Methods and compositions for modifying flowering time genes in plants

Abstract

Methods and compositions are provided for modifying the flowering and / or maturity times of soybean plants to enable their cultivation in multiple geographical locations with varying day lengths. Modified soybean plants containing non-naturally occurring mutant alleles at the FT2a, FT2b, FT5a, and / or ELF3 loci are disclosed. These modified plants exhibit shorter flowering and / or maturity times than control plants.

Description

Declaration regarding the electronic submission of the sequence list

[0001] A sequence list in ST.26 format is provided as an alternative to a paper copy. This sequence list, filed pursuant to 37 CFR §1.821, is named PAT-109897-WO-SEC-1_SEQLIST.xml, is 87 kb in size, and was generated and filed via EFS-Web on January 2, 2025. This sequence list is hereby incorporated herein by reference with respect to its disclosures. Technical Field

[0002] This disclosure relates to the field of plant biotechnology. In particular, the present invention relates to methods and compositions for modifying the flowering and / or maturity times of photoperiodic plants to enable the cultivation of these photoperiodic plants in multiple geographical locations with different day lengths. Background Technology

[0003] Soybeans (Glycine max) are a valuable field crop. Soybean oil, extracted from the seeds, is used in many retail products such as cooking oil, baked goods, and margarine. Soybeans are also used as a grain, serving as a food source for both animals and humans. Soybean meal is a component of many foods and animal feeds. Edible protein components produced from soybeans provide a healthier and cheaper alternative to animal protein in meat and dairy products.

[0004] The typical growth cycle of full-season soybean begins with a long vegetative growth period. The vegetative stage begins when the hypocotyl emerges from the soil (VE), followed by the unfolding of a pair of single leaves (VC) on the first node directly above the cotyledon. At this stage, the leaves are fully unfolded so that the leaf edges do not touch. After VC, the plant transitions from V1 (where the fully developed leaves unfold at the first node) to Vn as the three leaves unfold at each of the multiple nodes (n).

[0005] The reproductive stage (R1 or initial flowering stage) begins when the first open flower is present at any node on the main stem of the plant. The first flower typically faces the base of the plant. As the plant enters its peak flowering stage, it enters R2. At this stage, an open flower is present at one of the two uppermost nodes on the main stem, and the flower is fully developed. The reproductive stages include pod development (R3 and R4), seed development (R5 and R6), and final maturation (R7 and R8). In R3 (pod formation stage), a pod at least three-sixteenths of an inch long is present at one of the four uppermost nodes on the main stem with fully developed leaves. In R4 (or peak pod formation stage), a pod at least three-quarters of an inch long is present at one of the four uppermost nodes on the main stem with fully developed leaves. In R5 (or initial seed stage), a seed at least one-eighth of an inch long is present in the pod at one of the four uppermost nodes on the main stem with fully developed leaves. At R6 (or full-grain stage), a pod containing green seeds is present at one of the four uppermost nodes on the main stem with fully developed leaves, the green seeds filling the pod cavity. At R7 (or early maturity stage), at least one normal pod on the main stem has reached its mature pod color. At R8 (or full maturity stage), at least 95% of the pods have reached their mature pod color. After R8, five to ten days of dry weather are required to reduce the soybean moisture level to less than 15%.

[0006] Most flowering plants respond to daily photoperiodic cycles and are classified as short-day (SD) or long-day (LD) plants based on the photoperiodic conditions required to induce flowering. The photoperiodic conditions experienced by plants vary depending on the geographical location where they are cultivated (e.g., latitude or longitude). Soybeans are short-day (SD) plants, requiring fewer days than a critical value to induce flowering. Soybean varieties are grouped into several maturity groups based on their response to photoperiod, such as the number of days until flowering. For example, for most North American soybean varieties, the typical planting date is May 1st, the vegetative growth period can last from 55 to 65 days, and flowering begins around mid-July.

[0007] Plant breeders and growers are constantly seeking new ways to manipulate plant breeding and yield, especially for agronomically important crops. For example, soybean breeders are interested in soybean varieties that can be bred in a wide range of geographical locations. Therefore, there is a ongoing need in the art for improved compositions and methods for modifying agronomic traits related to flowering time.

[0008] Multiple genes that play a role in controlling the flowering time and maturity of soybean have been identified and discovered. This disclosure provides novel, non-natural allelic variations that generate genes involved in the photoperiodic response of soybean, and methods for using specific allelic combinations to provide soybean plants with a range of modified flowering times. Summary of the Invention

[0009] Methods and systems are provided for providing edited plants (e.g., soybean plants) having altered or modified flowering and / or maturity times from natural flowering times (e.g., from unedited corresponding control plants). In embodiments, soybean plants have flowering and / or maturity times that are shorter (e.g., significantly shorter or slightly shorter) than those of control plants. Compositions of nucleic acid molecules (e.g., expression cassettes or vectors) are also provided, capable of introducing targeted edits into the genome of plant cells, particularly at loci of selected plant genes involved in regulating flowering and / or maturity and / or photoperiod responses, resulting in novel mutant alleles producing flowering and / or maturity and / or photoperiod response genes. In embodiments, the resulting mutant alleles contain sequences that, when included in the genome of a plant, confer modified (e.g., shorter) flowering and / or maturity times compared to plants not containing mutant alleles. In embodiments, compositions resulting from different allele combinations of mutant alleles confer modified (e.g., shorter / fewer) flowering days, maturity days, and / or the number of days between flowering and maturity on plants that do not contain allele combinations. Such compositions and methods of using such compositions enable the production of plants that can grow in multiple geographic locations, including locations with shorter or longer day lengths.

[0010] Embodiments of the present invention include nucleic acid molecules containing nucleotide sequences encoding mutations at the FT2a, FT2b, FT5a, and / or ELF3 loci of the soybean plant or plant cell genome, thereby generating novel alleles at the FT2a, FT2b, FT5a, and / or ELF3 loci. In embodiments, mutations are introduced via an expression cassette containing a nucleic acid sequence encoding a mutation at a designated locus, the nucleic acid sequence being operatively linked to a promoter. In embodiments, one or more of the nucleotide sequences encoding mutations at the FT2a, FT2b, FT5a, or ELF3 loci are operatively linked to a promoter (e.g., the same or different promoters). In embodiments, mutations are introduced into the FT2a, FT2b, FT5a, and / or ELF3 loci of the soybean plant genome via genome editing (e.g., genome modification using site-directed nucleases). Embodiments of the present invention include plants or plant cells containing novel alleles at the FT2a, FT2b, FT5a, and / or ELF3 loci.

[0011] Further methods of the present invention include using mutagenesis and recombination (e.g., directed using chimeric oligonucleotides, megnucleotides, zinc fingers, TALENs, or CRISPR) to introduce specific strand breaks, recombination insertions, and mutations to engineer in situ changes in the plant genome, thereby altering the plant genome at the FT2a, FT2b, FT5a, and / or ELF3 loci. Thus, the plant is able to express one or more mutant proteins at the FT2a, FT2b, FT5a, and / or ELF3 loci, and consequently, the plant possesses altered flowering time characteristics. Therefore, the present invention also includes plants, varieties, and their seeds and progeny that alter flowering time, all products derived from the application of the methods described above.

[0012] Embodiments of the present invention include example methods for determining where soybean plants or their seeds should be grown. In an example embodiment, the method includes a) introducing mutations (e.g., via genomic modification using site-directed nucleases) at the FT2a, FT2b, FT5a, and / or ELF3 loci of the soybean plant genome; b) self-pollinating the plants for one or more generations to generate progeny plants that are homozygous at each of the mutated loci; c) obtaining DNA from the progeny plants; d) determining the allelic combination of the progeny plants via a first determination of DNA indicating the type of mutation introduced at a first FT2a, FT2b, FT5a, or ELF3 locus and a second determination of DNA indicating the type of mutation introduced at a second and different FT2a, FT2b, FT5a, or ELF3 locus; and e) specifying a variation in flowering time of the plant based on the determined allelic combination, wherein the variation in flowering time is relative to a control plant that does not contain the allelic combination. In embodiments, editing of endogenous genes at the FT2a, FT2b, FT5a, and / or ELF3 loci includes editing using a DNA-modifying enzyme (e.g., a site-directed nuclease). In embodiments, editing includes transforming plant cells with an expression cassette containing (i) a nucleic acid encoding a site-directed nuclease and (ii) a nucleic acid encoding at least one guide RNA (gRNA) targeting a target sequence. In embodiments, at least one gRNA targets a first target sequence at the FT2a, FT2b, FT5a, and / or ELF3 loci. In an example embodiment, at least one gRNA targets a target sequence at the FT2a, FT2b, FT5a, and / or ELF3 loci containing a second target sequence. In embodiments, the nucleic acid encoding the site-directed nuclease is operatively linked to a first promoter, and the nucleic acid encoding the at least one gRNA is operatively linked to a second promoter. In embodiments, the expression cassette further includes an enhancer operatively linked to the first promoter or the second promoter. In the embodiments, the site-directed nuclease is selected from the group consisting of: mega-nucleases (MN), zinc finger nucleases (ZFN), transcription activator-like effector nucleases (TALEN), Cas9 nucleases, Cfp1 nucleases, dCas9-Fokl, dCpf1-Fokl, chimeric Cas9-cytidine deaminase, chimeric Cas9-adenine deaminase, chimeric FEN1-Fokl, and Mega-TAL, nickase Cas9 (nCas9), chimeric dCas9 non-Fokl nucleases, and dCpfl non-Fokl nucleases. In the embodiments, the editing includes introducing a mutation into the locus, the mutation being selected from the group consisting of: allele substitution, one or more base insertions, and one or more base deletions.

[0013] In an embodiment, the editing further includes regenerating a transformed T0 plant from transformed plant cells, the transformed T0 plant having a plurality of T1 seeds, wherein the plurality of T1 seeds contain a plurality of unique edits at the FT2a, FT2b, FT5a, and / or ELF3 loci; growing a plurality of T1 plants from the T1 seeds; subjecting these T1 plants to self-pollination for one or more generations; and selecting progeny plants homozygous at the FT2a, FT2b, FT5a, and / or ELF3 loci. In an embodiment, the method further includes sequencing the FT2a, FT2b, FT5a, and / or ELF3 loci of the progeny plants; sequencing the FT2a, FT2b, FT5a, and / or ELF3 loci of the T0 plants; and comparing the FT2a, FT2b, FT5a, and / or ELF3 locus sequences of the T0 plants with the corresponding sequences of the progeny plants to determine the type of mutation introduced into the FT2a, FT2b, FT5a, and / or ELF3 loci.

[0014] In embodiments, the allele combination comprises: loss-of-function or partially functional alleles at one or more of the FT2a, FT2b, FT5a, and / or ELF3 loci. In embodiments, specifying a variation in flowering time includes specifying a relative maturity group value relative to a control plant that does not contain one or more mutant alleles at the FT2a, FT2b, FT5a, and / or ELF3 loci, wherein optionally the control plant contains wild-type alleles at the respective FT2a, FT2b, FT5a, and / or ELF3 loci. In embodiments, specifying a variation in flowering time includes specifying the number of days earlier the flowering time of the soybean plant compared to the control plant.

[0015] In other embodiments, a method is provided for producing soybean plants with modified flowering times. In an example embodiment, the method includes introducing an edit into a first gene at the FT2a, FT2b, FT5a, and / or ELF3 loci in plant cells to generate mutant alleles with reduced protein function at the FT2a, FT2b, FT5a, and / or ELF3 loci relative to wild-type alleles at the same loci. In an embodiment, the method further includes introducing a second edit into a second FT2a, FT2b, FT5a, and / or ELF3 locus in plant cells to generate a mutant with reduced mutant protein function relative to wild-type proteins; regenerating the edited plant from the edited plant cells; and self-pollinating the edited plant to obtain edited offspring containing allele combinations of the first and second mutant alleles, wherein the edited offspring have modified flowering times relative to the flowering times of control plants containing wild-type alleles at one or both mutation sites. Mutations can result in partial loss of function or loss-of-function mutations.

[0016] Embodiments of the invention further include gene-edited plants comprising any of the listed allele combinations and edited progeny plants. In embodiments, the flowering time of the edited progeny plant is modified (e.g., longer or shorter) compared to the flowering time of the control plant. In embodiments, the relative maturity group value of the edited progeny plant differs from the relative maturity group value of the control plant. A brief description of sequences in a sequence list.

[0017] SEQ ID NO: 1 is the genome sequence of WT FT2a.

[0018] SEQ ID NO: 2 is the genomic sequence of an FT2a mutant with a 1-bp insertion at nucleotide position 153 relative to SEQ ID NO: 10.

[0019] SEQ ID NO: 3 is the genome sequence of WT FT2b.

[0020] SEQ ID NO: 4 is the genomic sequence of an FT2b mutant with a 4-bp deletion at nucleotide positions 10-13 relative to SEQ ID NO: 12.

[0021] SEQ ID NO: 5 is the genome sequence of WT FT5a.

[0022] SEQ ID NO: 6 is the genomic sequence of an FT5a mutant with a 1-bp insertion at nucleotide position 2 relative to SEQ ID NO: 14.

[0023] SEQ ID NO: 7 is the genome sequence of WT ELF3.

[0024] SEQ ID NO: 8 is the genomic sequence of an ELF3 mutant with a 1-bp insertion at nucleotide position 28 relative to SEQ ID NO: 16.

[0025] SEQ ID NO: 9 is the genomic sequence of an ELF3 mutant with a 5-bp deletion at nucleotide positions 24-28 relative to SEQ ID NO: 16.

[0026] SEQ ID NO: 10 is the nucleotide coding sequence of WT FT2a.

[0027] SEQ ID NO: 11 is the nucleotide coding sequence of an FT2a mutant with a 1-bp insertion at nucleotide position 153 relative to SEQ ID NO: 10.

[0028] SEQ ID NO: 12 is the nucleotide coding sequence of WT FT2b.

[0029] SEQ ID NO: 13 is the nucleotide coding sequence of an FT2b mutant with a 4-bp deletion at nucleotide positions 10-13 relative to SEQ ID NO: 12.

[0030] SEQ ID NO: 14 is the nucleotide coding sequence of WT FT5a.

[0031] SEQ ID NO: 15 is the nucleotide coding sequence of an FT5a mutant with a 1-bp insertion at nucleotide position 2 relative to SEQ ID NO: 14.

[0032] SEQ ID NO: 16 is the nucleotide coding sequence of WT ELF3.

[0033] SEQ ID NO: 17 is the nucleotide coding sequence of an ELF3 mutant with a 1-bp insertion at nucleotide position 28 relative to SEQ ID NO: 16.

[0034] SEQ ID NO: 18 is the nucleotide coding sequence of an ELF3 mutant with a 5-bp deletion at nucleotide positions 24-28 relative to SEQ ID NO: 16.

[0035] SEQ ID NO: 19 is the amino acid sequence of WT FT2a.

[0036] SEQ ID NO: 20 is the amino acid sequence of the FT2a mutant encoded by SEQ ID NO: 11.

[0037] SEQ ID NO: 21 is the amino acid sequence of WT FT2b.

[0038] SEQ ID NO: 22 is the amino acid sequence of the FT2b mutant encoded by SEQ ID NO: 13.

[0039] SEQ ID NO: 23 is the amino acid sequence of WT FT5a.

[0040] SEQ ID NO: 24 is the amino acid sequence of the FT5a mutant encoded by SEQ ID NO: 15.

[0041] SEQ ID NO: 25 is the amino acid sequence of WT ELF3.

[0042] SEQ ID NO: 26 is the amino acid sequence of the ELF3 mutant encoded by SEQ ID NO: 17.

[0043] SEQ ID NO: 27 is the amino acid sequence of the ELF3 mutant encoded by SEQ ID NO: 18.

[0044] SEQ ID NO: 28 is the GmFT2a target sequence.

[0045] SEQ ID NO: 29 is a meaningful sequence of GmFT2a.

[0046] SEQ ID NO: 30 is an antisense sequence of GmFT2a.

[0047] SEQ ID NO: 31 is the GmFT2a forward primer.

[0048] SEQ ID NO: 32 is the GmFT2a reverse primer.

[0049] SEQ ID NO: 33 is the GmFT2b targeting sequence.

[0050] SEQ ID NO: 34 is a meaningful sequence of GmFT2b.

[0051] SEQ ID NO: 35 is the GmFT2b antisense sequence.

[0052] SEQ ID NO: 36 is the GmFT2b forward primer.

[0053] SEQ ID NO: 37 is the GmFT2b reverse primer.

[0054] SEQ ID NO: 38 is the GmFT5a targeting sequence.

[0055] SEQ ID NO: 39 is a meaningful sequence of GmFT5a.

[0056] SEQ ID NO: 40 is an antisense sequence of GmFT5a.

[0057] SEQ ID NO: 41 is the GmFT5a forward primer.

[0058] SEQ ID NO: 42 is the GmFT5a reverse primer.

[0059] SEQ ID NO: 43 is the GmELF3 targeting sequence.

[0060] SEQ ID NO: 44 is a meaningful sequence of GmELF3.

[0061] SEQ ID NO: 45 is an antisense sequence of GmELF3.

[0062] SEQ ID NO: 46 is the GmELF3 forward primer.

[0063] SEQ ID NO: 47 is the GmELF3 reverse primer. Attached Figure Description

[0064] This application includes the following figures. These figures are intended to illustrate certain embodiments and / or features of the compositions and methods, and to supplement any description of the compositions and methods. These figures do not limit the scope of the compositions and methods unless expressly indicated in the written description.

[0065] Figure 1A It shows the different developmental stages of soybean plants.

[0066] Figure 1B It depicts the color change of the bean pods after they mature.

[0067] definition

[0068] Unless otherwise defined below, all technical and scientific terms used herein are intended to have the same meaning as commonly understood by one of ordinary skill in the art. References to techniques used herein are intended to refer to techniques commonly understood in the art, including variations and / or alternatives to equivalent techniques that are readily apparent to one of ordinary skill in the art. While it is believed that the following terms will be well understood by one of ordinary skill in the art, the following definitions are set forth to facilitate the interpretation of the subject matter disclosed in this application.

[0069] Under the long-standing Patent Law Convention, the terms “a / an” and “the” used in this application (including the claims) mean “one / a kind or more / kinds”. For example, the phrase “a / a kind of cell” refers to one or more / more than one type of cell, and in some embodiments may refer to tissues and / or organs. Similarly, the phrase “at least one / a kind” when used herein to refer to an entity means, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100 or more of that entity, including but not limited to all integer values ​​between 1 and 100 and integers greater than 100.

[0070] Unless otherwise indicated, all figures representing amounts of components, reaction conditions, etc., used in this specification and claims should be understood to be modified in all cases by the term "about". As used herein, the term "about", when referring to a measurable value such as mass, weight, time, volume, concentration, or percentage, means to cover variations of ±20% from a specified amount in some embodiments, ±10% in some embodiments, ±5% in some embodiments, ±1% in some embodiments, ±0.5% in some embodiments, and ±0.1% in some embodiments, because such variations are suitable for performing the disclosed methods and / or using the disclosed compositions, nucleic acids, peptides, etc. Therefore, unless indicated to the contrary, the numerical parameters listed in this specification and the appended claims are approximate values ​​that may vary depending on the desired characteristics sought to be obtained through the subject matter disclosed in this application.

[0071] As used herein, the term "allele" refers to a gene or a variant or alternative nucleotide sequence at a particular genetic locus. An allele may be considered (i) wild-type or (ii) mutant if one or more mutations or edits are present in the nucleic acid sequence of a mutant allele relative to the wild-type allele. In diploids, a single allele at each locus is inherited separately by offspring individuals from each parent. While those skilled in the art will understand that an allele in any particular individual need not represent all alleles present in that species, the two alleles at a given locus in a diploid organism occupy corresponding positions on a pair of homologous chromosomes.

[0072] Mutant alleles of a gene, relative to the wild-type allele, can have reduced or eliminated gene activity or expression levels. In diploid organisms (such as maize and soybean), the first allele can appear on one chromosome, and the second allele can appear at the same locus on a second homologous chromosome. If one allele at a locus on a plant chromosome is a mutant allele, and the other corresponding allele on the plant's homologous chromosome is wild-type, the plant is described as heterozygous for the mutant allele. However, if both alleles at the locus are mutant alleles, the plant is described as homozygous for the mutant allele. Plants homozygous for the mutant allele at a locus can contain the same mutant allele or different mutant alleles (if they are heteroallelic or bialic).

[0073] "Allelic variation" refers to the variation in the form of allele sequences at a given genetic locus. Allelic variation results in the production of two or more allelic variants. Variants can be naturally occurring and reflect genetic differences between individuals of the same species. Such natural variation may occur due to natural breeding practices. Alternatively, variants can be non-natural and artificially created (e.g., by breeders or scientists) using mutagenesis and / or gene editing techniques. In embodiments of the invention, allelic variants of the soybean FT2a, FT2b, FT5a, and / or ELF3 loci are produced by gene editing methods that result in the introduction of mutations. In other or alternative embodiments of the invention, allelic variants of the soybean FT2a, FT2b, FT5a, and / or ELF3 loci can be produced by chemical mutagenesis, transposon insertion or excision, or any other known mutagenesis technique.

