyze the differences in genotype and allele frequencies between the sensitive and tolerant groups.

[0064] Table 3. Genotype frequency distribution of the SIK2 gene 526T>A locus in the validation population.

[0065] 526T>A TT 51(78.46) 23(34.85) 25.34 <0.001 AT 14(21.54) 43(65.15) AA 1(1.23) 2(3.64)

[0066] Table 4. Allele frequency distribution of the SIK2 gene 526T>A locus in the validation population.

[0067] 526T>A T 116(89.23) 89(67.42) 18.30 <0.001 A 14(10.77) 43(32.58)

[0068] Statistical analysis showed that the frequency of allele A in the tolerant group was significantly higher than that in the sensitive group, with the difference in allele frequency reaching a significant level. This further supports the application value of this locus as a molecular marker for the ammonia nitrogen tolerance trait of the yellowfin spiny seabream.

[0069] Example 5: Screening of breeding materials based on the SIK2 gene 526T>A locus

[0070] Genomic DNA was extracted from fin rays of individuals in a yellowfin seabream breeding population. PCR amplification was performed using primer pairs shown in SEQ ID NO.2 and SEQ ID NO.3, and the amplified products were subjected to Sanger sequencing, KASP genotyping, TaqMan genotyping, high-resolution melting curve analysis, or other SNP genotyping detection. Based on the 3965T>A site genotyping results, individuals carrying the A allele were preferentially retained as candidates for ammonia nitrogen tolerance breeding. This method can be used in conjunction with other breeding indicators such as growth, body size, and disease resistance to improve overall breeding efficiency.

[0071] The above embodiments are only used to illustrate the present invention, and the scope of protection of the present invention is not limited to the above embodiments. Those skilled in the art can achieve the purpose of the present invention based on the above disclosure. Any improvements and modifications made based on the concept of the present invention fall within the scope of protection of the present invention, and the specific scope of protection is determined by the claims.

Claims

1. A SNP molecular marker related to the ammonia-nitrogen tolerance trait of Siganus canaliculatus SIK2 gene, characterized in that, The SNP molecular marker is located in the nucleotide sequence of the yellowfin seabream SIK2 gene as shown in SEQ ID NO:1, where the N at position 526, starting from the 5' end, is either T or A.

2. The SNP molecular marker related to ammonia nitrogen tolerance in the SIK2 gene of the yellowfin seabream according to claim 1, characterized in that, Individuals carrying the A allele in the SNP molecular markers are considered as candidate materials or preferred materials for ammonia nitrogen tolerance breeding.

3. A primer for detecting SNP molecular markers related to ammonia nitrogen tolerance in the SIK2 gene of the yellowfin spiny seabream, characterized in that, The primers include an upstream primer and a downstream primer, the sequence of which is shown in SEQ ID NO: 2, and the sequence of which is shown in SEQ ID NO:

3.

4. A kit for detecting SNP molecular markers related to ammonia nitrogen tolerance in the SIK2 gene of the yellowfin spiny seabream, characterized in that, The kit includes the primers described in claim 3.

5. The reagent kit according to claim 4, characterized in that, The kit also includes one or more of the following: PCR amplification reagents, sequencing reagents, genotyping probes, positive controls, and negative controls.

6. A method for detecting the ammonia nitrogen tolerance trait of the yellowfin seabream, characterized in that, Includes the following steps: (1) Extract genomic DNA from individual yellowfin seabream to be tested; (2) Perform PCR amplification on the extracted genomic DNA using the primers described in claim 3 or the kit described in claim 4; (3) Sequencing or typing the amplification products to determine the genotype of the SNP locus; (4) The ammonia nitrogen tolerance of the individual to be tested can be determined based on the genotype.

7. The method for detecting the ammonia nitrogen tolerance trait of the yellowfin seabream according to claim 6, characterized in that, In step (4), when the A allele is detected, the individual to be tested is used as a candidate material for ammonia nitrogen tolerance breeding or a material to be preferentially retained.

8. The use of the reagent for detecting the SNP molecular marker of claim 1 or 2, the primer of claim 3, the kit of claim 4 or 5, or the method of claim 6 or 7 in identifying or assisting in the identification of the ammonia nitrogen tolerance of yellowfin seabream.

9. The application of the reagent for detecting the SNP molecular markers of claim 1 or 2, the primers of claim 3, the kit of claim 4 or 5, or the method of claim 6 or 7 in screening ammonia-resistant yellowfin seabream breeding materials, screening ammonia-resistant breeding materials, or carrying out molecular-assisted selection of yellowfin seabream.

Images