[0074] In the example embodiment, the mutations introduced into the FT2a, FT2b, FT5a, and / or ELF3 loci are allelic substitutions, insertions of one or more base pairs, or deletions of one or more base pairs. Base pair insertions or deletions can include 3n-base mutations, wherein the deletion or insertion is a multiple of 3 base pairs (e.g., insertions or deletions of 3 bp, 6 bp, 9 bp, 12 bp, 15 bp, 18 bp, etc.) that do not affect the gene's reading frame. Alternatively, the base pair insertion or deletion may not be a multiple of 3 base pairs (e.g., insertions or deletions of 1 bp, 2 bp, 4 bp, 5 bp, 7 bp, 8 bp, 10 bp, 11 bp, 13 bp, 14 bp, etc.) that affect the gene's reading frame.

[0075] In various embodiments, the mutation is a truncating mutation, wherein the mutation can result in the introduction of a stop codon into the gene upstream of the transcriptional endpoint of the corresponding wild-type gene. Transcription of the resulting mutant allele terminates at the newly introduced stop codon, thereby producing a truncated protein that is shorter than the corresponding wild-type protein.

[0076] In other embodiments, the mutation is an in-frame deletion mutation, in which an integer multiple of three base pairs (i.e., 3n base pairs) are deleted. Since three base pairs encode a single amino acid, the result of an in-frame deletion is to maintain the reading frame of the transcript (i.e., no frameshift mutation is introduced); however, the transcript produced by the mutant allele encodes a mutant protein that is shorter than the corresponding wild-type protein. Both in-frame deletions and truncation mutations in a gene result in a mutated allele that encodes a shortened protein that has reduced function (e.g., partial or complete loss of function) compared to the protein encoded by the wild-type (i.e., unmutated) allele.

[0077] As used herein, "allele combination" refers to a specific combination of alleles present at more than one specific location or locus. Embodiments of the invention include multiple allele combinations at the FT2a, FT2b, FT5a, and / or ELF3 loci. Non-limiting examples of combinations of allele variations or mutant alleles include:

[0078] i. A mutant allele at the FT2a locus, optionally inserted at nucleotide position 153 of SEQ ID NO: 10; and a mutant allele at the FT2b locus, optionally deleted at nucleotide positions 10-13 of SEQ ID NO: 12;

[0079] ii. A mutant allele at the FT2a locus, optionally inserted at nucleotide position 153 of SEQ ID NO: 10; and a mutant allele at the FT5a locus, optionally inserted at nucleotide position 2 of SEQ ID NO: 14;

[0080] iii. A mutant allele at the FT2a locus, optionally inserted at nucleotide position 153 of SEQ ID NO: 10; and a mutant allele at the ELF3 locus, optionally inserted at nucleotide position 28 of SEQ ID NO: 16;

[0081] iv. A mutant allele at the FT2a locus, optionally with a 1-bp insertion at nucleotide position 153 of SEQ ID NO: 10; and a mutant allele at the ELF3 locus, optionally with a 5-bp deletion at nucleotide positions 24-28 of SEQ ID NO: 16;

[0082] The mutant allele at the v.FT2b locus, optionally with a 4-bp deletion at nucleotide positions 10-13 of SEQ ID NO: 12; and the mutant allele at the FT5a locus, optionally with a 1-bp insertion at nucleotide position 2 of SEQ ID NO: 14;

[0083] vi. The mutant allele at the FT2b locus, optionally with a 4-bp deletion at nucleotide positions 10-13 of SEQ ID NO: 12; and the mutant allele at the ELF3 locus, optionally with a 1-bp insertion at nucleotide position 28 of SEQ ID NO: 16;

[0084] vii. The mutant allele at the FT2b locus, optionally with a 4-bp deletion at nucleotide positions 10-13 of SEQ ID NO: 12; and the mutant allele at the ELF3 locus, optionally with a 5-bp deletion at nucleotide positions 24-28 of SEQ ID NO: 16;

[0085] viii. The mutant allele at the FT5a locus is optionally inserted 1-bp at nucleotide position 2 relative to SEQ ID NO: 14; and the mutant allele at the ELF3 locus is optionally inserted 1-bp at nucleotide position 28 relative to SEQ ID NO: 16; or

[0086] ix. A mutant allele at the FT5a locus, optionally with a 1-bp insertion at nucleotide position 2 relative to SEQ ID NO: 14; and a mutant allele at the ELF3 locus, optionally with a 5-bp deletion at nucleotide positions 24-28 relative to SEQ ID NO: 16.

[0087] In other embodiments, other allele variants include:

[0088] i. A combination of a mutant allele at any of the aforementioned FT2a loci with a mutation at one or more of the aforementioned FT2b, FT5a, or ELF3 loci;

[0089] ii. A combination of a mutated allele at any of the aforementioned FT2b loci with a mutation at any of the aforementioned FT2a, FT5a, or ELF3 loci;

[0090] iii. A combination of a mutant allele at any of the aforementioned FT5a loci with a mutation at one or more of the aforementioned FT2a, FT2b, or ELF3 loci; or

[0091] iv. A combination of a mutant allele at any of the aforementioned ELF3 loci with a mutant allele at one or more of the aforementioned FT2a, FT2b, or FT5a loci.

[0092] In unrestricted instances, allele variants include:

[0093] i. Mutant allele at the FT2a locus;

[0094] ii. Mutant alleles at the FT2a locus and mutant alleles at the FT2b locus;

[0095] iii. Mutant alleles at the FT2a locus and mutant alleles at the ELF3 locus;

[0096] iv. Mutant alleles at the FT2b locus;

[0097] v. Mutant allele at the FT5a locus;

[0098] vi. Mutant alleles at the FT5a locus and mutant alleles at the ELF3 locus; or

[0099] vii. Mutant alleles at the ELF3 locus.

[0100] In the embodiments, allele variants include one or more of the following:

[0101] i.SEQ ID NO: 11;

[0102] ii. A combination of SEQ ID NO: 11 and SEQ ID NO: 13;

[0103] iii. A combination of SEQ ID NO: 11 and SEQ ID NO: 17;

[0104] iv.SEQ ID NO: 13;

[0105] v.SEQ ID NO: 15;

[0106] vi. A combination of SEQ ID NO: 15 and SEQ ID NO: 18; or

[0107] vii.SEQ ID NO: 17 or 18.

[0108] In various embodiments:

[0109] i. The nucleotide sequence encoding the FT2a mutant having a 1-bp insertion at nucleotide position 153 relative to SEQ ID NO: 10 is shown in SEQ ID NO: 11, and encoding the amino acid sequence shown in SEQ ID NO: 20;

[0110] ii. The nucleotide sequence encoding the FT2b mutant having a 4-bp deletion at nucleotide positions 10-13 relative to SEQ ID NO: 12 is shown in SEQ ID NO: 13, and encodes the amino acid sequence shown in SEQ ID NO: 22;

[0111] iii. A nucleotide sequence encoding an FT5a mutant having a 1-bp insertion at nucleotide position 2 relative to SEQ ID NO: 14, as shown in SEQ ID NO: 15, and encoding an amino acid sequence as shown in SEQ ID NO: 24;

[0112] iv. A nucleotide sequence encoding an ELF3 mutant having a 1-bp insertion at nucleotide position 28 relative to SEQ ID NO: 16, as shown in SEQ ID NO: 17, and encoding an amino acid sequence as shown in SEQ ID NO: 26; and

[0113] v. A nucleotide sequence encoding an ELF3 mutant having a 5-bp deletion at nucleotide positions 24-28 relative to SEQ ID NO: 16, as shown in SEQ ID NO: 18, and encoding an amino acid sequence as shown in SEQ ID NO: 27.

[0114] In embodiments, the flowering time of non-natural soybean plants containing any of the non-natural allele combinations disclosed above is modified relative to control plants having a wild-type allele at the corresponding mutated locus, or relative to control plants having a wild-type allele at one or all of the corresponding mutated loci (in the case of multiple loci mutations). For example, a non-natural plant may have more than one mutant allele described herein at the FT2a, FT2b, FT5a, or ELF3 loci, but a control plant may have the corresponding wild-type allele at only some (e.g., one) but not all of the loci. In this case, mutations at more than one allele can have altered flowering times compared to control plants having one corresponding wild-type allele but mutated at one or more of the other mutant alleles. As a non-limiting example, a non-natural soybean plant with mutations at both the FT2a and FT2b loci can have altered flowering times relative to a control plant that is wild-type at one of the FT2a or FT2b loci and mutated at another of the FT2a or FT2b loci.

[0115] In the embodiments, modified soybean plants containing mutant alleles at one or more of the FT2a, FT2b, FT5a, or ELF3 loci had a flowering time that was less than (e.g., slightly less or significantly less than) that of control plants.

[0116] In embodiments of the present invention, the allele combinations of plants at the FT2a, FT2b, FT5a, or ELF3 loci can be determined by assays based on molecular markers, such as assays of plant DNA indicating the type of mutation introduced at each locus.

[0117] In the embodiments, allele combinations indicate the variation in flowering time of plants relative to control plants that do not contain allele combinations (e.g., control plants containing one or more of the wild-type alleles or containing wild-type alleles at all corresponding loci).

[0118] As used herein, the term “and / or” when used in the context of enumerating entities refers to entities existing individually or in combination. Thus, for example, the phrase “A, B, C and / or D” includes A, B, C, and D individually, but also any and all combinations and sub-combinations of A, B, C, and D (e.g., AB, AC, AD, BC, BD, CD, ABC, ABD, and BCD). In some embodiments, one or more elements referred to by “and / or” may also exist individually in single or multiple occurrences within combinations and / or sub-combinations.

[0119] As used herein, the phrase “associated with” refers to an identifiable and / or measurable relationship between two entities. For example, the phrase “associated with soybean maturity” refers to a trait, locus, gene, allele, marker, phenotype, or their expression, the presence or absence of which can affect the number of days a soybean plant is in a vegetative state. Therefore, a marker is “associated” with a trait when it is linked to it and when the presence of the marker indicates whether and / or to what extent the desired trait or trait form will occur in the plant / germplasm containing the marker. Similarly, a marker is “associated” with an allele when it is linked to it and when the presence of the marker indicates the presence of the allele in the plant / germplasm containing the marker. For example, “a marker associated with an allele of the soybean maturity gene FT2a” refers to a marker whose presence or absence can be used to predict the presence of the FT2a allele and its responsibility for the plant's flowering time.

[0120] A dominant maturation allele is an allele that affects plant maturation when it exists as a single copy (heterozygous) or two copies (homozygous). A recessive maturation allele is an allele that affects plant maturation only when it exists as two copies (homozygous), and has no effect on plant maturation when it exists as a single copy (heterozygous).

[0121] The term "comprising" is synonymous with "including," "containing," and "characterized by," and is inclusive or open-ended, and does not exclude additional unlisted elements and / or method steps. "Comprising" means that the specified elements and / or steps exist, but other elements and / or steps may be added and still fall within the scope of the relevant subject matter.

[0122] As used herein, the phrase “composes of” excludes any element, step, or component not specifically listed. When the phrase “composes of” appears in a clause of the body of a claim, rather than directly following the preamble, it limits only the element set forth in that clause; other elements are not excluded from the claim as a whole.

[0123] As used herein, the phrase “consistently of…” limits the scope of the relevant disclosure or claim to the specified materials and / or steps, plus those that do not substantially affect the basic and novel features of the disclosed and / or claimed subject matter.

[0124] Regarding the terms “comprising,” “substantially consisting of,” and “composed of,” when one of these three terms is used herein, the subject matter disclosed and claimed in this application may include the use of either of the other two terms in some embodiments. For example, if the subject matter in some embodiments relates to soybean plants whose genome contains genomic regions containing mutant FT2a, FT2b, FT5a, or ELF3 alleles, it should be understood that the disclosed subject matter therefore also covers soybean plants having genomic regions consisting substantially of mutant FT2a, FT2b, FT5a, or ELF3 alleles in some embodiments, as well as soybean plants having genomic regions consisting of mutant FT2a, FT2b, FT5a, or ELF3 alleles in some embodiments. Similarly, it should also be understood that in some embodiments, the method for the disclosed subject matter includes the steps disclosed herein, in some embodiments, the method for the subject matter disclosed herein consists substantially of the disclosed steps, and in some embodiments, the method for the subject matter disclosed herein consists of the steps disclosed herein.

[0125] As used in this article, a “breeding variety” is a plant species or variety that is intentionally created or selected and maintained through breeding.

[0126] As used in this article, "determined growth habit" refers to the cessation of vegetative growth after the main stem terminates at a cluster of flowers. In contrast, "indeterminate growth habit" refers to the simultaneous development of leaves and flowers during a portion of their entire reproductive period, with one to three pods at the terminal apex.

[0127] As used herein, the term "gene" refers to a genetic unit consisting of a DNA sequence that occupies a specific location on a chromosome and contains the genetic instructions for a specific characteristic or trait in an organism.

[0128] A genetic map is a description of genetic linkages between loci on one or more chromosomes within a given species, typically presented as a diagram or table. Unlike a physical map, a genetic map describes the location of genetic elements (e.g., genes, alleles, chromosomal loci, markers, etc.) on sequenced chromosomes.

[0129] As used herein, the term "human-induced mutation" refers to any mutation resulting from direct or indirect human intervention. This term includes, but is not limited to, mutations obtained through any targeted mutagenesis and gene editing methods.

[0130] As used herein, “introduction” refers to the delivery, expression, application, transport, transfer, infiltration, or other similar terms indicating the delivery of nucleic acids or proteins, or combinations thereof, to an object. For example, nucleic acids encoding site-directed nucleases and optionally at least one guide RNA can be introduced into a plant embryo. Similarly, existing editing machinery (containing site-directed nuclease proteins and optionally at least one guide RNA) can be introduced into sterile soybean seeds by applying appropriate cell-penetrating chemicals and / or cell-penetrating peptides.

[0131] As used herein, a “strain” refers to a group of individual plants derived from similar parents that have similar traits. A “superior strain” is any strain resulting from breeding and selection aimed at superior agronomic performance. Furthermore, superior strains are sufficiently homogeneous and homozygous for use in commercial production. Superior strains can be used for further breeding work to develop new superior strains. Superior plants are any plants derived from superior strains.

[0132] As used in this article, a "locus" is a chromosomal locus or region where a polymorphic nucleic acid, trait determinant, gene, or marker is located. A "locus" can be shared by two homologous chromosomes to refer to their corresponding locus or region.

[0133] As used herein, the terms "label probe" and "probe" refer to a nucleotide sequence or nucleic acid molecule that can be used to detect the presence or absence of a sequence within a larger sequence, such as a nucleic acid probe that is wholly or partially complementary to a label or label locus through nucleic acid hybridization. Label probes containing approximately 8, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more consecutive nucleotides can be used for nucleic acid hybridization.

[0134] As used herein, the term "molecular marker" can be used to refer to a genetic marker or its encoded product (e.g., a protein) used as a reference point when identifying the presence / absence of a gene or allele (e.g., an allele at soybean maturity-related loci such as FT2a, FT2b, FT5a, and / or ELF3). Molecular markers can be derived from genomic nucleotide sequences or expressed nucleotide sequences (e.g., derived from RNA, cDNA, etc.). The term also refers to nucleotide sequences complementary to or flanking the marker sequence, such as nucleotide sequences used as probes and / or primers capable of amplifying the marker sequence. These nucleotide sequences are "complementary" (e.g., according to the Watson-Crick base pairing principle) when they specifically hybridize in solution. The term also refers to genetic markers that indicate traits by the absence of nucleotide sequences complementary to or flanking the marker sequence (e.g., nucleotide sequences used as probes and / or primers capable of amplifying the marker sequence).

[0135] As used herein, the terms “nucleotide sequence,” “polynucleotide,” “nucleic acid sequence,” “nucleic acid molecule,” and “nucleic acid fragment” refer to a polymer of single-stranded or double-stranded RNA or DNA, optionally containing synthetic, non-natural, and / or modified nucleotide bases. A “nucleotide” is a monomeric unit from which a DNA or RNA polymer is constructed and consists of a purine or pyrimidine base, a pentose sugar, and a phosphate group. Nucleotides (usually found in their 5′-monophosphate form) are designated by their single-letter names as follows: “A” for adenosine or deoxyadenosine (for RNA or DNA, respectively), “C” for cytidine or deoxycytidine, “G” for guanylic acid or deoxyguanylic acid, “U” for uridine, “T” for deoxythymidine, “R” for purine (A or G), “Y” for pyrimidine (C or T), “K” for G or T, “H” for A, C, or T, “I” for inosine, and “N” for any nucleotide.

[0136] As used herein, in the context of plants, plant seeds, plant parts, plant cells, and / or plant genomes, "modified" refers to an engineered change in the expression level and / or coding sequence of one or more of the FT2a, FT2b, FT5a, or ELF3 genes relative to wild-type or control plants, plant seeds, plant parts, plant cells, and / or plant genomes (e.g., via genome editing events or mutations affecting (e.g., reducing or eliminating) the expression level or activity of one or more endogenous FT2a, FT2b, FT5a, and / or ELF3 genes). The term "modified" may further refer to a plant, plant seed, plant part, plant cell, and / or plant genome having one or more mutations affecting the expression of one or more endogenous FT2a, FT2b, FT5a, or ELF3 genes, introduced by chemical mutagenesis, transposon insertion or excision, or any other known mutagenesis technique, or introduced by genome editing. Therefore, for clarity, modified plants, plant seeds, plant parts, plant cells, and / or plant genomes include mutated and / or edited plants, plant seeds, plant parts, plant cells, and / or plant genomes that, relative to wild-type or control plants, plant seeds, plant parts, plant cells, and / or plant genomes, have modified expression levels, expression patterns, and / or coding sequences of one or more FT2a, FT2b, FT5a, or ELF3 genes. Modified plants may be homozygous or heterozygous for any given mutation or edit, and / or may be biallelic at the FT2a, FT2b, FT5a, or ELF3 loci. If each copy of a gene is modified with different alleles (i.e., different mutations and / or edits), the modified plant is biallelic for the FT2a, FT2b, FT5a, or ELF3 genes, where each allele reduces the gene expression level and / or activity. Modified plants or seeds may contain a variety of molecular changes affecting the expression of the FT2a, FT2b, FT5a, or ELF3 genes, including genetic and / or epigenetic modifications. Modified plants, plant parts, seeds, etc., may have undergone mutagenesis, genome editing or site-directed integration (e.g., but not limited to, via methods using site-specific nucleases), genetic transformation (e.g., but not limited to, via Agrobacterium-mediated transformation or particle bombardment), or combinations thereof. Such “modified” plants, plant seeds, plant parts, and plant cells include plants, plant seeds, plant parts, and plant cells that are progeny of or derived from “modified” plants, plant seeds, plant parts, and plant cells, and that retain the molecular changes (e.g., changes in expression levels and / or activity) of the FT2a, FT2b, FT5a, or ELF3 genes.The modified seeds provided herein can produce the modified plants provided herein. The modified plants, plant seeds, plant parts, plant cells, or plant genomes provided herein may contain recombinant DNA constructs or vectors or genome editing as provided herein. “Modified plant products” can be any product made from the modified plants, plant parts, plant cells, or plant chromosomes or any part or component thereof provided herein.

[0137] As used herein, the term "nucleotide sequence identity" refers to the presence of identical nucleotides at corresponding positions in two polynucleotides. When performing alignments to obtain the best correspondence (e.g., within a comparison window), the polynucleotides are considered to have an "identical" sequence if the nucleotide sequences in the two polynucleotides are identical. Sequence comparisons between two or more polynucleotides are typically performed by comparing portions of the two sequences within a comparison window to identify and compare local regions of sequence similarity. Comparison windows are typically from about 20 to 200 consecutive nucleotides. The "sequence identity percentage" of a polynucleotide, such as approximately 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity, can be determined within a comparison window by comparing two optimally aligned sequences, where, for optimal alignment of the two sequences, the portion of the polynucleotide sequence within the comparison window compared to a reference sequence may include additions or deletions (i.e., vacancies). In some embodiments, the percentage is calculated by: (a) determining the number of positions where the same nucleic acid base appears in both sequences; (b) dividing the number of matching positions by the total number of positions in the comparison window; and (c) multiplying the result by 100. Optimal alignment of sequences for comparison can also be performed by a computerized implementation of known algorithms or by visual inspection. Easily available sequence comparison and multiple sequence alignment algorithms include the Basic Local Alignment Search Tool (BLAST) and the ClustalW / ClustalW2 / Clustal Omega programs, which are available on the Internet (e.g., the EMBL-EBI website). Other suitable programs include, but are not limited to, GAP, BestFit, Plot Similarity, and FASTA, which are part of the Accelrys GCG software package available from Accelrys Inc. (San Diego, California, USA). See also Smith and Waterman, 1981; Needleman and Wunsch, 1970; Pearson and Lipman, 1988; Ausubel et al., 1988; and Sambrook and Russell, 2001.

[0138] The term "open reading frame" (ORF) refers to a nucleic acid sequence encoding a polypeptide. In some embodiments, the ORF comprises a translation start codon (i.e., start codon), a translation termination codon (i.e., stop codon), and the nucleic acid sequence encoding amino acids present in the polypeptide therein. The terms "start codon" and "stop codon" refer to a unit of three adjacent nucleotides (i.e., codons) in the coding sequence, which correspondingly indicate the initiation and termination of protein synthesis (mRNA translation).

[0139] As used herein, the terms “phenotype,” “phenotypic trait,” or “trait” refer to one or more characteristics of a plant or plant cell. A phenotype can be observed with the naked eye or by any other assessment method known in the art (e.g., microscopy, biochemical analysis, or electromechanical assay). In some cases, a phenotype is directly controlled by a single gene or genetic locus (i.e., corresponding to a “monogenous trait”).

[0140] In other cases, phenotype is the result of interactions between several genes, and in some embodiments, it is also caused by the interaction between the plant and / or plant cells and their environment.

[0141] In the case of soybean maturity genes (such as FT2a, FT2b, FT5a, or ELF3), phenotypic traits include one or more or combinations of flowering time, post-flowering time, relative maturity time, maturity time, maturity group, and the number of days from flowering to initial maturity in soybean plants. In a particular embodiment, the phenotypic trait measured is flowering time, and includes VE and R1 stages in modified soybean plants relative to control plants (see different stages). Figure 1A A measure of the time elapsed between (R1 and R7 or R1 and R8) in modified soybean plants, relative to control plants (see [reference for different stages]). In another embodiment, the phenotypic trait measured is maturity time, and includes the time elapsed between (R1 and R7 or R1 and R8) in modified soybean plants, relative to control plants. Figure 1A The number of days is a measure of the time elapsed between two loci. The number of days can vary depending on the specific allele combination of the plant, relative to a control plant containing wild-type alleles at both loci.

[0142] In exemplary embodiments of the invention, modified soybean plants containing mutant FT2a, FT2b, FT5a, and / or ELF3 alleles exhibit significantly shorter flowering and / or maturity times compared to control plants. Additionally, soybean plants containing mutant alleles at more than one of the FT2a, FT2b, FT5a, or ELF3 loci exhibit significantly shorter flowering and / or maturity times compared to control plants. The duration or extent of the reduced flowering time is further based on the nature of the mutant alleles, such as whether the mutant alleles result in gain-of-function, complete loss of function, or partial loss of function of the gene product. Furthermore, the duration or extent of the reduced flowering time can be based on whether the alleles are homozygous or heterozygous (e.g., biallelic) and whether the alleles are homozygous recessive or dominant.

[0143] As used herein, a modified plant having a “slightly shorter” flowering and / or maturity time compared to a control plant has a flowering and / or maturity time that is between 1 and 10 days shorter than that of the control plant (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 days shorter than that of the control plant). In embodiments, if the modified plant has a flowering time that is 1-2 days, 1-3 days, 1-4 days, 1-5 days, 1-6 days, 1-7 days, 1-8 days, 1-9 days, or 1-10 days shorter than that of the control plant, then the modified plant has a slightly shorter flowering time compared to the control plant.

[0144] In contrast, modified plants with “significantly fewer” flowering and / or maturity times compared to control plants have flowering and / or maturity times that are at least 10 days shorter than control plants, such as between 10 and 100 days shorter than control plants (e.g., at least 10 days, 10-20 days, 10-30 days, 10-40 days, 10-50 days, 10-60 days, 10-70 days, 10-80 days, 10-90 days, or 10-100 days or any range thereof, such as 20-30 days, 20-40 days, 30-40 days, 40-50 days, 50-60 days, 70-80 days, 80-90 days, 90-100 days, etc. shorter than control plants).

[0145] As used herein, the term "photoperiodic response" or "photoperiodic phenomenon" refers to a plant's physiological response to the relative lengths of light and dark cycles. Photoperiodic responsive plants can be "short-day," "long-day," or "medium-day" plants. The photoperiodic phenomenon influences flowering by inducing shoots to produce floral buds rather than leaves and lateral buds. For example, soybean is a short-day (SD) plant. In embodiments of the invention, the timing of soybean flowering is assessed. Short-day plants flower when night length exceeds their critical photoperiod and cannot flower under short nights. They require a prolonged period of darkness before flower development can begin. Natural nighttime light (such as moonlight or lightning) does not have sufficient brightness or duration to interrupt flowering. Typically, short-day (i.e., long-night) plants flower when day length becomes shorter (e.g., late summer and fall in the Northern Hemisphere). The length of the dark period required to induce flowering varies between species and varieties of species. Long-day plants flower when night length is below their critical photoperiod. These plants typically bloom when daylight hours become longer (e.g., late spring and early summer in the Northern Hemisphere).

[0146] As used herein, “flowering time” or “days of flowering” is an estimate of the duration (e.g., in hours, days, weeks, etc.) between the onset of first flowering and seed emergence. In embodiments of the invention, the flowering time of soybean plants is modified or altered relative to control plants by introducing novel, non-naturally occurring alleles into genes involved in soybean maturation (particularly FT2a, FT2b, FT5a, or ELF3 genes). In a particular embodiment, flowering time is defined as the number of days that occur in soybean plants transitioning from the VE stage (e.g., seed emergence, where for at least 50% of seeds, cotyledons have penetrated the soil surface) to the R1 stage (e.g., initial flowering, where at least 50% of plants have at least one flower at any node). In a specific embodiment, maturity time or post-flowering time is defined as the number of days elapsed for a soybean plant to transition from stage R1 (e.g., initial flowering, where an open flower is present at any node on the main stem) to stage R7 (where any pods have reached mature pod color) or from stage R1 to stage R8 (where 95% of the pods have reached their mature pod color). The descriptions of different developmental stages of soybean plants and the color of mature pods are provided in... Figure 1A and Figure 1B Provided here for reference.

[0147] As used herein, “relative maturity group” or “relative maturity value” or “RM” can be any indicative number, symbol, or combination of both that provides an indication of when a plant matures. In embodiments, the relative maturity value indicates the average number of days elapsed between flowering and maturity time, or between flowering and the final seed pod reaching maturity (e.g., to stage R7). Similarly, variations in the relative maturity group can be correlated with variations in average flowering time. As an example, in North America, a variation in relative maturity from RM 2.0 to RM 3.0 might be correlated with a 10-day variation in maturity time. This value can vary based on growing conditions, such as whether the plant is grown under short-day or long-day conditions, or whether the plant is grown in a greenhouse or field conditions.

[0148] As used herein, “altered” or “modified” when applied to soybean maturity means an increase or decrease in maturity. In this respect, mature seeds are defined by seeds harvested in the field for commercial agricultural practices (such as the sale of feed). In one aspect, soybean plants are selected for preferred geographic locations to express at least one phenotypic trait. Phenotypic traits include altered levels of substances or molecules (such as proteins, oils, or gamma-linolenic acid). “Altered” can include any relative increase or decrease in the function or production of a target gene product, in one aspect up to and including the complete elimination of the function or production of that gene product. When comparing levels of gene products, such comparisons are preferably made between organisms with similar genetic backgrounds. Preferably, a similar genetic background is one in which the nuclear genetic material of the organisms being compared has 50% or more, more preferably 75% or more, and even more preferably 90% or more sequence identity. In another aspect, a similar genetic background is one in which the plants are homogeneous except for one or more markers of the present invention.

[0149] As used herein, the term "plant" can refer to the whole plant, any part thereof, or a cell or tissue culture derived from a plant. Therefore, unless otherwise stated, the term "plant" can refer to any of the following: the whole plant, plant components or organs (e.g., leaves, stems, roots, etc.), plant tissues, seeds and / or plant cells, including viable seeds as well as inactive seeds or seeds that cannot regenerate into a whole plant.

[0150] Plant cells are plant cells obtained from plants, or plant cells derived from cells taken from plants through culture. Therefore, the term "plant cell" includes, but is not limited to, cells within seeds, suspension cultures, embryos, meristematic zones, callus, leaves, buds, gametophytes, sporophytes, pollen, and microspores. The phrase "plant part" refers to a portion of a plant, including single cells and cellular tissues (such as intact plant cells), cell masses, and tissue cultures that can regenerate plants. Examples of plant parts include, but are not limited to, single cells and tissues derived from: pollen, ovules, leaves, embryos, roots, root tips, anthers, flowers, fruits, stems, buds, and seeds; as well as scions, rhizomes, protoplasts, callus, etc.

[0151] As used herein, the term "primer" refers to an oligonucleotide that, when placed under conditions inducing primer extension product synthesis (e.g., in the presence of nucleotides and reagents for polymerization, such as DNA polymerase, and at suitable temperature and pH), is capable of annealing (in some embodiments, specifically annealing) with a nucleic acid target to allow DNA polymerase and / or reverse transcriptase to attach thereto, thereby serving as a starting point for DNA synthesis. In some embodiments, one or more primers are used to amplify plant nucleic acids (e.g., using polymerase chain reaction; PCR).

[0152] As used herein, the term "probe" refers to a nucleic acid (e.g., a single-stranded nucleic acid or a strand of a double-stranded or higher-order nucleic acid, or a subsequence thereof) that can form a hydrogen-bonded duplex with a complementary sequence in a target nucleic acid sequence. Typically, probes are of sufficient length to form stable and sequence-specific duplex molecules with their complementary sequences, and this can be used in some embodiments to detect a target sequence present in multiple nucleic acids.

[0153] As used herein, the terms "offspring" and "offspring plant" refer to a plant produced from one or more parent plants through vegetative or sexual reproduction. Offspring plants can be obtained by cloning a single parent plant, self-pollinating a single parent plant, or by hybridizing two or more parent plants. For example, offspring plants can be obtained by cloning or self-pollinating a single parent plant or by hybridizing two parent plants, and include inbreds as well as F1 or F2 or even further generations. F1 is the first generation of offspring produced from two parents (at least one of the two parents is used as a donor for the trait for the first time), while the second generation (F2) or subsequent generations (F3, F4, etc.) are samples produced from self-pollination, intercrossing, backcrossing, and / or other hybridizations of F1, F2, etc. Thus, F1 can be (and in some embodiments is) a hybrid produced from hybridization between two homozygous parents (i.e., each of the parents homozygous for the desired trait or its alleles is homozygous), while F2 can be (and in some embodiments is) an offspring produced from self-pollination of the F1 hybrid.

[0154] As used herein, the phrase “recombination” refers to the exchange (“crossing-over”) of DNA fragments between two DNA molecules or chromatids on a paired chromosome in regions of similar or identical nucleotide sequences. “Recombination event” is understood herein to refer, in some embodiments, to meiotic crossing-over.

[0155] As used herein, the term "reference sequence" refers to a defined nucleotide sequence that serves as the basis for nucleotide sequence comparisons.

[0156] As used herein, the terms "reference plant" or "control plant" refer to a specific plant used as the basis for genetic and / or phenotypic comparisons. In some embodiments, soybean plants containing wild-type alleles at each of the FT2a, FT2b, FT5a, or ELF3 loci are used as control plants for comparison with other plants containing mutant alleles at one or more of the FT2a, FT2b, FT5a, or ELF3 loci.

[0157] As used in this article, the term “regeneration” and its grammatical variations refer to the production of plants from tissue cultures.

[0158] As used herein, the phrase “strict hybridization conditions” refers to the conditions under which polynucleotides typically hybridize with their target sequence (but substantially not with other sequences) in a complex mixture of nucleic acids. Strict conditions are sequence-dependent and can vary under different conditions. Typically, longer sequences hybridize specifically at higher temperatures. A comprehensive guide to nucleic acid hybridization can be found in Sambrook and Russell, 2001. Generally, for specific sequences at a defined ionic strength and pH, strict conditions are chosen to be approximately 5°C–10°C below the thermal melting point (Tm). Tm is the temperature at which 50% of the probe complementary to the target hybridizes to the target sequence at equilibrium (in the presence of an excess of the target sequence, 50% of the probe is occupied at Tm at a given ionic strength, pH, and nucleic acid concentration). Exemplary stringent conditions are as follows: salt concentration less than about 1.0 M sodium ions, typically about 0.01 to 1.0 M sodium ion concentration (or other salt) at pH 7.0 to 8.3, and a temperature of at least about 30°C for short probes (e.g., 10 to 50 nucleotides) and at least about 60°C for long probes (e.g., more than 50 nucleotides).

[0159] Tight conditions can also be achieved by adding a destabilizing agent, such as formamide. Other exemplary tight hybridization conditions include incubation at 42°C with 50% formamide, 5×SSC, and 1% SDS; or incubation at 65°C with SSC and 1% SDS; followed by one or more washes at 65°C in 0.2×SSC and 0.1% SDS. For PCR, a temperature of approximately 36°C is typically used for low-tight amplification, but the annealing temperature can vary between approximately 32°C and 48°C (or higher) depending on the primer length. Further guidelines for determining hybridization parameters are provided in numerous references (see, for example, Ausubel et al., 1999).

[0160] As used herein, the term “trait” refers to a desired phenotype, the gene that promotes the desired phenotype, and the nucleic acid sequence associated with the gene that promotes the desired phenotype. For example, “soybean maturity trait” refers to a phenotype and the gene that promotes soybean maturity and has a nucleic acid sequence (e.g., soybean maturity-related gene product) associated with a photoperiodic response (including the number of days between flowering and pod formation).

[0161] As used herein, the term "transgenic" refers to a nucleic acid molecule introduced into an organism or one or more of its ancestors through some form of artificial transfer technique. Thus, artificial transfer techniques create "transgenic organisms" or "transgenic cells." It should be understood that artificial transfer techniques can occur in ancestral organisms (or cells therein and / or cells that can develop into ancestral organisms), and any offspring individual possessing an artificially transferred nucleic acid molecule or fragment thereof is still considered transgenic, even if one or more natural and / or assisted breeding results in the presence of the artificially transferred nucleic acid molecule in the offspring individual.

[0162] As used herein, the term “targeted mutagenesis” or “mutation strategy” refers to any mutagenesis method that intentionally induces mutagenesis in a selected gene. Targeted mutagenesis includes CRISPR, TILLING, TALEN methods, and other methods that have not yet been discovered but can be used to achieve the same results. Detailed Implementation

[0163] Soybeans are short-day (SD) plants, growing in a wide geographical area and across a broad range of latitudes from the equator to up to 50 degrees. This wide adaptability most likely results from genetic diversity at numerous major genes and quantitative trait loci controlling flowering behavior. Photoperiod is one of the major climatic factors determining soybean flower development and adaptability to different regions. Shorter day lengths can accelerate flowering, while longer day lengths can delay it. Due to their photoperiod sensitivity, the cultivation area for each soybean breed is limited to a very narrow latitudinal range to achieve its maximum yield.

[0164] This article provides information on plants containing non-naturally occurring allelic combinations of soybean maturity genes (particularly at the FT2a, FT2b, FT5a, and / or ELF3 loci) that modify the flowering characteristics (e.g., flowering time and / or maturity values) of the resulting plants. In some cases, when the alleles are expressed in the plant or parts thereof, the allelic combinations produce modified soybean maturity characteristics compared to control plants that do not contain a given allelic combination (e.g., control plants containing wild-type alleles at one or more loci). Due to the modified flowering characteristics, the resulting soybean plants and their progeny can be cultured and grown at a wider range of latitudes, resulting in higher yields. The terms “soybean maturity,” “relative maturity,” and “photoperiod response” are used interchangeably herein. Various methods for introducing mutations that result in non-naturally occurring alleles and allelic combinations into soybean plants are also disclosed, including transgenic methods, gene editing, and breeding. Markers for identifying the presence of these non-naturally occurring alleles in plants are also disclosed. As used herein, the terms “phenotype,” “phenotypic trait,” or “trait” refer to one or more distinguishable characteristics of a genetically controlled trait.

[0165] In some embodiments, the plant provided herein is a non-naturally existing soybean variety with the desired traits. In specific embodiments, the non-naturally existing soybean variety is a superior soybean variety. A “non-naturally existing soybean variety” is any soybean variety that does not exist in nature. A “non-naturally existing soybean variety” can be generated by any method known in the art, including but not limited to transforming soybean plants or germplasm, transfecting soybean plants or germplasm, and hybridizing naturally existing soybean varieties with non-naturally existing soybean varieties. In some embodiments, a “non-naturally existing soybean variety” may contain one or more heterologous nucleotide sequences. In some embodiments, a “non-naturally existing soybean variety” may contain one or more non-naturally existing alleles of a naturally existing gene (i.e., introducing a non-natural mutation into a gene naturally existing in soybean). In some embodiments, a “non-naturally existing soybean variety” may contain a non-natural combination of one or more non-natural alleles of the soybean maturation gene (i.e., non-naturally existing alleles of the FT2a, FT2b, FT5a, and / or ELF3 genes in different combinations that are not naturally existing in the same soybean variety).

[0166] "Subject plant or plant cell" refers to a plant or plant cell whose genetic alteration (e.g., mutation) of a target gene has affected the production of a novel, non-natural allele, or a plant or plant cell that has been inherited from such an altered plant or cell and contains that alteration. "Control" or "control plant" or "control plant cell" provides a reference point for measuring changes in the phenotypic characteristics of the subject plant or plant cell. Control plants or plant cells may include, for example: (a) wild-type plants or cells that have the same genotype as the starting material used to induce genetic changes in the subject plant or cell; (b) plants or plant cells that have the same genotype as the starting material but have wild-type alleles at each of the FT2a, FT2b, FT5a, and ELF3 loci; (c) plants or plant cells that have the same genotype as the starting material but have wild-type alleles at one or more of the FT2a, FT2b, FT5a, or ELF3 loci; (d) plants or plant cells that are non-transformed segregants in the offspring of the subject plant or plant cell; (e) plants or plant cells that are genetically identical to the subject plant or plant cell but have not been exposed to conditions or stimuli that would induce expression of the target gene or allele; or (f) the subject plant or plant cell itself under conditions in which the target gene or allele is not expressed.

[0167] I. Novel, non-naturally occurring alleles that cause modified soybean flowering time

[0168] Methods and compositions are provided for producing soybean plants with modified flowering characteristics. Such plants contain non-naturally occurring alleles at one or more of the FT2a, FT2b, FT5a, or ELF3 loci. These plants can be grown in geographic areas (including latitudinal regions) outside the restricted area when no allele combination is introduced (e.g., relative to plants containing any two wild-type alleles). In addition to expanding the breeding range, plant yield is also increased.

[0169] Site-directed mutagenesis is performed at the FT2a, FT2b, FT5a, and / or ELF3 loci, followed by selection of alleles encoding mutant forms of the FT2a, FT2b, FT5a, and / or ELF3 proteins with reduced activity. These alleles can be used to produce soybean plants with altered flowering times. The resulting novel FT2a, FT2b, FT5a, or ELF3 alleles are particularly well-suited for use in the context of in situ mutant (genome-edited) plants that can grow at latitudes other than their unmutated counterparts.

[0170] Non-limiting examples of allele combinations resulting from non-naturally occurring alleles described herein include:

[0171] (i) mutant alleles of one or more of the FT2a, FT2b, FT5a, or ELF3 loci that result in partial expression of one or more proteins, and wild-type alleles at other FT2a, FT2b, FT5a, or ELF3 loci, wherein the combination of alleles may be selected from:

[0172] a. Mutant alleles at the FT2a locus that lead to partial expression of the FT2a protein, and wild-type alleles at the FT2b, FT5a, and ELF3 loci;

[0173] b. Mutant alleles at the FT2b locus that lead to partial expression of the FT2b protein, and wild-type alleles at the FT2a, FT5a and ELF3 loci;

[0174] c. Mutant alleles at the FT5a locus leading to partial expression of the FT5a protein, and wild-type alleles at the FT2a, FT2b, and ELF3 loci; and

[0175] d. Mutant alleles at the ELF3 locus that lead to partial expression of the ELF3 protein, and wild-type alleles at the FT2a, FT2b, and FT5a loci;

[0176] (ii) A mutant allele of one or more of the FT2a, FT2b, FT5a, or ELF3 loci that results in loss of expression of one or more proteins, and wild-type alleles at other FT2a, FT2b, FT5a, or ELF3 loci, wherein the combination of alleles is selected from:

[0177] a. Mutant alleles at the FT2a locus that cause loss of FT2a protein expression, and wild-type alleles at the FT2b, FT5a and ELF3 loci;

[0178] b. Mutant alleles at the FT2b locus that lead to loss of FT2b protein expression, and wild-type alleles at the FT2a, FT5a and ELF3 loci;

[0179] c. Mutant alleles at the FT5a locus leading to loss of FT5a protein expression, and wild-type alleles at the FT2a, FT2b, and ELF3 loci; and

[0180] d. Mutant alleles at the ELF3 locus that lead to loss of ELF3 protein expression, and wild-type alleles at the FT2a, FT2b, and FT5a loci;

[0181] (iii) A mutant allele at one or more of the FT2a, FT2b, FT5a, or ELF3 loci that results in partial expression of one or more proteins, and a mutant allele at one or more other FT2a, FT2b, FT5a, or ELF3 loci that results in partial expression of one or more other proteins, wherein the combination of alleles may be selected from:

[0182] a. Mutant alleles at the FT2a locus that cause partial expression of the FT2a protein, and one or more mutant alleles at the other FT2b, FT5a and ELF3 loci that cause partial expression of one or more other proteins;

[0183] b. Mutant alleles at the FT2b locus that cause partial expression of the FT2b protein, and one or more mutant alleles at the other FT2a, FT5a and ELF3 loci that cause partial expression of one or more other proteins;

[0184] c. Mutant alleles at the FT5a locus leading to partial expression of the FT5a protein, and one or more mutant alleles at other FT2a, FT2b, and ELF3 loci leading to partial expression of one or more other proteins; and

[0185] d. Mutant alleles at the ELF3 locus that cause partial expression of the ELF3 protein, and one or more mutant alleles at the other FT2a, FT2b, and FT5a loci that cause partial expression of one or more other proteins;

[0186] (iv) Mutant alleles at one or more of the FT2a, FT2b, FT5a, or ELF3 loci that result in loss of expression of one or more proteins, and mutant alleles at one or more other FT2a, FT2b, FT5a, or ELF3 loci that result in partial expression of one or more other proteins, wherein the combination of alleles may be selected from:

[0187] a. Mutant alleles at the FT2a locus that cause loss of FT2a protein expression, and one or more mutant alleles at the other FT2b, FT5a and ELF3 loci that cause partial expression of one or more other proteins;

[0188] b. Mutant alleles at the FT2b locus that cause loss of FT2b protein expression, and one or more mutant alleles at other FT2a, FT5a and ELF3 loci that cause partial expression of one or more other proteins;

[0189] c. Mutant alleles at the FT5a locus leading to loss of FT5a protein expression, and one or more mutant alleles at other FT2a, FT2b, and ELF3 loci leading to partial expression of one or more other proteins; and

[0190] d. Mutant alleles at the ELF3 locus that cause loss of ELF3 protein expression, and one or more mutant alleles at the other FT2a, FT2b, and FT5a loci that cause partial expression of one or more other proteins;

[0191] (v) Mutant alleles at one or more of the FT2a, FT2b, FT5a, or ELF3 loci that result in partial expression of one or more proteins, and mutant alleles at one or more other FT2a, FT2b, FT5a, or ELF3 loci that result in loss of expression of one or more other proteins, wherein the combination of alleles may be selected from:

[0192] a. Mutant alleles at the FT2a locus that cause partial expression of the FT2a protein, and one or more mutant alleles at the other FT2b, FT5a, and ELF3 loci that cause loss of expression of one or more other proteins;

[0193] b. Mutant alleles at the FT2b locus that cause partial expression of the FT2b protein, and one or more mutant alleles at other FT2a, FT5a and ELF3 loci that cause loss of expression of one or more other proteins;

[0194] c. Mutant alleles at the FT5a locus that cause partial expression of the FT5a protein, and one or more mutant alleles at other FT2a, FT2b, and ELF3 loci that cause loss of expression of one or more other proteins; and

[0195] d. Mutant alleles at the ELF3 locus leading to partial expression of the ELF3 protein, and one or more mutant alleles at other FT2a, FT2b, and FT5a loci leading to loss of expression of one or more other proteins; and

[0196] (vi) Mutant alleles at one or more of the FT2a, FT2b, FT5a, or ELF3 loci that cause loss of expression of one or more proteins, and mutant alleles at one or more other FT2a, FT2b, FT5a, or ELF3 loci that cause loss of expression of one or more other proteins, wherein the combination of alleles may be selected from:

[0197] a. Mutant alleles at the FT2a locus that cause loss of FT2a protein expression, and one or more mutant alleles at the other FT2b, FT5a and ELF3 loci that cause loss of expression of one or more other proteins;

[0198] b. Mutant alleles at the FT2b locus that cause loss of FT2b protein expression, and one or more mutant alleles at the other FT2a, FT5a and ELF3 loci that cause loss of expression of one or more other proteins;

[0199] c. Mutant alleles at the FT5a locus leading to loss of FT5a protein expression, and one or more mutant alleles at other FT2a, FT2b, and ELF3 loci leading to loss of expression of one or more other proteins; and

[0200] d. Mutant alleles at the ELF3 locus that cause loss of ELF3 protein expression, and one or more mutant alleles at the other FT2a, FT2b, and FT5a loci that cause loss of expression of one or more other proteins.

[0201] In various embodiments:

[0202] i. The wild-type FT2a, FT2b, FT5a and ELF3 genes are shown in SEQ ID NO: 10, 12, 14 and 16, respectively, and the amino acids they encode are shown in SEQ ID NO: 19, 21, 23 and 25, respectively;

[0203] ii. Specifically, the mutated FT2a gene is shown in SEQ ID NO: 11, and the encoded amino acid is shown in SEQ ID NO: 20;

[0204] iii. The mutated FT2b gene is shown in SEQ ID NO: 13, and the encoded amino acid is shown in SEQ ID NO: 22;

[0205] iv. The mutated FT5a gene is shown in SEQ ID NO:15, and the encoded amino acids are shown in SEQ ID NO:24; and

[0206] v. The mutated ELF3 genes are selected from SEQ ID NO: 17 and 18, and the amino acids encoded by each are shown in SEQ ID NO: 26 and 27, respectively.

[0207] The flowering time of soybean plants containing any of the above-described allele combinations is modified relative to the control plant. In a particular embodiment, the control plant contains a wild-type allele at each of FT2a, FT2b, FT5a, and ELF3. In other embodiments, the control plant contains a wild-type allele at the corresponding locus of any mutant allele, optionally wherein other alleles of the invention are mutant or wild-type.

[0208] As used herein, protein activity refers to the effect of the mentioned protein on flowering time and / or maturity time. Alleles causing complete loss of function encode mutant proteins that have no effect on flowering / maturation time. Alleles causing partial loss of function encode mutant proteins that have a reduced effect on flowering / maturation time relative to the wild-type unmutated protein.

[0209] This invention discloses novel FT2a, FT2b, FT5a, and ELF3 alleles generated using mutagenesis and genome editing techniques. The novel alleles are generated by deleting and / or substituting bases at positions corresponding to the wild-type alleles.

[0210] In the context of nucleic acid or amino acid sequences, the term "corresponding to" means that when nucleic acid or amino acid sequences are aligned to each other, the nucleic acid "corresponding to" certain enumerated positions in this invention is the one aligned to those positions in the reference sequence, but does not necessarily lie at those precise numerical positions relative to a specific nucleic acid or amino acid sequence of this invention. For example, an FT2b allele generated via mutation that includes a 4 bp deletion of the nucleotide coding sequence at positions 10-13 relative to SEQ ID NO: 12 means that when the nucleotide sequence of the wild-type allele (SEQ ID NO: 12) is aligned to the nucleotide sequence of the mutant allele (SEQ ID NO: 13), there is a 4 bp base pair vacancy at positions 10-13 of the wild-type sequence. In this example, the mutant allele overlaps with the wild-type allele before but not at position 10, and after but not at position 13. In another example, an FT5a mutant with a 1-bp insertion at nucleotide position 2 relative to SEQ ID NO: 14 means that the insertion occurs after nucleotide position 2 relative to SEQ NO: 14. In this example, the mutant and wild-type FT5a nucleotide sequences overlap at positions before and after the insertion, but not at the insertion site.

[0211] The best alignment of sequences for comparison can be performed using a computerized implementation of known algorithms or by visual inspection. Easily available sequence comparison and multiple sequence alignment algorithms include the Basic Local Alignment Search Tool (BLAST) and the ClustalW / ClustalW2 / Clustal Omega programs, which are available on the Internet (e.g., the EMBL-EBI website). Other suitable programs include, but are not limited to, GAP, BestFit, Plot Similarity, and FASTA, which are part of the Accelrys GCG software package available from Accelrys Corporation (San Diego, California, USA). See also Smith and Waterman, 1981; Needleman and Wunsch, 1970; Pearson and Lipman, 1988; Ausubel et al., 1988; and Sambrook and Russell, 2001.

[0212] In some embodiments, the alleles result in variants and fragments of the aforementioned FT2a, FT2b, FT5a, or ELF3 proteins, and when expressed in plants, plant parts, or seeds, these variants and fragments result in modified flowering time characteristics.

[0213] When expressed in plants, plant parts, or seeds, the alleles that result in protein fragments of FT2a, FT2b, FT5a, or ELF3 that modify flowering time characteristics include those shorter than the full-length sequence, either due to the use of an alternative downstream start site or due to processing that produces a shorter, active protein. Alleles encoding protein fragments that modify flowering time characteristics when expressed in plants can be polypeptides of length, for example, 10, 25, 50, 100, 150, 200, or 250 amino acids, of any one of SEQ ID NO: 27, 28, 30, 32, 34, 35, 36, 38, 39, 40, 41, 43, or 44. As used herein, fragments contain at least eight consecutive amino acids of SEQ ID NO: 27, 28, 30, 32, 34, 35, 36, 38, 39, 40, 41, 43, or 44.

[0214] Unless otherwise stated, identity and similarity will be calculated using the Needleman-Wunsch global alignment and scoring algorithm (Needleman and Wunsch (1970) J. Mol. Biol. [Molecular Biology Journal] 48(3):443-453), which is implemented as part of the "needle" program (Rice, P., Longden, I. and Bleasby, A., EMBOSS: The European Molecular Biology Open Software Suite, 2000, Trends in Genetics 16, (6) pp. 276-277, version 6.3.1, available from EMBnet (embnet.org / resource / emboss) and emboss.sourceforge.net, etc.), using the default vacancy penalty and scoring matrix (EBLOSUM62 for proteins and EDNAFULL for DNA). An equivalent program may also be used. "Equivalent procedure" refers to any sequence comparison procedure that, for any two sequences in question, generates an alignment with the same nucleotide residue match and the same percentage of sequence identity when compared to the corresponding alignment generated by needle in EMBOSS version 6.3.1.

[0215] Other mathematical algorithms are known in the art and can be used to compare two sequences. See, for example, the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA [Proceedings of the National Academy of Sciences] 87:2264, which is an improvement on that of Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA [Proceedings of the National Academy of Sciences] 90:5873-5877. Such algorithms are integrated into the BLAST program of Altschul et al. (1990) J. Mol. Biol. [Journal of Molecular Biology] 215:403. BLAST nucleotide searches can be performed using the following procedures: using the BLASTN program (a nucleotide query for searching nucleotide sequences) to obtain nucleotide sequences homologous to the nucleic acid molecules of the present invention, or using the BLASTX program (a nucleotide query for searching protein sequences for translation) to obtain protein sequences homologous to the nucleic acid molecules of the present invention. BLAST protein searches can be performed using the following procedures: the BLASTP procedure (searching for protein queries based on protein sequences) to obtain amino acid sequences homologous to the protein molecules of the present invention, or the TBLASTN procedure (searching for protein queries based on translated nucleotide sequences) to obtain nucleotide sequences homologous to the protein molecules of the present invention. For vacancy-free alignments for comparative purposes, Gapped BLAST (in BLAST 2.0) as described in Altschul et al. (1997) Nucleic Acids Res. 25:3389 can be used. Alternatively, iterative searches can be performed using PSI-Blast, which detects distant relationships between molecules. See Altschul et al. (1997), ibid. When using BLAST, Gapped BLAST, and PSI-Blast procedures, the default parameters of the corresponding procedures (e.g., BLASTX and BLASTN) can be used. Alignments can also be performed manually by checking.

[0216] When two sequences are aligned for similarity scoring using a defined amino acid or nucleotide substitution matrix (e.g., BLOSUM62), a vacancy presence penalty, and a vacancy expansion penalty (to achieve the highest possible score for the sequence pair), the two sequences are considered “best aligned.” Amino acid substitution matrices and their use in quantifying the similarity between two sequences are well known in the art and described, for example, in Dayhoff et al. (1978), “A model of evolutionary change in proteins,” in “Atlas of Protein Sequence and Structure,” Vol. 5, Supplement 3 (edited by MO Dayhoff), pp. 345-352. Natl. Biomed. Res. Found., Washington, DC. and Hemkoff et al. (1992), Proc. Natl. Acad. Sci. USA, 89: 10915-10919. The BLOSUM62 matrix is ​​commonly used as the default scoring substitution matrix in sequence alignment schemes. A penalty is applied for introducing a single amino acid vacancy in one of the aligned sequences, and a penalty is applied for vacancy expansion for each additional empty amino acid position in an already opened vacancy. Alignment is defined by the amino acid positions of each sequence at the start and end of the alignment, and optionally by inserting one or more vacancy positions in one or both sequences to achieve the highest possible score. While optimal alignment and scoring can be performed manually, the process is assisted by using computer-implemented alignment algorithms, such as gapped BLAST 2.0, described in Altschul et al. (1997) NucleicAcids Res. [Nucleic Acids Research] 25:3389-3402 and publicly available on the website of the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov). The best alignment, including multiple alignments, can be prepared using, for example, PSI-BLAST, which is available from www.ncbi.nlm.nih.gov and described by Altschul et al. (1997) Nucleic Acids Res. [Nucleic Acid Research] 25:3389-3402.

[0217] II. Gene Editing

[0218] The flowering time-related sequences (i.e., FT2a, FT2b, FT5a, or ELF3) provided in this paper can target the genome of recipient plant cells to generate novel allele sequences. Such methods include, but are not limited to, meganucleases designed for CRISPR-Cas9 targeting the target plant genome sequence, TALEN, and other technologies for precise genome editing (Feng et al., Cell Research 23: 1229-1232, 2013, WO 2013 / 026740); Cre-lox site-specific recombination; FLP-FRT recombination (Li et al. (2009), Plant Physiol 151:1087-1095); Bxbl-mediated integration (Yau et al., Plant J (2011) 701: 147-166); zinc finger-mediated integration (Wright et al. (2005), Plant J 44:693-705; Cai et al. (2009), Plant MolBiol). 69:699-709); and homologous recombination (Lieberman-Lazarovich and Levy (2011) Methods Mol Biol [Molecular Biology Methods]: 51-65); primer editing and transposases (Anzalone, A. et al., Nat Biotechnol. [Nature Biotechnology] 2020 July; 38(7):824-844); translocation; and inversion.

[0219] Various embodiments of the methods described herein utilize gene editing. In some embodiments, gene editing is used to mutate the genome of a plant to produce plants having novel alleles at the FT2a, FT2b, FT5a, and / or ELF3 loci that confer a modified flowering time. Novel alleles can be generated by targeted introduction of mutations at the FT2a, FT2b, FT5a, or ELF3 loci in the plant genome.

[0220] Editing can be achieved using an expression cassette. The expression cassette contains, in the 5'-3' transcriptional direction, a transcription and translation initiation region (i.e., promoter), a target polynucleotide, and a transcription and translation termination region (i.e., termination region) that functions in the target organism (i.e., plant or bacteria). The promoter of this invention is capable of directing or driving the transcription and expression of a coding sequence in a host cell. The regulatory regions (i.e., promoter, transcription regulatory region, and translation termination region) can be endogenous or heterologous to the host cell or to each other. As used herein, chimeric genes or chimeric nucleic acid molecules contain a coding sequence operatively linked to a transcription initiation region that is heterologous to that coding sequence.

[0221] A variety of transcription terminators are available for use in expression cassettes. These terminators are responsible for transcription termination outside of transgenes and proper mRNA polyadenylation. Termination regions can be naturally associated with the transcription initiator region, naturally associated with the DNA sequence to which the target is operatively linked, naturally associated with the host plant, or derived from another source (i.e., foreign or heterologous to the promoter, target DNA sequence, host plant, or any combination thereof). Suitable transcription terminators are those known to function in plants and include the CAMV pSOY1 terminator, the tml terminator, the carmine synthase terminator, and the pea rbcs E9 terminator. These terminators can be used in both monocotyledonous and dicotyledonous plants. Additionally, natural transcription terminators of the gene can be used. Termination regions used in expression cassettes can be obtained, for example, from Ti-plasmids of Agrobacterium tumefaciens, such as octopine synthase and carmine synthase terminators. See also Guerineau et al. (1991) Mol. Gen. Genet. [Molecular Genetics and General Genetics] 262: 141-144; Proudfoot (1991) Cell [Cell] 64:671-674; Sanfacon et al. (1991) Genes Dev. [Genes and Development] 5:141-149; Mogen et al. (990) Plant Cell [Plant Cell] 2: 1261-1272; Munroe et al. (1990) Gene [Genes] 91: 151-158; Ballas et al. (1989) Nucleic Acids Res. [Nucleic Acids Research] 17:7891-7903; and Joshi et al. (1987) Nucleic Acid Res. [Nucleic Acids Research] 15:9627-9639.

[0222] Other regulatory signals include, but are not limited to, transcription initiation sites, operons, activators, enhancers, other regulatory elements, ribosome binding sites, start codons, and termination signals. See, for example, U.S. Patents 5,039,523 and 4,853,331; EPO 0480762 A2; Sambrook et al. (1992) *Molecular Cloning: A Laboratory Manual*, edited by Maniatis et al. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York), hereinafter referred to as "Sambrook 11"; Davis et al. (1980).

[0223] In preparing expression cassettes, various DNA fragments can be manipulated to provide DNA sequences that are appropriately oriented and, where appropriate, form the appropriate reading frame. For this purpose, adaptors or linkers can be used to ligate the DNA fragments, or other manipulations can be involved to provide convenient restriction sites, remove excess DNA, or eliminate restriction sites. For this purpose, in vitro mutagenesis, primer repair, restriction, annealing, and re-substitution (e.g., conversion and transversion) can be employed.

[0224] Many promoters can be used in the practice of this invention. Promoters can be selected based on the desired results. Nucleic acids can be combined with constitutive, inducible, tissue-preferred, or other promoters for expression in a target organism. See, for example, the promoters shown below: WO 99 / 43838 and U.S. Patent Nos. 8,575,425; 7,790,846; 8,147,856; 8,586,832; 7,772,369; 7,534,939; 6,072,050; 5,659,026; 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463; 5,608,142; and 6,177,611; which are incorporated herein by reference. In some embodiments, the promoters used herein include exogenous promoters. The term "exogenous promoter" refers to a promoter that is not found in plants in nature, such as a synthetic promoter.

[0225] In some embodiments, this document provides plants transformed and expressed using the gene-editing machine described above, which, when hybridized with a target plant, result in gene editing occurring in the target plant.

[0226] Typically, gene editing may involve transient, inducible, or constitutive expression of gene-editing components or systems. Gene editing may also involve genomic integration or the presence of free copies of gene-editing components or systems.

[0227] Gene editing typically refers to the use of site-directed nucleases (including but not limited to CRISPR / Cas, zinc fingers, meganucleases, etc.) to shorten nucleotide sequences at desired locations. This can result in insertion / deletion (“indel”) mutations (i.e., “SDN1”), base editing (i.e., “SDN2”), or allele insertion or substitution (i.e., “SDN3”). SDN2 or SDN3 gene editing may include providing one or more recombinant templates (e.g., in a vector) containing a target gene sequence (i.e., to be introduced into the plant genome) that can be used for homology-directed repair (HDR) within the plant. In some embodiments, the target gene or allele is a gene or allele capable of conferring improved traits to the plant (e.g., modified flowering time characteristics). The recombinant template can be introduced into the plant, and editing can be performed using a donor plant containing the recombinant template through transformation or breeding. Breaks in the plant genome can be introduced into the interior, upstream, and / or downstream of the target sequence. In some embodiments, double-strand DNA breaks are generated inside or near the target sequence locus. In some embodiments, breaks are generated upstream and downstream of the target sequence locus, which can result in its excision from the genome. In some embodiments, one or more single-stranded DNA breaks (nicks) are generated within, upstream of, and / or downstream of the target sequence (e.g., using a Cas9 nickase variant). Any of these DNA breaks, as well as those introduced via other methods known to those skilled in the art, can induce HDR. With HDR, the target sequence is replaced by a sequence of a provided recombinant template containing the target allele, such as SEQ ID NO: 7, 10, 12, 14, 18, or 23, or a polynucleotide encoding a polypeptide having a sequence having any of SEQ ID NO: 26, 29, 31, 33, 37, and 42 may be provided on or as a template. This system is designed such that one or more single-stranded or double-stranded breaks are introduced into the interior, upstream of, and / or downstream of a corresponding region in a plant genome that does not contain the target gene sequence, which may be replaced by the template.

[0228] In the embodiments, the site-directed nuclease is selected from the group consisting of: mega-nuclease (MN), zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), Cas9 nuclease, Cfp1 nuclease, dCas9-Fokl, dCpf1-Fokl, chimeric Cas9-cytidine deaminase, chimeric Cas9-adenine deaminase, chimeric FEN1-Fokl, and Mega-TAL, nickase Cas9 (nCas9), chimeric dCas9 non-Fokl nuclease, and dCpfl non-Fokl nuclease.

[0229] In embodiments, editing is performed by transforming plant cells with an expression cassette comprising (i) a nucleic acid encoding a site-directed nuclease and (ii) a nucleic acid encoding at least one guide RNA (gRNA) targeting a target sequence. In embodiments of editing the expression cassette, the nucleic acid encoding the site-directed nuclease is operatively linked to a first promoter, while the nucleic acid encoding the at least one gRNA is operatively linked to a second promoter (which may be the same as or different from the first promoter). In some embodiments, the expression cassette may further comprise one or more additional regulatory elements, such as enhancers operatively linked to the first or second promoter.

[0230] In some embodiments, mutations in the target gene or wild-type allele described herein can be generated by targeted introduction of DNA double-strand breaks without the use of a recombination template. Such breaks can be repaired by a non-homologous end joining (NHEJ) process, which may result in small insertions or deletions (indels) at the repair site. Such indels may lead to frameshift mutations, causing premature stop codons or other types of loss-of-function mutations in the target gene.

[0231] In some embodiments, gene editing may involve transient, inducible, or constitutive expression of gene-editing components or systems in the target plant. Gene editing may also involve genomic integration or the presence of free forms of gene-editing components or systems in the target plant.

[0232] In some embodiments, nucleic acid modification or mutation is achieved by a (modified) zinc finger nuclease (ZFN) system. The ZFN system uses an artificial restriction endonuclease generated by fusing a zinc finger DNA-binding domain with a DNA-cutting domain, which can be engineered to target a desired DNA sequence. Exemplary methods for genome editing using ZFNs can be found, for example, in: U.S. Patent Nos. 6,534,261; 6,607,882; 6,746,838; 6,794,136; 6,824,978; 6,866,997; 6,933,113; and 6,979,539.

[0233] In some embodiments, nucleic acid modification is achieved by a (modified) meganuclease, which is a deoxyribonuclease characterized by a large recognition site (a double-stranded DNA sequence of 12 to 40 base pairs). Exemplary methods using meganucleases can be found in: U.S. Patent Nos. 8,163,514; 8,133,697; 8,021,867; 8,119,361; 8,119,381; 8,124,369; and 8,129,134, which are incorporated herein by reference in particular.

[0234] In some embodiments, nucleic acid modification is achieved by a (modified) CRISPR / Cas complex or system. In some embodiments, the CRISPR / Cas system or complex is a type II CRISPR / Cas system. In some embodiments, the CRISPR / Cas system or complex is a type II, type V, or type VI CRISPR / Cas system or complex. CRISPR / Cas systems do not require the generation of custom proteins to target specific sequences; instead, a single Cas protein can be programmed via an RNA-guided sequence (gRNA) to recognize a specific nucleic acid target. In other words, the short RNA-guided sequence can be used to recruit the Cas enzyme protein to a specific target nucleic acid locus (which may contain or be composed of RNA and / or DNA).

[0235] Generally, CRISPR / Cas or CRISPR systems, as used in the literature described above, refer to transcripts and other elements involved in the expression of CRISPR-related (“Cas”) genes or directing their activity, including sequences encoding Cas genes and one or more of the following: tracr (trans-activating CRISPR) sequences (e.g., tracrRNA or active portion tracrRNA), tracr-pairing sequences (in the context of endogenous CRISPR systems, containing “homogeneous repeat sequences” and tracrRNA-treated partial homogeneous repeat sequences), directing sequences (also referred to as “spacers” in the context of endogenous CRISPR systems), or one or more of the term “RNA” as used herein (e.g., one or more RNAs for directing Cas such as Cas9, such as CRISPRRNA and, where applicable, trans-activating (tracr) RNA or single directing RNA (sgRNA) (chimeric RNA)) or other sequences and transcripts from CRISPR loci. Typically, CRISPR systems are characterized by elements that promote the formation of the CRISPR complex at the site of the target sequence (also referred to as prototypical spacers in the context of endogenous CRISPR systems). In the formation of a CRISPR complex, the "target sequence" refers to a sequence to which the guide sequence is designed to be complementary, where hybridization between the target sequence and the guide sequence promotes the formation of the CRISPR complex. The target sequence can contain any polynucleotide, such as DNA or RNA polynucleotides.

[0236] In some embodiments, the gRNA is a chimeric guide RNA or a single guide RNA (sgRNA). In some embodiments, the gRNA comprises a guide sequence and a tracr pairing sequence (or a direct repeat sequence). In some embodiments, the gRNA comprises a guide sequence, a tracr pairing sequence (or a direct repeat sequence), and a tracr sequence. In some embodiments, the CRISPR / Cas system or complex as described herein does not contain and / or is independent of the presence of the tracr sequence (e.g., if the Cas protein is Cas12a).

[0237] As mentioned herein, Cas proteins, such as but not limited to Cas9, Cas12a (formerly known as Cpf1), Cas12b (formerly known as C2c1), Cas13a (formerly known as C2c2), C2c3, and Cas13b, can be derived from any suitable source and thus can include different orthologs from a variety of (prokaryotic) organisms, as well as well described in the art. In some embodiments, the Cas protein is (modified) Cas9, preferably (modified) Staphylococcus aureus Cas9 (SaCas9) or (modified) Streptococcus pyogenes Cas9 (SpCas9). In some embodiments, the Cas protein is Cas12a, optionally derived from an aminococcal species, such as aminococcal species BV3L6 Cpf1 (AsCas12a), or a spirochete Cas12a, such as spirochete MA2020 or spirochete MD2006 (LBCas12a). See U.S. Patent No. 10,669,540, which is incorporated herein by reference in its entirety. Alternatively, the Cas12a protein may be derived from *Moraxella bovoculi* AAX08_00205 [Mb2Cas12a] or *Moraxella bovoculi* AAX11_00205 [Mb3Cas12a]. See also WO 2017 / 189308, which is incorporated herein by reference in its entirety. In some embodiments, the Cas protein is a (modified) C2c2, preferably *Leptotrichia wadei* C2c2 (LwC2c2) or *Listeria newyorkensis* FSL M6-0635 C2c2 (LbFSLC2c2). In some embodiments, the (modified) Cas protein is C2c1. In some embodiments, the (modified) Cas protein is C2c3. In some embodiments, the (modified) Cas protein is Cas13b. Other Cas enzymes are available to those skilled in the art.

[0238] Gene editing methods and compositions are also disclosed in U.S. Patent Nos. 10,519,456 and 10,285,348,82, the entire contents of which are incorporated herein by reference.

[0239] Gene-editing machinery introduced into plants (e.g., DNA-modifying enzymes) can be controlled by any promoter capable of driving the expression of recombinant genes in plants. In some embodiments, the promoter is a constitutive promoter. In some embodiments, the promoter is a tissue-specific promoter, such as a pollen-specific promoter or a sperm cell-specific promoter, a conidia-specific promoter, or a promoter highly expressed in sperm, eggs, and conidia (e.g., prOsActin1). Suitable promoters are disclosed in U.S. Patent No. 10,519,456, the entire contents of which are incorporated herein by reference.

[0240] In another aspect, this document provides methods for editing plant genomic DNA. In some embodiments, the method includes pollinating a target plant containing genomic DNA to be edited using a first soybean plant expressing a DNA-modifying enzyme and at least one optional guide nucleic acid as described above. In some embodiments, methods for generating novel alleles and allele combinations include editing at one or more of the FT2a, FT2b, FT5a, and / or ELF3 loci in the soybean plant genome via a site-directed nuclease.

[0241] III. Select plants with novel alleles and improved traits.

[0242] In addition to phenotypic traits, genetic characteristics of plants, represented by genetic markers, can be used to select plants with desired traits. The term "marker-based selection" refers to the use of genetic markers to detect one or more nucleic acids in a plant that are associated with a desired trait, in order to identify plants carrying the gene or allele of the desired (or undesired) trait. Markers include, but are not limited to, restriction fragment length polymorphism (RFLP), random amplified polymorphic DNA (RAPD), random primer polymerase chain reaction (AP-PCR), DNA amplification fingerprinting (DAF), sequence signature amplified region (SCAR), amplified fragment length polymorphism (AFLP), simple sequence repeats (SSR) (also known as microsatellites), and single nucleotide polymorphisms (SNPs). A number of publicly available markers are known to be under investigation by ASTA and other industry organizations under the US Plant Variety Protection Act, studying their applicability in standardization to determine what constitutes a basic derivative variety. However, these standard markers do not limit the types of markers and marker characteristics that can be used for breeding or developing backcross transformations, or for distinguishing varieties, plant parts or plant cells, or for verifying progeny lineages. Primers and PCR protocols used to determine these and other markers are disclosed at Soybase (funded by the USDA Agricultural Research Service and Iowa State University) at 129.186.26.94 / SSR.html on the World Wide Web.

[0243] As used herein, the term "associated with" refers to an identifiable and / or detectable relationship between two entities. For example, the phrase "associated with modified flowering time" means that the presence or absence of a trait, locus, gene, allele, marker, phenotype, or its expression product can influence or indicate the range and / or extent of variation in flowering time and / or maturity values ​​exhibited by plants or their progeny compared to control plants. Therefore, a marker is "associated" with a trait when it is linked to it and when the presence of the marker indicates whether and / or to what extent the desired trait or trait form will occur in the plant / germplasm containing the marker. Similarly, a marker is "associated" with an allele when it is linked to it and when the presence (or absence) of the marker indicates the presence (or absence) of the allele in the plant, germplasm, or population containing the marker. For example, “markers associated with novel FT2a, FT2b, FT5a, or ELF3 alleles that confer modified flowering time characteristics” refers to such markers, the presence or absence of which can be used to determine whether these novel alleles are present in the plant, and / or to what extent the plant will exhibit altered flowering time compared to control plants.

[0244] The term "one or more alleles" refers to any one of one or more alternative forms of a gene, all of which are associated with at least one trait or characteristic. In diploid cells, the two alleles of a given gene occupy corresponding loci on homologous chromosome pairs.

[0245] The term “genotype” and its variants refer to the genetic components of an organism, including, for example, whether a diploid organism is heterozygous (i.e., has two distinct alleles for a given gene or QTL) or homozygous (i.e. has the same alleles for a given gene or QTL) for one or more genes or loci (e.g., SNPs, haplotypes, gene mutations, insertions, or deletions).

[0246] In one embodiment, the marker used to identify plants containing the alleles disclosed herein is an SNP. Non-limiting examples of SNP genotyping methods include hybridization, primer extension, oligonucleotide ligation, nuclease cutting, microsequencing, and coded spheres. Such methods are well known and disclosed in, for example, Gut, IG, Hum. Mutat. [Human Mutation] 17: 475-492 (2001); Shi, Clin. Chem. [Clinical Chemistry] 47(2): 164-172 (2001); Kwok, Pharmacogenomics [Pharmacogenomics] 1(1): 95-100 (2000); and Bhattramakki and Rafalski, Discovery and application of single nucleotide polymorphism markers in plants, PLANTGENOTYPING: THE DNA FINGERPRINTING OF PLANTS, CABI Publishing, Wallingford (2001). A wide range of commercially available technologies utilize these and other methods to query SNPs, including Masscode Sup™ / Sup (Qiagen, Germantown, MD), Hologic, Madison, Wisconsin, Applied Biosystems, Foster City, CA), and Beadarrays Sup™ / Sup (Illumina, San Diego, CA).

[0247] In some embodiments, assays (e.g., typically a two-step allele identification assay or similar assay), KASPSup™ / Sup assays (typically a one-step allele identification assay or similar assay as defined below), or both can be used to identify SNPs associated with a modified flowering time trait. In an exemplary two-step assay, a forward primer, a reverse primer, and two assay probes are employed to identify two distinct alleles (or hybrid oligonucleotides) at the SNP site. The forward and reverse primers are used to amplify a genetic locus containing an SNP associated with a modified flowering time (FT) trait. The specific nucleotide present at the SNP site is then determined using the probes. In some embodiments, the assay probes and reaction conditions are designed such that the assay probes hybridize only with the reverse complement of a 100% perfectly matching sequence, thereby allowing for hybridization-based detection to identify which alleles(s) are present. In some embodiments, the probes are differentially labeled, for example, with fluorophores to distinguish the two assay probes in a single reaction. Exemplary methods for amplification include using polymerase chain reaction (PCR) or ligase chain reaction (LCR), using nucleic acids isolated from soybean plants or germplasm as templates in PCR or LCR.

[0248] In some embodiments, a haplotype of any particular genotype can be described using multiple SNP alleles, either within a sequence or across linked sequences. (Ching et al., BMC Genet. [BMC Genetics] 3: 19 (2002) (p. 14); Gupta et al., (2001) Curr Sci. [Contemporary Science] 80:524-535; Rafalski, Plant Sci [Plant Science] 162: 329-333 (2002).) In some cases, a haplotype can be more informative than a single SNP and can describe any particular genotype in more detail. For example, for a particular disease-resistant line or variety, a single SNP might be the allele “T,” but the allele “T” can also appear in soybean breeding populations used for recurrent parents. In this case, a combination of alleles of linked SNPs can be more informative. Once a unique haplotype is assigned to a donor chromosomal region, that haplotype can be used in that population or any subpopulation to determine whether an individual possesses a particular gene. The method is efficient and effective because it utilizes an automated high-throughput marker detection platform known to those skilled in the art.

[0249] These SNP markers can be used in marker-assisted breeding programs to transfer traits (such as naturally occurring traits, transgenic traits, or traits conferred by genome editing) into a desired plant background. As used herein, the term "natural trait" refers to a trait already present in the germplasm, including wild relatives of a crop species, or traits that can be generated through recombination of existing traits. For example, progeny plants from a cross between a donor soybean plant containing a nucleic acid sequence encoding an allele of SEQ ID NO: 8, 9, 11, 13, 15, 16, 17, 19, 20, 21, 22, 24, or 25 in its genome and a recipient soybean plant not containing said nucleic acid sequence can be screened to detect the presence of markers associated with modified FT characteristics. Plants containing said markers can be selected, and their modified FT characteristics compared to control plants can be verified.

[0250] IV. Plant Transformation

[0251] Once the gene-editing cassette has been cloned into the expression system, it is transformed into plant cells. The receptor and target expression cassettes of the present invention can be introduced into plant cells in a variety of technically recognized manners. In the case of polynucleotides (e.g., target nucleotide constructs), the term "introduction" is intended to mean the presentation of the polynucleotide into the plant in a manner that allows it to enter the plant cell. In cases where more than one polynucleotide is to be introduced, these polynucleotides may be assembled as part of a single nucleotide construct or as separate nucleotide constructs, and may be located on the same or different transformation vectors. Thus, these polynucleotides can be introduced into the target host cell in a single transformation event, in a separate transformation event, or, for example, as part of a breeding program in the plant. The method of the present invention does not depend on a specific method for introducing one or more polynucleotides into the plant, as long as the one or more polynucleotides enter at least one cell of the plant. Methods for introducing polynucleotides into plants are known in the art, including but not limited to transient transformation methods, stable transformation methods, and virus-mediated methods.

[0252] In the case of polynucleotides, "transient conversion" refers to the introduction of polynucleotides into a plant without their integration into the plant's genome.

[0253] In the context of polynucleotides introduced into plants, "stably introducing" or "stably introduced" means that the introduced polynucleotide is stably incorporated into the plant genome, and therefore the plant is stably transformed with the polynucleotide.

[0254] "Stable transformation" or "stable transformation" is intended to mean that a polynucleotide introduced into a plant (e.g., the nucleotide construct described herein) is integrated into the plant's genome and is inherited by its offspring, and more particularly, by offspring across multiple successive generations.

[0255] A variety of transformation vectors that can be used for plant transformation are known to those skilled in the art of plant transformation, and the gene relating to this invention can be used in combination with any such vector. The choice of vector will depend on the preferred transformation technique and the target species for transformation. For certain target species, different antibiotic or herbicide selective markers may be preferred. Selection markers commonly used in transformation include the nptll gene, which confers resistance to kanamycin and related antibiotics (Messing & Vierra Gene [Gene] 19: 259-268 (1982); Bevan et al., Nature [Nature] 304:184-187 (1983)); the pat and bar genes, which confer resistance to the herbicide glufosinate (also known as glufosinate-ammonium) (see White et al., Nucl. Acids Research [Nucleic Acids Research] 18: 1062 (1990); Spencer et al., Theor. Appl. Genet [Theoretical and Applied Genetics] 79: 625-631 (1990) and US Patent Nos. 5,561,236 and 5,276,268); and the hph gene, which confers resistance to the antibiotic hygromycin (Blochinger & Diggelmann, Mol. CellBiol. [Molecular Cell Biology] 4: 2929-2931), and the dhfr gene that confers resistance to methotrexate (Bourouis et al., EMBO J. [Journal of the European Society for Molecular Biology] 2(7): 1099-1104 (1983)), the EPSPS gene that confers resistance to glyphosate (US Patent Nos. 4,940,935 and 5,188,642), the glyphosate N-acetyltransferase (GAT) gene that also confers resistance to glyphosate (Castle et al. (2004) Science, 304:1151-1154; US Patent Application Publication Nos. 20070004912, 20050246798 and 20050060767); and the mannose-6-phosphate isomerase gene that provides the ability to metabolize mannose (US Patent Nos. 5,767,378 and 5,994,629).

[0256] Methods for plant regeneration are also well known in the art. For example, Ti plasmid vectors, as well as direct DNA uptake, liposomes, electroporation, microinjection, and microprojectiles have been used to deliver foreign DNA. Furthermore, bacteria from the genus *Agrobacterium* can be used to transform plant cells. The following is a description of representative techniques for transforming both dicotyledonous and monocotyledonous plants, along with representative plasmid transformation techniques.

[0257] For transformation using Agrobacterium tumefaciens, many vectors are available. These typically carry at least one T-DNA boundary sequence and include vectors such as pBIN19 (Bevan, Nucl. Acids Res. [Nucleic Acid Research] (1984)). For the construction of vectors useful in Agrobacterium transformation, see, for example, U.S. Patent Application Publication No. 2006 / 0260011, which is incorporated herein by reference.

[0258] Transformation without the use of Agrobacterium tumefaciens avoids the need for T-DNA sequences in the chosen transformation vector, and therefore, vectors lacking these sequences can be used in addition to those containing T-DNA sequences as described above. Agrobacterium-independent transformation techniques include transformation via particle bombardment, protoplast uptake (e.g., PEG and electroporation), and microinjection. The choice of vector depends largely on the preference for the species being transformed. For the construction of such vectors, see, for example, U.S. Patent Application No. 20060260011, which is incorporated herein by reference.

[0259] Transformation techniques for dicotyledonous plants are well known in the art and include both Agrobacterium-based and Agrobacterium-free techniques. Non-Agrobacterium techniques involve the direct uptake of exogenous genetic material by protoplasts or cells. This can be accomplished via PEG or electroporation-mediated uptake, particle bombardment-mediated delivery, or microinjection. Examples of these techniques are described in: Paszkowski et al., EMBO J. [Journal of the European Society for Molecular Biology] 3: 2717-2722 (1984), Potrykus et al., Mol. Gen. Genet. [Molecular Genetics and General Genetics] 199: 169-177 (1985), Reich et al., Biotechnology [Biotechnology] 4: 1001-1004 (1986), and Klein et al., Nature [Nature] 327: 70-73 (1987). In each case, the transformed cells are regenerated into a whole plant using standard techniques known in the art.

[0260] Agrobacterium-mediated transformation is the preferred technique for the transformation of dicotyledonous plants due to its high transformation efficiency and wide applicability to many different species. Agrobacterium transformation typically involves the transfer of a binary vector (e.g., pCIB200 or pCIB2001) carrying the target exogenous DNA into a suitable Agrobacterium strain. This binary vector can rely on a complement of a vir gene carried by the host Agrobacterium strain (e.g., CIB542 strain used for pCIB200 and pCIB2001 (Uknes et al. Plant Cell 5: 159-169 (1993))) or on a co-resident Ti plasmid or on a chromosome. The transfer of the recombinant binary vector to Agrobacterium is achieved by using a three-parental hybridization method with Escherichia coli carrying the recombinant binary vector and an auxiliary E. coli strain carrying a plasmid (e.g., pRK2013) capable of moving the recombinant binary vector into the target Agrobacterium strain. Alternatively, the recombinant binary vector can be transferred into Agrobacterium via DNA transformation (Hofgen and Willmitzer, Nucl. Acids Res. [Nucleic Acid Research] 16: 9877 (1988)).

[0261] Transformation of target plant species via recombinant Agrobacterium typically involves co-culturing the Agrobacterium with explants from that plant, following protocols well-known in the art. The transformed tissues are then regenerated on a selective medium carrying antibiotic markers, located between the boundaries of the binary plasmid T-DNA.

[0262] Another method for gene-transforming plant cells involves advancing inert or bioactive particles onto plant tissues and cells. This technique is disclosed in U.S. Patent Nos. 4,945,050, 5,036,006, and 5,100,792 (all belonging to Sanford et al.). Generally, this method involves advancing inert or bioactive particles onto cells under conditions that allow them to effectively penetrate the outer surface of the cell and provide incorporation into its interior. When using inert particles, these particles can be introduced into the cell by coating them with a vector containing the desired gene. Alternatively, the target cell can be surrounded by a vector so that the vector is carried into the cell by the tail of the particle. Bioactive particles (e.g., dry yeast cells, dry bacteria, or bacteriophages, each containing the DNA to be introduced) can also be advanced into plant cell tissues.

[0263] Transformation of most monocotyledonous plant species has now become routine. Preferred techniques include direct transfer of genes into protoplasts using PEG or electroporation, and particle bombardment into callus. Transformation can be performed with a single DNA species or multiple DNA species (i.e., co-transformation), and both techniques are suitable for use in this invention. Co-transformation can have the advantages of avoiding the construction of intact vectors and generating transgenic plants with non-sex-linked loci containing the target gene and a selective marker, allowing for the removal of the selective marker in subsequent generations (if this is considered desirable). However, a disadvantage of using co-transformation is that the isolated DNA species are integrated into the genome at a frequency of less than 100% (Schocher et al., Biotechnology 4: 1093-1096 (1986)).

[0264] Patent applications EP 0 292 435, EP 0 392 225, and WO 93 / 07278 describe techniques for preparing callus and protoplasts from improved inbred maize varieties, transforming protoplasts using PEG or electroporation, and regenerating maize plants from transformed protoplasts. Gordon-Kamm et al. (Plant Cell 2: 603-618 (1990)) and Fromm et al. (Biotechnology 8: 833-839 (1990)) have disclosed techniques for transforming maize varieties derived from A188 using particle bombardment. Furthermore, WO 93 / 07278 and Koziel et al. (Biotechnology 11: 194-200 (1993)) describe techniques for transforming improved inbred maize varieties by particle bombardment. This technology utilizes 1.5-2.5 mm long immature maize embryos removed from the maize ears 14-15 days after pollination, along with a PDS-1000He Biolistics device for bombardment.

[0265] Transformation of monocotyledonous plants using Agrobacterium has also been described. See WO 94 / 00977 and U.S. Patent No. 5,591,616, both of which are incorporated herein by reference. See also Negrotto et al., Plant Cell Reports 19: 798-803 (2000), which is incorporated herein by reference.

[0266] Genetic traits engineered into the aforementioned genome edits or transgenic seeds and plants are transferred through sexual reproduction or vegetative growth, and can thus be maintained and propagated in offspring plants. Typically, maintenance and propagation utilize known agricultural methods, developed to suit specific purposes such as cultivation, sowing, or harvesting.

[0267] The advantageous genetic characteristics of genome-edited or transgenic plants and seeds according to the present invention can be further utilized in plant breeding. Different breeding measures are taken depending on the desired characteristics. Related techniques are well known in the art and include, but are not limited to: hybridization, inbreeding, backcrossing, multiline breeding, variety blending, interspecific hybridization, aneuploidy techniques, etc. Therefore, genome-edited or transgenic seeds and plants according to the present invention can be used for breeding improved plant lines (e.g., increasing the geographical range of cultivation).

[0268] Many suitable transformation methods using appropriate selection markers (such as kanamycin), binary vectors (such as those from Agrobacterium), and plant regeneration (such as from tobacco leaf discs) are well known in the art.

[0269] V. Establish breeding areas based on altered flowering time characteristics.

[0270] Methods are provided for determining where plants with genome editing at one or more of the FT2a, FT2b, FT5a, or ELF3 loci should be bred. Specifically, these methods are capable of determining where soybean plants or their seeds should be grown, wherein the soybean plant has genome editing at one or more of the FT2a, FT2b, FT5a, or ELF3 loci, resulting in novel allele combinations that differ from the allele combinations of a control plant containing wild-type alleles. The methods require identifying specific allele combinations and then comparing the altered flowering time produced by those specific allele combinations. In example embodiments, specifying a change in flowering time includes specifying the duration (e.g., hours, days, or weeks) of the change in flowering time (e.g., earlier or later) of the soybean plant relative to a control plant. For example, an allele combination resulting in a flowering time of 50 days compared to a control plant with a flowering time (e.g., the duration from VE to R1) of 45 days specifies a change in flowering time (particularly earlier) of 5 days (50-45) or 120 hours (5x24). In some embodiments, an advance of 5 days is associated with a defined transition to the relative maturity group. In other embodiments, an advance of 10 days is associated with a defined transition to the relative maturity group. However, it will be understood that the relationship between the degree and direction of change in flowering time and the change in the relative maturity group may not be linear and may be based on other factors such as ambient weather conditions (e.g., temperature and humidity), cultivation location (indoor or outdoor), frequency of watering and chemical treatments, etc.

[0271] As a first non-limiting example, the variation in flowering time from a first time of about 90-100 days to a second time of about 87-97 days (e.g., 87 to 95 days) can be correlated with the variation in maturity group from RM 5.5 to RM 5.

[0272] As a second non-limiting example, the variation in flowering time from a first time of about 90-100 days to a second time of about 83-84 days can be correlated with the variation in maturity group from RM 5.5 to RM 4.

[0273] As a third non-limiting example, the variation in flowering time from a first time of about 90-100 days to a second time of about 70-72 days can be correlated with the variation in maturity group from RM 5.5 to RM 3.

[0274] As a fourth non-limiting example, the variation in flowering time from a first time of about 90-100 days to a second time of about 58-62 days can be correlated with the variation in maturity group from RM 5.5 to RM 2.

[0275] As a fifth non-limiting example, the variation in flowering time from a first time of about 90-100 days to a second time of about 43-44 days can be associated with the variation in maturity group from RM 5.5 to RM 0 or RM 1.0.

[0276] As a sixth non-limiting example, the variation in flowering time from a first time of about 90-100 days to a second time of about 37-41 days can be correlated with the variation in maturity group from RM 5.5 to RM 00.

[0277] As a seventh non-limiting example, the variation in flowering time from a first time of about 90-100 days to a second time of about 30-31 days can be correlated with the variation in maturity group from RM 5.5 to RM 000.

[0278] In an embodiment, the altered flowering time can be used to establish an altered maturity value or relative maturity group for the edited plant. Based on the change in flowering time, a geographic region (e.g., latitude, temperature region, etc.) can be selected. In an embodiment, selecting a region can further include determining whether the plant is grown indoors (e.g., in a greenhouse) or outdoors (e.g., in a field).

[0279] As an example, based on allele combinations, soybean plants can transition from growing in a first region to growing in a second region. As used herein, transitioning plant growth from a first region to a second region means that the edited plant can additionally or optionally grow in the second region, while the unedited control plant (from which the edited plant is derived or relative to its measured flowering time change) continues to grow only in the first region, and wherein the control plant cannot grow in the second region.

[0280] As an example, based on allele combinations, edited non-naturally occurring soybean plants can transition from growing in a first region between 40°N and 50°N (e.g., between 40°N and 45°N, or between 45°N and 50°N) to growing in a second region between 30°N and 40°N (e.g., between 30°N and 35°N, or between 35°N and 40°N) or between 20°N and 30°N (e.g., between 20°N and 25°N, or between 25°N and 30°N). As another example, based on allele combinations, edited non-naturally occurring soybean plants can transition from growing in a first region between 30°N and 40°N (e.g., between 30°N and 35°N, or between 35°N and 40°N) to growing in a second region between 20°N and 30°N (e.g., between 20°N and 25°N, or between 25°N and 30°N). Here, the transition is from regions with longer daylight hours to regions with shorter daylight hours. In a particular embodiment, the transition to regions with shorter daylight hours can be achieved by increasing the allele combination of the flowering time of the edited plant relative to the control plant.

[0281] As an example, based on allele combinations, edited non-naturally occurring soybean plants can transition from growing in a first region between 20°N and 30°N (e.g., between 20°N and 25°N, or between 25°N and 30°N) to growing in a second region between 30°N and 40°N (e.g., between 30°N and 35°N, or between 35°N and 40°N) or between 40°N and 50°N (e.g., between 40°N and 45°N, or between 45°N and 50°N). As another example, based on allele combinations, edited non-naturally occurring soybean plants can transition from growing in a first region between 30°N and 40°N (e.g., between 30°N and 35°N, or between 35°N and 40°N) to growing in a second region between 40°N and 50°N (e.g., between 40°N and 45°N, or between 45°N and 50°N). Here, the transition is from regions with shorter daylight hours to regions with longer daylight hours. In a particular embodiment, the transition to regions with longer daylight hours can be achieved by reducing the allele combination of the edited plant's flowering time compared to the control plant.

[0282] An example embodiment of a method for determining where a soybean plant or its seeds should be grown includes: (a) introducing mutations at the FT2a, FT2b, FT5a, or ELF3 loci of the soybean plant genome via genomic modification using site-directed nucleases; (b) self-pollinating the plants for one or more generations to generate progeny plants that are homozygous at each of the FT2a, FT2b, FT5a, and ELF3 loci; (c) obtaining DNA from the progeny plants; (d) determining the allelic combination of the progeny plants via a first determination of DNA indicating the type of mutation introduced at one of the FT2a, FT2b, FT5a, or ELF3 loci and a second, optionally subsequent determination of DNA indicating the type of mutation introduced at a second, and optionally subsequent, FT2a, FT2b, FT5a, or ELF3 loci; and (e) specifying a variation in flowering time of the plant based on the determined allelic combination, wherein the variation in flowering time is relative to a control plant that does not contain the allelic combination.

[0283] Another example embodiment of the method includes editing at two or more loci (FT2a, FT2b, FT5a, or ELF3) in the soybean plant genome via site-directed nucleases; isolating DNA from the edited progeny of the soybean plant; determining the allele combination of the edited progeny plant via a first DNA assay indicating the type of mutation introduced at one locus and a second, optionally subsequent, DNA assay indicating the type of mutation introduced at a second locus; and specifying a change in flowering time of the progeny based on the determined allele combination, wherein the change in flowering time is relative to a control plant that does not contain the allele combination.

[0284] Another embodiment of the method includes editing at least first and second endogenous FT2a, FT2b, FT5a, and / or ELF3 genes in the genome of a soybean plant; self-pollinating the plant for one or more generations to generate progeny plants homozygous edited at at least first and second endogenous FT2a, FT2b, FT5a, or ELF3 loci; obtaining DNA from the progeny plants; determining the allele combination of the progeny plants via a first determination of DNA indicating the type of mutation introduced at the first edited locus and a second determination of DNA indicating the type of mutation introduced at the second edited locus; and specifying a change in flowering time of the plant based on the determined allele combination, wherein the change in flowering time is relative to a control plant that does not contain the allele combination.

[0285] Another example embodiment of a method for determining where soybean plants or their seeds should grow includes: a. introducing mutations at the FT2a, FT2b, FT5a, and / or ELF3 loci of the soybean plant genome via site-directed nuclease modification; b. self-pollinating the plants for one or more generations to generate progeny plants in which the mutation at each mutated locus is homozygous; c. obtaining DNA from the progeny plants; d. determining the allelic combination of the progeny plants via a determination indicating the mutation introduced at each of the mutated loci; and e. assigning variations in flowering time and / or maturity time to the progeny plants based on the determined allelic combination, wherein the variations in flowering time and / or maturity time are relative to control plants that do not contain the determined allelic combination. In a particular embodiment, the mutation includes:

[0286] In embodiments, the process includes transforming plant cells with an expression cassette comprising: (i) a nucleic acid encoding the site-directed nuclease; and (ii) a nucleic acid encoding at least one guide RNA (gRNA) targeting a target sequence at the FT2a, FT2b, FT5a, and / or ELF3 loci. In some instances, the nucleic acid encoding the site-directed nuclease is operatively linked to a first promoter of the expression cassette, and the nucleic acid encoding the at least one gRNA is operatively linked to a second promoter of the expression cassette, wherein the first and second promoters are different promoter sequences or have a common promoter sequence. In embodiments, the expression cassette further comprises an enhancer operatively linked to the first or second promoter for enhancing transcription of the sequence operatively linked to the promoter. As a non-limiting example, the site-directed nuclease is selected from the group consisting of: mega-nucleases (MN), zinc finger nucleases (ZFN), transcription activator-like effector nucleases (TALEN), Cas9 nucleases, Cfp1 nucleases, dCas9-Fokl, dCpf1-Fokl, chimeric Cas9-cytidine deaminase, chimeric Cas9-adenine deaminase, chimeric FEN1-Fokl, and Mega-TAL, nickase Cas9 (nCas9), chimeric dCas9 non-Fokl nucleases, and dCpfl non-Fokl nucleases. In some instances, mutations introduced into the FT2a, FT2b, FT5a, and / or ELF3 loci are selected from the group consisting of: allelic substitutions, one or more base insertions, and one or more base deletions.

[0287] In embodiments, the progeny plants have modified flowering and / or maturity times relative to the control plants, and wherein the control plants contain wild-type alleles at each of the corresponding FT2a, FT2b, FT5a, or ELF3 loci. In some instances, specifying variations in flowering and / or maturity times includes specifying the number of days that the flowering and / or maturity times of the progeny plants are shortened relative to the control plants. In specific embodiments, specifying variations in flowering time includes a reduction in the number of days between the VE and R1 phases of the progeny plants relative to the control plants, and / or wherein specifying variations in maturity time includes a reduction in the number of days between the R1 and R7 or R8 phases of the progeny plants relative to the control plants.

[0288] In an embodiment, introducing mutations further includes regenerating transformed T0 plants from transformed plant cells, the transformed T0 plants having multiple T1 seeds, wherein the multiple T1 seeds contain multiple unique edits at the FT2a, FT2b, FT5a and / or ELF3 loci; growing multiple T1 plants from the T1 seeds; and self-pollinating the T1 plants for one or more generations to obtain progeny plants that are homozygous for the mutations introduced at the respective loci, wherein determining the allele combination includes sequencing the FT2a, FT2b, FT5a and / or ELF3 loci of the progeny plants; sequencing the FT2a, FT2b, FT5a and / or ELF3 loci of the T0 plants; and comparing the sequences of the progeny plants with the corresponding sequences of the ancestral (T0) plants to determine the mutations introduced at the FT2a, FT2b, FT5a and / or ELF3 loci.

[0289] Non-limiting embodiments of the present invention include a method for determining where soybean plants or their seeds should be grown. In embodiments, the method includes: a. introducing mutations at the FT2a, FT2b, FT5a, and / or ELF3 loci of the soybean plant genome via site-directed nuclease genomic modification; b. self-pollinating the plants for one or more generations to generate progeny plants that are homozygous at each of the mutated loci; c. obtaining DNA from the progeny plants; d. determining the allelic combination of the progeny plants via a first determination of DNA indicating the type of mutation introduced at a first FT2a, FT2b, FT5a, or ELF3 locus and a second and optionally subsequent determination of DNA indicating the type of mutation introduced at a second and optionally subsequent FT2a, FT2b, FT5a, or ELF3 locus; and e. specifying a variation in flowering time of the plant based on the determined allelic combination, wherein the variation in flowering time is relative to a control plant that does not contain the allelic combination.

[0290] In one embodiment, specifying a variation in flowering time includes specifying a relative maturity group value relative to a control plant that does not contain the allele combination, wherein optionally the control plant contains the corresponding wild-type allele at each of the mutated loci. In other embodiments, specifying a variation in flowering time includes specifying the number of days earlier or later than the flowering time of the control soybean plant.

[0291] Non-limiting embodiments of the invention also include expression cassettes for editing plant cells. Example embodiments include transforming plant cells with an expression cassette comprising (i) a nucleic acid encoding a site-directed nuclease; and (ii) a nucleic acid encoding at least one guide RNA (gRNA) targeting a target sequence. In one embodiment, the nucleic acid encoding the site-directed nuclease is operatively linked to a first promoter, and wherein the nucleic acid encoding the at least one gRNA is operatively linked to a second promoter. In another embodiment of the expression cassette, an enhancer is operatively linked to either the first or second promoter. In the embodiments, the site-directed nuclease is selected from the group consisting of: mega-nuclease (MN), zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), Cas9 nuclease, Cfp1 nuclease, dCas9-Fokl, dCpf1-Fokl, chimeric Cas9-cytidine deaminase, chimeric Cas9-adenine deaminase, chimeric FEN1-Fokl, and Mega-TAL, nickase Cas9 (nCas9), chimeric dCas9 non-Fokl nuclease, and dCpf1 non-Fokl nuclease.

[0292] Non-limiting embodiments of the invention also include methods for editing plants at the FT2a, FT2b, FT5a, and / or ELF3 loci to produce novel alleles and plants with novel allele combinations that, relative to control plants not containing the novel allele combinations, confer altered flowering time characteristics. Example embodiments of the editing methods include introducing mutations into the FT2a, FT2b, FT5a, and / or ELF3 loci, the mutations being selected from the group consisting of allele substitutions, one or more base insertions, and one or more base deletions. In another embodiment, the method includes regenerating transformed T0 plants from transformed plant cells having a plurality of T1 seeds, wherein the plurality of T1 seeds contain a plurality of unique edits at the mutated loci; growing a plurality of T1 plants from the T1 seeds; and self-pollinating these T1 plants for one or more generations to obtain offspring plants that are homozygous at the mutated loci.

[0293] In a particular embodiment, the flowering time of the edited progeny plants was shorter than that of the control plants. In another embodiment, the relative maturity group value of the edited progeny plants differed from that of the control plants.

[0294] Non-limiting embodiments of the invention further include edited progeny plants produced by the methods disclosed above, as well as further progeny plants of the edited progeny plants, such as those obtained through breeding or self-pollination. In embodiments, the flowering time of the edited progeny plants is modified compared to that of the control plants (e.g., shorter or longer). In embodiments, the relative maturity group value of the edited progeny plants differs from that of the control plants.

[0295] Non-limiting embodiments further include a breeding method comprising:

[0296] The above-disclosed non-naturally occurring soybean plants were hybridized with different soybean plants that did not contain allelic combinations of non-naturally occurring soybean plants; and offspring plants with modified flowering were selected. Example

[0297] The following examples provide illustrative embodiments. Based on this disclosure and the skill of a person of ordinary skill in the art, it should be understood that the following examples are merely intended to be exemplary and that many changes, modifications, and alterations may be made without departing from the scope of the subject matter of this disclosure.

[0298] Example A. CRISPR / Cas9-mediated GmFT2a and GmELF3 mutagenesis slows down soybean flowering

[0299] A.1: CRISPR / Cas9-mediated gmft2a directed mutagenesis slows down soybean flowering

[0300] A.1.1 SgRNA Design and Construction of CRISPR / Cas9 Expression Vector

[0301] The genomic sequence of GmFT2a (SEQ ID NO: 1) was obtained from the Phytozome database based on the Glyma.16G150700 gene located on chromosome 16. The target site of GmFT2a (GmFT2a-TS) was designed using CRISPR-P software (World Wide Web, cbi.hzau.edu.cn / cgi-bin / CRISPR). The sequence of GmFT2a-TS is CACAAGTTGTCAACCAACCAAGG (SEQ ID NO: 28).

[0302] To obtain the CRISPR / Cas9-GmFT2a vector, GmFT2a-TS (GmFT2a-sense: 5'-TTG) was synthesized. CACAAGTTGTCAACCAACCA -3' (SEQ ID NO: 29); GmFT2a-Antonym: 5'-AAC TGGTTGGTTGACAACTTGTGPrimers for the target site (SEQ ID NO: 30, where the underscore represents the target site) were polymerized to form a double strand, and then subcloned into a CRISPR / Cas9 vector (ViewSolid Biotech, VK005-15, Beijing) using T4 ligase. The recombinant vector was confirmed by sequencing and named CRISPR / Cas9-GmFT2a. CRISPR / Cas9-GmFT2a was then transformed into Agrobacterium EHA105 strain by electroporation, which was verified by PCR and sequencing. The PCR reaction system was as follows: 2×Taq master mixture, 12.5 μL; bacterial culture (200 ng / μL), 1 μL; Cas9-F (10 pmol / μL), 1 μL; Cas9-R (10 pmol / μL), 1 μL; ddH2O 9.5 μL, total volume 25 μL. The PCR reaction was set as follows: 94°C for 3 min; 94°C for 30 s, 55°C for 30 s, and 72°C for 1 min, for 35 cycles; and a final extension at 72°C for 10 min.

[0303] A.1.2 CRISPR / Cas9-GmFT2a conversion in soybean

[0304] A.1.2.1. Plant materials

[0305] The Jack soybean variety was used for Agrobacterium-mediated transformation. Healthy seeds were surface-sterilized by exposure to chlorine for 16 hours. The sterilized seeds were then placed in germination medium (GCM, pH 5.8) containing 3.1 g / L Gamberg base salt mixture (Phytotech, G768), 20 g / L sugar, 1 mL / L Gamberg vitamin solution (Phytotech, G219), and 7 g / L agar (Sigma), and germinated at 25°C under light for 18–20 h.

[0306] A.1.2.2. Agrobacterium strains and vectors

[0307] The *Agrobacterium tumefaciens* strain EHA105 was used in the experiment. A CRISPR / Cas9 vector (VK005-15, Beijing) was used to carry T-DNA and the bar gene, which serves as a marker of herbicide resistance.

[0308] A.1.2.3. Preparation of Agrobacterium

[0309] Agrobacterium stock solution of EHA105, stored at -80°C, was streaked onto a fixed YEP plate containing 5 g / L NaCl, 10 g / L tryptone, 5 g / L yeast extract, 15 g / L agar, and 50 mg / L kanamycin, 75 mg / L chloramphenicol, and 50 mg / L rifampin. The Agrobacterium-streaked plate was incubated at 28°C for approximately 2 days until colonies formed. Colonies were collected using a spreader and transferred to a fresh fixed YEP plate containing the same antibiotics, and incubated overnight at 28°C. Fresh Agrobacterium was suspended in a liquid co-culture medium (LCCM) containing a 1 / 2 Murashige & Skoog Basal Salt Mixture (Plant Technology Laboratory, M524, Lenexa, Kansas, USA), 3.9 g / L 2-(N-morpholino)ethanesulfonic acid (MES), 30 g / L sugar, 1 mL / L Gamberg vitamin solution, 150 mg / L dl-dithiothreitol (DTT), 2 mg / L zeatin, and 40 mg / L 3′,5′-dimethoxy-4-hydroxyacetophenone (AS) (pH 5.4). A final optical density of 0.6 was measured at 600 nm, and Agrobacterium cultures were prepared for transformation.

[0310] A.1.2.4. Infection and Co-culture

[0311] Explants were prepared from one-day-old seedlings. The seed coat was removed by longitudinally cutting along the hilum to separate the cotyledons. The hypocotyl found at the junction of the hypocotyl and cotyledon was excised to obtain semi-seed explants. The explant cuttings were immersed in Agrobacterium for 2 h at 50 rpm. After inoculation, each of the nine cotyledons was placed in a solid co-medium (CCM) containing a 1 / 2 mixture of Mourasig and Skog basal salts, 3.9 g / L MES, 30 g / L sugar, 1 mL / L Gamberg vitamin solution, 150 mg / L DTT, 40 mg / L AS, 2 mg / L zeatin, and 7 g / L agar (pH 5.4) with a Whatman filter paper placed on it, and then incubated at 22°C in the dark for 5 days.

[0312] A.1.2.5. Recovery Culture and Selection Culture

[0313] After co-culturing, the explants were then transferred to recovery medium (SIMO) containing 3.1 g / L Gamborghini basal salt mixture, 0.98 g / L LMES, 30 g / L sucrose, 1 mL / L Gamborghini vitamin solution, 150 mg / L cefotaxime, 450 mg / L termethin, 1 mg / L 6-benzylaminopurine (6-BA), and 7 g / L agar (pH 5.7) and incubated at 28°C for 7 days. Seven days after recovery, the explants were transferred to selective medium (SIM6) containing 3.1 g / L Gamborghäuser basal salt mixture, 0.98 g / L MES, 30 g / L sucrose, 1 mL / L Gamborghäuser vitamin solution, 150 mg / L cefotaxime, 450 mg / L termethin, 1 mg / L 6-BA, 7 g / L agar and 6 mg / L glufosinate (pH 5.7) and incubated at 28°C for 21 days.

[0314] A.1.2.6. Bud elongation and rooting

[0315] After selection and culture, cotyledons and brown leaves were excised from the explants. The remaining tissue was transferred to shoot elongation medium (SEM) containing a mixture of 4.0 g / L Mulasig and Skog basal salts, 0.6 g / L MES, 30 g / L sucrose, 1 mL / L Gamberg vitamin solution, 150 mg / L cefotaxime, 450 mg / L termethin, 0.1 mg / L 3-indoleacetic acid (IAA), 0.5 mg / L gibberellic acid (GA), 1 mg / L zeatin, 7 g / L agar, and 6 mg / L glufosinate (pH 5.6) and incubated at 28°C. The medium was changed every two weeks. Simultaneously with changing the SEM, cut off the elongated shoots (5-8 cm) from the base of the buds and immerse the stems in 1 mg / L indole-3-butyric acid (IBA) for 1 min. Then place them in rooting medium (RCM) containing a 1 / 2 mixture of Mourasig and Skog base salts, 0.6 g / L MES, 20 g / L sucrose, 1 mL / L Gamberg vitamin solution, 7 g / L agar, and 3 mg / L glufosinate (pH 5.7) and incubate at 28°C for 7 days. After rooting, transfer the plants to pots and grow them in a greenhouse.

[0316] A.1.3 Screening for gmft2a mutant plants by sequencing analysis

[0317] Genomic DNA was extracted from the leaves of each individual plant in the T0 generation, and then the region across the target site was analyzed using Phanta. ®Ultra-fidelity DNA polymerase (Vazyme Biotech) was used to amplify DNA via PCR using the GmFT2a forward primer (5'-ATTCATAACAAAGCAAACGAG-3', SEQ ID NO: 31) and reverse primer (5'-ACTTGACCTTCCCTTAAACAC-3', SEQ ID NO: 32). The DNA was purified using the Zymoclean™ gel DNA recovery kit and sequenced by Tsingke (Beijing). Different types of gene editing can be identified by sequence peaks. Short base insertions or deletions induced by CRISPR / Cas9 (not multiples of three) result in frameshift mutations. Heterozygous mutations show overlapping peaks from the target site to the ends. Wild-type and homozygous mutations do not have overlapping peaks at the target site. Homozygous mutants were then identified by sequence alignment with the wild-type sequence. This method was also used for T1 and T2 generations. In this study, we detected only one type of homozygous mutation at the GmFT2a target site in the T1 generation. The type of mutation (SEQ ID NO: 11) is a 1-bp insertion (153 to 154 bp, where the A in the start codon ATG is considered to be position 1).

[0318] A.1.4 Phenotypic characteristics of gmft2a mutant plants under different photoperiods

[0319] To verify whether GmFT2a is involved in regulating photoperiodic flowering, wild-type (WT) plants and gmft2a mutants were grown under long-day (LD, 16 h light / 8 h dark) and short-day (SD, 12 h light / 12 h dark) photoperiodic conditions. Flowering time for each soybean plant was recorded as the number of days from emergence to stage R1 (the first flower appearing at any node on the main stem). Maturity time was recorded as the number of days from emergence to stages R7 (any pods turning mature color) and R8 (95% of pods turning mature color). Statistical analysis and significance tests were performed using Microsoft Excel. Significance between control and treatment was considered at the 0.01 probability level. Flowering and maturity times are shown as mean ± standard deviation. Under SD conditions, the gmft2a mutant showed a flowering time approximately 3 days later than WT plants (24.8 ± 0.5 DAE for gmft2a mutants vs. 21.0 ± 0.5 DAE for WT). The maturation time of the gmft2a mutant at stage R7 was 67.0 ± 1.2 DAE for the gmft2a mutant and 67.3 ± 1.0 DAE for the WT mutant. The maturation time of the gmft2a mutant at stage R8 was 73.0 ± 0.8 DAE for the gmft2a mutant and 72.6 ± 0.5 DAE for the WT mutant (Table A.1.1). Under LD conditions, the gmft2a mutant showed a flowering time approximately 7 days later than the WT plants (50.1 ± 1.4 DAE for the gmft2a mutant and 43.6 ± 1.4 DAE for the WT). The gmft2a mutant showed a maturation time approximately 6 days later in the R7 stage (153.0 ± 1.6 DAE for gmft2a mutants compared to 147.0 ± 2.5 DAE for WT) and approximately 10 days later in the R8 stage (173.8 ± 1.3 DAE for gmft2a mutants compared to 163.1 ± 4.1 DAE for WT) (Table A.1.2). These results indicate that CRISPR / Cas9-mediated directed mutagenesis of gmft2a slows down flowering and maturation in soybean under SD and LD conditions.

[0320] Table A.1.1 Phenotypes of WT and gmft2a plants under SD conditions.

[0321]

[0322] Table A.1.2 Phenotypes of WT and gmft2a plants under LD conditions.

[0323]

[0324] This indicates that p < 0.01.

[0325] A.2: CRISPR / Cas9-mediated gmELF3 directed mutagenesis slows down soybean flowering

[0326] A.2.1 SgRNA Design and Construction of CRISPR / Cas9 Expression Vector

[0327] The genome sequence of GmELF3 (SEQ ID NO:7) was obtained from the Phytozome database based on the Glyma.04G050200 gene located on chromosome 4. The target site of GmELF3 (GmELF3-TS) was designed using CRISPR-P software (World Wide Web, cbi.hzau.edu.cn / cgi-bin / CRISPR). The sequence of GmELF3-TS is AAGGATGATGAGAAGGTGATGGG (SEQ ID NO: 43).

[0328] To obtain the CRISPR / Cas9-GmELF3 vector, GmELF3-TS (GmELF3-significant: 5'-TTG) was synthesized. AAGGATGATGAGAAGGTGAT -3' (SEQ ID NO: 44); GmELF3-Antonym: 5'-AAC ATCACCTTCTCATCATCCTT Primers (SEQ ID NO: 45, with the underlined area representing the target site) were used to polymerize the recombinant vector into a double strand, which was then subcloned into a CRISPR / Cas9 vector (VK005-15, Beijing) using T4 ligase. The recombinant vector was confirmed by sequencing and named CRISPR / Cas9-GmELF3. CRISPR / Cas9-GmELF3 was then transformed into Agrobacterium EHA105 strain by electroporation, which was verified by PCR and sequencing. The PCR reaction system was as follows: 2×Taq master mixture, 12.5 μL; bacterial culture (200 ng / μL), 1 μL; Cas9-F (10 pmol / μL), 1 μL; Cas9-R (10 pmol / μL), 1 μL; ddH2O 9.5 μL, total volume 25 μL. The PCR reaction was set as follows: 94°C for 3 min; 94°C for 30 s, 55°C for 30 s, and 72°C for 1 min, for 35 cycles; and a final extension at 72°C for 10 min.

[0329] A.2.2 CRISPR / Cas9-GmELF3 conversion in soybeans

[0330] See A.1.2.

[0331] A.2.3 Screening for gmELF3 mutant plants by sequencing analysis

[0332] Genomic DNA was extracted from the leaves of each individual plant in the T0 generation, and then the region across the target site was analyzed using Phanta. ® Ultra-fidelity DNA polymerase (Vazyme Biotech) was used for PCR amplification with GmELF3 forward primer (5'-CTCACGAGTTCAGTTCTGTAC-3', SEQ ID NO: 46) and reverse primer (5'-CAGAACACCTGAATTGAACC-3', SEQ ID NO: 47), followed by purification using the Zymoclean™ gel DNA recovery kit and sequencing by Tsingke (Beijing). Different types of gene editing can be identified by sequence peaks. Short base insertions or deletions induced by CRISPR / Cas9 (not multiples of three) result in frameshift mutations. Heterozygous mutations show overlapping peaks from the target site to the ends. Wild-type and homozygous mutations do not have overlapping peaks at the target site. Homozygous mutants were then identified by sequence alignment with wild-type sequences. This method was also used for T1 and T2 generations. In this study, we detected only one type of homozygous mutation at the GmELF3 target site in the T1 generation. The mutant (SEQ ID NO:17) is a 1-bp insertion (29 to 30 bp, where the A in the start codon ATG is considered to be position 1).

[0333] A.2.4 Phenotypic characteristics of gmELF3 mutant plants under different photoperiods

[0334] To verify whether GmELF3 is involved in regulating photoperiodic flowering, wild-type (WT) plants and gmELF3 mutants were grown under long-day (LD, 16 h light / 8 h dark) and short-day (SD, 12 h light / 12 h dark) photoperiodic conditions. Flowering time for each soybean plant was recorded as the number of days from emergence to stage R1 (the first flower appearing at any node on the main stem). Maturity time was recorded as the number of days from emergence to stages R7 (any pods turning mature color) and R8 (95% of pods turning mature color). Statistical analysis and significance tests were performed using Microsoft Excel. Significance between control and treatment was considered at the 0.01 probability level. Flowering and maturity times are shown as mean ± standard deviation. Under SD conditions, the gmELF3 mutant showed approximately 2 days later flowering time compared to WT plants (23.5 ± 1.1 DAE for gmELF3 mutants vs. 21.0 ± 0.5 DAE for WT). The maturation time of the gmELF3 mutant at stage R7 was 65.8 ± 1.3 DAE for the gmELF3 mutant and 67.3 ± 1.0 DAE for the WT. The maturation time of the gmELF3 mutant at stage R8 was 73.4 ± 0.5 DAE for the gmELF3 mutant and 72.6 ± 0.5 DAE for the WT (Table A.2.1). Under LD conditions, the gmELF3 mutant showed a flowering time approximately 4 days later than the WT plants (47.5 ± 0.5 DAE for the gmELF3 mutant and 43.6 ± 1.4 DAE for the WT). The gmELF3 mutant showed a maturation time approximately 5 days later in the R7 stage (152.9 ± 8.0 DAE for gmELF3 mutants compared to 147.0 ± 2.5 DAE for WT) and approximately 7 days later in the R8 stage (170.3 ± 3.6 DAE for gmELF3 mutants compared to 163.1 ± 4.1 DAE for WT) (Table A.2.2). These results indicate that CRISPR / Cas9-mediated gmELF3 directed mutagenesis slows down flowering and maturation in soybean under SD and LD conditions.

[0335] Table A.2.1 Phenotypes of WT and gmELF3 plants under SD conditions.

[0336]

[0337] Table A.2.2 Phenotypes of WT and gmELF3 plants under LD conditions.

[0338]

[0339] This indicates that p < 0.01.

[0340] A.3: In soybeans, CRISPR / Cas9-mediated gmft2a ELF3 directed mutagenesis is very late.

[0341] A.3.1 Generation of the gmft2a ELF3 double mutant

[0342] To generate the gmft2a ELF3 double mutant, we used the T1 homozygous gmft2a mutant (1-bp insertion) (SEQ ID NO: 11) as the male parent and the gmELF3 mutant (1-bp insertion) (SEQ ID NO: 17) as the female parent for hybridization. F2 generation plants were obtained by self-pollination. Genomic DNA was extracted from the leaves of each individual F2 plant. The region spanning the target sites of GmFT2a or GmELF3 was then amplified by PCR using Phanta® Ultra Fidelity DNA Polymerase (Novizan Biotechnology Co., Ltd.) with GmFT2a forward primer (5'-ATTCATAACAAAGCAAACGAG-3', SEQ ID NO: 31) and reverse primer (5'-ACTTGACCTTCCCTTAAACAC-3', SEQ ID NO: 32), and GmELF3 forward primer (5'-CTCACGAGTTCAGTTCTGTAC-3', SEQ ID NO: 46) and reverse primer (5'-CAGAACACCTGAATTGAACC-3', SEQ ID NO: 47). The DNA was purified using the Zymoclean™ Gel DNA Recovery Kit and sequenced by Qingke Biotechnology Co., Ltd. (Beijing). The homozygous gmft2a ELF3 double mutant was used for subsequent experiments.

[0343] A.3.2 Phenotypic characteristics of gmft2a ELF3 mutant plants under different photoperiods

[0344] To verify whether GmFT2a and GmELF3 are involved in regulating photoperiodic flowering, wild-type (WT) plants and gmft2a ELF3 mutants were grown under long-day (LD, 16 h light / 8 h dark) and short-day (SD, 12 h light / 12 h dark) photoperiodic conditions. Flowering time for each soybean plant was recorded as the number of days from emergence to stage R1 (the first flower appearing at any node on the main stem). Maturity time was recorded as the number of days from emergence to stages R7 (any pods turning mature color) and R8 (95% of pods turning mature color). Statistical analysis and significance tests were performed using Microsoft Excel. Significance between control and treatment was considered at the 0.01 probability level. Flowering and maturity times are shown as mean ± standard deviation. Under SD conditions, the gmft2a ELF3 mutant showed a flowering time approximately 5 days later than WT plants (26.8 ± 0.7 DAE for gmft2a ELF3 mutant, compared to 21.0 ± 0.5 DAE for WT). The maturity time at R7 stage for the gmft2a ELF3 mutant was 67.6 ± 0.5 DAE, compared to 67.3 ± 1.0 DAE for WT. The maturity time at R8 stage for the gmft2a ELF3 mutant was 73.9 ± 1.1 DAE, compared to 72.6 ± 0.5 DAE for WT (Table A.3.1). Under LD conditions, the gmft2a ELF3 mutant showed a flowering time approximately 9 days later than WT plants (52.1 ± 1.8 DAE for gmft2a ELF3 mutant, compared to 43.6 ± 1.4 DAE for WT). The gmft2a ELF3 mutant showed a maturation time approximately 10 days later in the R7 stage (157.3 ± 2.1 DAE for the gmft2a ELF3 mutant compared to 147.0 ± 2.5 DAE for the WT) and approximately 16 days later in the R8 stage (179.7 ± 4.0 DAE for the gmft2a ELF3 mutant compared to 163.1 ± 4.1 DAE for the WT) (Table A.3.2). These results indicate that CRISPR / Cas9-mediated directed mutagenesis of gmft2a ELF3 slows down flowering and maturation in soybean under SD and LD conditions.

[0345] Table A.3.1 Phenotypes of WT and gmft2a ELF3 plants under SD conditions.

[0346]

[0347] Table A.3.2 Phenotypes of WT and gmft2a ELF3 plants under LD conditions.

[0348]

[0349] This indicates that p < 0.01.

[0350] Example B. CRISPR / Cas9-mediated GmFT2a and GmFT2b mutagenesis slows down soybean flowering.

[0351] B.1: CRISPR / Cas9-mediated gmft2a directed mutagenesis slows down soybean flowering

[0352] B.1.1 SgRNA Design and Construction of CRISPR / Cas9 Expression Vector

[0353] The genomic sequence of GmFT2a was obtained from the Phytozome database based on the Glyma.16G150700 gene located on chromosome 16. The target site of GmFT2a (GmFT2a-TS) was designed using CRISPR-P software (World Wide Web, cbi.hzau.edu.cn / cgi-bin / CRISPR). The sequence of GmFT2a-TS is CACAAGTTGTCAACCAACCAAGG (SEQ ID NO: 28).

[0354] To obtain the CRISPR / Cas9-GmFT2a vector, GmFT2a-TS (GmFT2a-sense: 5'-TTG) was synthesized. CACAAGTTGTCAACCAACCA -3' (SEQ ID NO: 29); GmFT2a-Antonym: 5'-AAC TGGTTGGTTGACAACTTGTG Primers (SEQ ID NO: 30, with the underlined area representing the target site) were used to polymerize the recombinant vector into a double strand, which was then subcloned into a CRISPR / Cas9 vector (VK005-15, Beijing) using T4 ligase. The recombinant vector was confirmed by sequencing and named CRISPR / Cas9-GmFT2a. CRISPR / Cas9-GmFT2a was then transformed into Agrobacterium EHA105 strain by electroporation, which was verified by PCR and sequencing. The PCR reaction system was as follows: 2×Taq master mixture, 12.5 μL; bacterial culture (200 ng / μL), 1 μL; Cas9-F (10 pmol / μL), 1 μL; Cas9-R (10 pmol / μL), 1 μL; ddH2O 9.5 μL, total volume 25 μL. The PCR reaction was set as follows: 94°C for 3 min; 94°C for 30 s, 55°C for 30 s, and 72°C for 1 min, for 35 cycles; and a final extension at 72°C for 10 min.

[0355] B.1.2 CRISPR / Cas9-GmFT2a conversion in soybean

[0356] B.1.2.1. Plant materials

[0357] The soybean 'Jack' variety was used for Agrobacterium-mediated transformation. Healthy seeds were surface-sterilized by exposure to chlorine for 16 hours. The sterilized seeds were then placed in germination medium (GCM, pH 5.8) containing 3.1 g / L Gamberg base salt mixture (Phytotech, G768), 20 g / L sugar, 1 mL / L Gamberg vitamin solution (Phytotech, G219), and 7 g / L agar (Sigma), and allowed to germinate at 25°C under light for 18–20 h.

[0358] B.1.2.2. Agrobacterium strains and vectors

[0359] The *Agrobacterium tumefaciens* strain EHA105 was used in the experiment. The CRISPR / Cas9 vector (VK005-15, Beijing) carried T-DNA and the bar gene, which serves as a herbicide resistance marker.

[0360] B.1.2.3. Preparation of Agrobacterium

[0361] Agrobacterium stock solution of EHA105, stored at -80°C, was streaked onto a fixed YEP plate containing 5 g / L NaCl, 10 g / L tryptone, 5 g / L yeast extract, 15 g / L agar, and 50 mg / L kanamycin, 75 mg / L chloramphenicol, and 50 mg / L rifampin. The Agrobacterium-streaked plate was incubated at 28°C for approximately 2 days until colonies formed. Colonies were collected using a spreader and transferred to a fresh fixed YEP plate containing the same antibiotics, and incubated overnight at 28°C. Fresh Agrobacterium was suspended in a liquid co-culture medium (LCCM) containing a 1 / 2 Murashige & Skoog Basal Salt Mixture (Plant Technology Laboratory, M524, Lenexa, Kansas, USA), 3.9 g / L 2-(N-morpholino)ethanesulfonic acid (MES), 30 g / L sugar, 1 mL / L Gamberg vitamin solution, 150 mg / L dl-dithiothreitol (DTT), 2 mg / L zeatin, and 40 mg / L 3′,5′-dimethoxy-4-hydroxyacetophenone (AS) (pH 5.4). A final optical density of 0.6 was measured at 600 nm, and Agrobacterium cultures were prepared for transformation.

[0362] B.1.2.4. Infection and Co-culture

[0363] Explants were prepared from one-day-old seedlings. The seed coat was removed by longitudinally cutting along the hilum to separate the cotyledons. The hypocotyl found at the junction of the hypocotyl and cotyledon was excised to obtain semi-seed explants. The explant cuttings were immersed in Agrobacterium for 2 h at 50 rpm. After inoculation, each of the nine cotyledons was placed in a solid co-medium (CCM) containing a 1 / 2 mixture of Mourasig and Skog basal salts, 3.9 g / L MES, 30 g / L sugar, 1 mL / L Gamberg vitamin solution, 150 mg / L DTT, 40 mg / L AS, 2 mg / L zeatin, and 7 g / L agar (pH 5.4) with a Whatman filter paper placed on it, and then incubated at 22°C in the dark for 5 days.

[0364] B.1.2.5. Recovery Culture and Selection Culture

[0365] After co-culturing, the explants were then transferred to recovery medium (SIMO) containing 3.1 g / L Gamborghini basal salt mixture, 0.98 g / L LMES, 30 g / L sucrose, 1 mL / L Gamborghini vitamin solution, 150 mg / L cefotaxime, 450 mg / L termethin, 1 mg / L 6-benzylaminopurine (6-BA), and 7 g / L agar (pH 5.7) and incubated at 28°C for 7 days. Seven days after recovery, the explants were transferred to selective medium (SIM6) containing 3.1 g / L Gamborghäuser basal salt mixture, 0.98 g / L MES, 30 g / L sucrose, 1 mL / L Gamborghäuser vitamin solution, 150 mg / L cefotaxime, 450 mg / L termethin, 1 mg / L 6-BA, 7 g / L agar and 6 mg / L glufosinate (pH 5.7) and incubated at 28°C for 21 days.

[0366] B.1.2.6. Bud elongation and rooting

[0367] After selection and culture, cotyledons and brown leaves were excised from the explants. The remaining tissue was transferred to shoot elongation medium (SEM) containing a mixture of 4.0 g / L Mulasig and Skog basal salts, 0.6 g / L MES, 30 g / L sucrose, 1 mL / L Gamberg vitamin solution, 150 mg / L cefotaxime, 450 mg / L termethin, 0.1 mg / L 3-indoleacetic acid (IAA), 0.5 mg / L gibberellic acid (GA), 1 mg / L zeatin, 7 g / L agar, and 6 mg / L glufosinate (pH 5.6) and incubated at 28°C. The medium was changed every two weeks. Simultaneously with changing the SEM, cut off the elongated shoots (5-8 cm) from the base of the buds and immerse the stems in 1 mg / L indole-3-butyric acid (IBA) for 1 min. Then place them in rooting medium (RCM) containing a 1 / 2 mixture of Mourasig and Skog base salts, 0.6 g / L MES, 20 g / L sucrose, 1 mL / L Gamberg vitamin solution, 7 g / L agar, and 3 mg / L glufosinate (pH 5.7) and incubate at 28°C for 7 days. After rooting, transfer the plants to pots and grow them in a greenhouse.

[0368] B.1.3 Screening for gmft2a mutant plants by sequencing analysis

[0369] Genomic DNA was extracted from the leaves of each individual plant in the T0 generation, and then the region across the target site was analyzed using Phanta. ® Ultra-fidelity DNA polymerase (Vazyme Biotech) was used to amplify DNA via PCR using the GmFT2a forward primer (5'-ATTCATAACAAAGCAAACGAG-3', SEQ ID NO: 31) and reverse primer (5'-ACTTGACCTTCCCTTAAACAC-3', SEQ ID NO: 32). The DNA was purified using the Zymoclean™ gel DNA recovery kit and sequenced by Tsingke (Beijing). Different types of gene editing can be identified by sequence peaks. Short base insertions or deletions induced by CRISPR / Cas9 (not multiples of three) result in frameshift mutations. Heterozygous mutations show overlapping peaks from the target site to the ends. Wild-type and homozygous mutations do not have overlapping peaks at the target site. Homozygous mutants were then identified by sequence alignment with the wild-type sequence. This method was also used for T1 and T2 generations. In this study, we detected only one type of homozygous mutation at the GmFT2a target site in the T1 generation. The type of mutation (SEQ ID NO: 11) is a 1-bp insertion (153 to 154 bp, where the A in the start codon ATG is considered to be position 1).

[0370] B.1.4 Phenotypic characteristics of gmft2a mutant plants under different photoperiods

[0371] To verify whether GmFT2a is involved in regulating photoperiodic flowering, wild-type (WT) plants and gmft2a mutants were grown under long-day (LD, 16 h light / 8 h dark) and short-day (SD, 12 h light / 12 h dark) photoperiodic conditions. Flowering time for each soybean plant was recorded as the number of days from emergence to stage R1 (the first flower appearing at any node on the main stem). Maturity time was recorded as the number of days from emergence to stages R7 (any pods turning mature color) and R8 (95% of pods turning mature color). Statistical analysis and significance tests were performed using Microsoft Excel. Significance between control and treatment was considered at the 0.01 probability level. Flowering and maturity times are shown as mean ± standard deviation. Under SD conditions, the gmft2a mutant showed a flowering time approximately 3 days later than WT plants (24.8 ± 0.5 DAE for gmft2a mutants vs. 21.0 ± 0.5 DAE for WT). The maturation time of the gmft2a mutant at stage R7 was 67.0 ± 1.2 DAE for the gmft2a mutant and 67.3 ± 1.0 DAE for the WT mutant. The maturation time of the gmft2a mutant at stage R8 was 73.0 ± 0.8 DAE for the gmft2a mutant and 72.6 ± 0.5 DAE for the WT mutant (Table B.1.1). Under LD conditions, the gmft2a mutant showed a flowering time approximately 7 days later than the WT plants (50.1 ± 1.4 DAE for the gmft2a mutant and 43.6 ± 1.4 DAE for the WT). The gmft2a mutant showed a maturation time approximately 6 days later in the R7 stage (153.0 ± 1.6 DAE for gmft2a mutants compared to 147.0 ± 2.5 DAE for WT) and approximately 10 days later in the R8 stage (173.8 ± 1.3 DAE for gmft2a mutants compared to 163.1 ± 4.1 DAE for WT) (Table B.1.2). These results indicate that CRISPR / Cas9-mediated directed mutagenesis of gmft2a slows down flowering and maturation in soybean under SD and LD conditions.

[0372] Table B.1.1 Phenotypes of WT and gmft2a plants under SD conditions.

[0373]

[0374] Table B.1.2 Phenotypes of WT and gmft2a plants under LD conditions.

[0375]

[0376] This indicates that p < 0.01.

[0377] B.2: CRISPR / Cas9-mediated gmft2b directed mutagenesis slows down soybean flowering

[0378] B.2.1 SgRNA Design and Construction of CRISPR / Cas9 Expression Vector

[0379] The genomic sequence of GmFT2b (SEQ ID NO: 3) was obtained from the Phytozome database based on the Glyma.16G151000 gene located on chromosome 16. The target site of GmFT2b (GmFT2b-TS) was designed using CRISPR-P software (World Wide Web, cbi.hzau.edu.cn / cgi-bin / CRISPR). The sequence of GmFT2b-TS is AGAGGGTCCCTACTTCCACGAGG (SEQ ID NO: 33).

[0380] To obtain the CRISPR / Cas9-GmFT2b vector, GmFT2b-TS (GmFT2b-sense: 5'-TTG) was synthesized. AGAGGGTCCCTACTTCCACG -3', SEQ ID NO: 34; GmFT2b-Antonym: 5'-AAC CGTGGAAGTAGGGACCCTCT Primers (-3', SEQ ID NO: 35; where the underscore represents the target site) were used to polymerize and form a double strand, which was then subcloned into a CRISPR / Cas9 vector (Vishang Lide Biotechnology Co., Ltd., VK005-15, Beijing) using T4 ligase. The recombinant vector was confirmed by sequencing and named CRISPR / Cas9-GmFT2b. CRISPR / Cas9-GmFT2b was then transformed into Agrobacterium EHA105 strain by electroporation, which was verified by PCR and sequencing. The PCR reaction system was as follows: 2×Taq master mixture, 12.5 μL; bacterial culture (200 ng / μL), 1 μL; Cas9-F (10 pmol / μL), 1 μL; Cas9-R (10 pmol / μL), 1 μL; ddH2O 9.5 μL, total volume 25 μL. The PCR reaction was set as follows: 94°C for 3 min; 94°C for 30 s, 55°C for 30 s, and 72°C for 1 min, for 35 cycles; and a final extension at 72°C for 10 min.

[0381] B.2.2 CRISPR / Cas9-GmFT2b conversion in soybeans

[0382] See B.1.2.

[0383] B.2.3 Screening for gmft2b mutant plants by sequencing analysis

[0384] Genomic DNA was extracted from the leaves of each individual plant in the T0 generation, and then the region across the target site was analyzed using Phanta. ® Ultra-fidelity DNA polymerase (Vazyme Biotech) was used for PCR amplification with the GmFT2b forward primer (5'-TGACCACACGATTGGTTCGAT-3', SEQ ID NO: 36) and reverse primer (5'-TCCTGAAATCATCACCACCGA-3', SEQ ID NO: 37). The DNA was purified using the Zymoclean™ gel DNA recovery kit and sequenced by Tsingke (Beijing). Different types of gene editing can be identified by sequence peaks. Short base insertions or deletions induced by CRISPR / Cas9 (not multiples of three) result in frameshift mutations. Heterozygous mutations show overlapping peaks from the target site to the ends. Wild-type and homozygous mutations do not have overlapping peaks at the target site. Homozygous mutants were then identified by sequence alignment with the wild-type sequence. This method was also used for T1 and T2 generations. In this study, we detected only one type of homozygous mutation at the target site of GmFT2b in the T1 generation. The mutant (SEQ ID NO:13) was a 4-bp deletion (10 to 13 bp, with the A in the start codon ATG considered to be position 1).

[0385] B.2.4 Phenotypic characteristics of gmft2b mutant plants under different photoperiods

[0386] To verify whether GmFT2b is involved in regulating photoperiodic flowering, wild-type (WT) plants and gmft2b mutants were grown under long-day (LD, 16 h light / 8 h dark) and short-day (SD, 12 h light / 12 h dark) photoperiodic conditions. Flowering time for each soybean plant was recorded as the number of days from emergence to stage R1 (the first flower appearing at any node on the main stem). Maturity time was recorded as the number of days from emergence to stages R7 (any pods turning mature color) and R8 (95% of pods turning mature color). Statistical analysis and significance tests were performed using Microsoft Excel. Significance between control and treatment was considered at the 0.01 probability level. Flowering and maturity times are shown as mean ± standard deviation. Under SD conditions, the flowering time of the gmft2b mutant was almost identical to that of the WT plants (21.4 ± 0.5 DAE for the gmft2b mutant versus 21.0 ± 0.5 DAE for WT). The maturation time of the gmft2b mutant at stage R7 was 74.1 ± 1.7 DAE for the gmft2b mutant and 67.3 ± 1.0 DAE for the WT mutant. The maturation time of the gmft2b mutant at stage R8 was 82.5 ± 0.8 DAE for the gmft2b mutant and 72.6 ± 0.5 DAE for the WT mutant (Table B.2.1). Under LD conditions, the gmft2b mutant showed a flowering time approximately 4 days later than the WT plants (47.6 ± 0.9 DAE for the gmft2b mutant and 43.6 ± 1.4 DAE for the WT). The gmft2b mutant showed a maturity time approximately 7 days later in the R7 stage (154.8 ± 5.4 DAE for gmft2b mutants compared to 147.0 ± 2.5 DAE for WT) and approximately 30 days later in the R8 stage (193.3 ± 4.0 DAE for gmft2b mutants compared to 163.1 ± 4.1 DAE for WT) (Table B.2.2). These results indicate that CRISPR / Cas9-mediated directed mutagenesis of gmft2b slows down flowering and maturation in soybean under SD and LD conditions.

[0387] Table B.2.1 Phenotypes of WT and gmft2b plants under SD conditions.

[0388]

[0389] Table B.2.2 Phenotypes of WT and gmft2b plants under LD conditions.

[0390]

[0391] This indicates that p < 0.01.

[0392] B.3: In soybeans, CRISPR / Cas9-mediated gmft2a ft2b directed mutagenesis is expressed very late.

[0393] B.3.1 Generation of gmft2a ft2b double mutants

[0394] To generate the gmft2a ft2b double mutant, we used a T1 homozygous gmft2a mutant (1-bp insertion) as the male parent and a gmft2b mutant (4-bp deletion) as the female parent for hybridization. F2 plants were obtained through self-pollination. Genomic DNA was extracted from the leaves of each individual F2 plant. The region spanning the target site of GmFT2a or GmFT2b was then amplified by PCR using Phanta® Ultra Fidelity DNA Polymerase (Novizan Biotechnology Co., Ltd.) with GmFT2a forward primer (5'-ATTCATAACAAAGCAAACGAG-3', SEQ ID NO: 31), reverse primer (5'-ACTTGACCTTCCCTTAAACAC-3', SEQ ID NO: 32), and GmFT2b forward primer (5'-TGACCACACGATTGGTTCGAT-3', SEQ ID NO: 36), and reverse primer (5'-TCCTGAAATCATCACCACCGA-3', SEQ ID NO: 37). The DNA was purified using the Zymoclean™ Gel DNA Recovery Kit and sequenced by Qingke Biotechnology Co., Ltd. (Beijing). Homozygous gmft2a and ft2b double mutants were used for subsequent experiments.

[0395] B.3.2 Phenotypic characteristics of gmft2a and ft2b mutant plants under different photoperiods

[0396] To verify whether GmFT2a and GmFT2b are involved in regulating photoperiodic flowering, wild-type (WT) plants and gmft2a ft2b mutants were grown under long-day (LD, 16 h light / 8 h dark) and short-day (SD, 12 h light / 12 h dark) photoperiodic conditions. Flowering time for each soybean plant was recorded as the number of days from emergence to stage R1 (the first flower appearing at any node on the main stem). Maturity time was recorded as the number of days from emergence to stages R7 (any pods turning mature color) and R8 (95% of pods turning mature color). Statistical analysis and significance tests were performed using Microsoft Excel. Significance between control and treatment was considered at the 0.01 probability level. Flowering and maturity times are shown as mean ± standard deviation. Under SD conditions, the gmft2a ft2b mutant showed a flowering time approximately 5 days later than the WT plant (26.0 ± 1.0 DAE for the gmft2aft2b mutant and 21.0 ± 0.5 DAE for the WT). The maturity time at R7 for the gmft2a ft2b mutant was 75.0 ± 1.0 DAE, compared to 67.3 ± 1.0 DAE for the WT. The maturity time at R8 for the gmft2a ft2b mutant was 83.2 ± 1.3 DAE, compared to 72.6 ± 0.5 DAE for the WT (Table B.3.1). Under LD conditions, the gmft2a ft2b mutant showed a flowering time approximately 17 days later than WT plants (60.8 ± 1.2 DAE for gmft2a ft2b mutants vs. 43.6 ± 1.4 DAE for WT). The gmft2a ft2b mutant showed a maturity time approximately 76 days later at R7 (223.0 ± 7.0 DAE for gmft2a ft2b mutants vs. 147.0 ± 2.5 DAE for WT) and approximately 95 days later at R8 (258.3 ± 3.8 DAE for gmft2a ft2b mutants vs. 163.1 ± 4.1 DAE for WT) (Table B.3.2). These results indicate that CRISPR / Cas9-mediated directed mutagenesis of gmft2a ft2b slows down flowering and maturation in soybean under both SD and LD conditions.

[0397] Table B.3.1 Phenotypes of WT and gmft2a ft2b plants under SD conditions.

[0398]

[0399] Table B.3.2 Phenotypes of WT and gmft2a ft2b plants under LD conditions.

[0400]

[0401] This indicates that p < 0.01.

[0402] Example C. CRISPR / Cas9-mediated mutagenesis of GmFT5a and GmELF3 slows down soybean flowering

[0403] C.1: CRISPR / Cas9-mediated gmft5a directed mutagenesis slows down soybean flowering

[0404] C.1.1 SgRNA design and construction of CRISPR / Cas9 expression vector

[0405] The genomic sequence of GmFT5a (SEQ ID NO: 5) was obtained from the Phytozome database based on the Glyma16G044100 gene located on chromosome 16. The target site of GmFT5a (GmFT5a-TS) was designed using CRISPR-P software (World Wide Web, cbi.hzau.edu.cn / cgi-bin / CRISPR). The sequence of GmFT5a-TS is AAAGTAAATAATCATGGCACGGG (SEQ ID NO: 38).

[0406] To obtain the CRISPR / Cas9-GmFT5a vector, GmFT5a-TS (GmFT5a-sense: 5'-TTG) was synthesized. AAAGTAAATAATCATGGCAC -3', SEQ ID NO: 39; GmFT5a-Antonym: 5'-AAC GTGCCATGATTAT TTACTTT Primers (-3', SEQ ID NO: 40; where the underscore represents the target site) were used to polymerize and form a double strand, which was then subcloned into a CRISPR / Cas9 vector (Vishang Lide Biotechnology Co., Ltd., VK005-15, Beijing) using T4 ligase. The recombinant vector was confirmed by sequencing and named CRISPR / Cas9-GmFT5a. CRISPR / Cas9-GmFT5a was then transformed into Agrobacterium EHA105 strain by electroporation, which was verified by PCR and sequencing. The PCR reaction system was as follows: 2×Taq master mixture, 12.5 μL; bacterial culture (200 ng / μL), 1 μL; Cas9-F (10 pmol / μL), 1 μL; Cas9-R (10 pmol / μL), 1 μL; ddH2O 9.5 μL, total volume 25 μL. The PCR reaction was set as follows: 94°C for 3 min; 94°C for 30 s, 55°C for 30 s, and 72°C for 1 min, for 35 cycles; and a final extension at 72°C for 10 min.

[0407] C.1.2 CRISPR / Cas9-GmFT5a conversion in soybean

[0408] C.1.2.1. Plant materials

[0409] The soybean 'Jack' variety was used for Agrobacterium-mediated transformation. Healthy seeds were surface-sterilized by exposure to chlorine for 16 hours. The sterilized seeds were then placed in germination medium (GCM, pH 5.8) containing 3.1 g / L Gamberg base salt mixture (Phytotech, G768), 20 g / L sugar, 1 mL / L Gamberg vitamin solution (Phytotech, G219), and 7 g / L agar (Sigma), and allowed to germinate at 25°C under light for 18–20 h.

[0410] C.1.2.2. Agrobacterium strains and vectors

[0411] The *Agrobacterium tumefaciens* strain EHA105 was used in the experiment. The CRISPR / Cas9 vector (VK005-15, Beijing) carried T-DNA and the bar gene, which serves as a herbicide resistance marker.

[0412] C.1.2.3. Preparation of Agrobacterium

[0413] Agrobacterium stock solution of EHA105, stored at -80°C, was streaked onto a fixed YEP plate containing 5 g / L NaCl, 10 g / L tryptone, 5 g / L yeast extract, 15 g / L agar, and 50 mg / L kanamycin, 75 mg / L chloramphenicol, and 50 mg / L rifampin. The Agrobacterium-streaked plate was incubated at 28°C for approximately 2 days until colonies formed. Colonies were collected using a spreader and transferred to a fresh fixed YEP plate containing the same antibiotics, and incubated overnight at 28°C. Fresh Agrobacterium was suspended in a liquid co-culture medium (LCCM) containing a 1 / 2 Murashige & Skoog Basal Salt Mixture (Plant Technology Laboratory, M524, Lenexa, Kansas, USA), 3.9 g / L 2-(N-morpholino)ethanesulfonic acid (MES), 30 g / L sugar, 1 mL / L Gamberg vitamin solution, 150 mg / L dl-dithiothreitol (DTT), 2 mg / L zeatin, and 40 mg / L 3′,5′-dimethoxy-4-hydroxyacetophenone (AS) (pH 5.4). A final optical density of 0.6 was measured at 600 nm, and Agrobacterium cultures were prepared for transformation.

[0414] C.1.2.4. Infection and Co-culture

[0415] Explants were prepared from one-day-old seedlings. The seed coat was removed by longitudinally cutting along the hilum to separate the cotyledons. The hypocotyl found at the junction of the hypocotyl and cotyledon was excised to obtain semi-seed explants. The explant cuttings were immersed in Agrobacterium for 2 h at 50 rpm. After inoculation, each of the nine cotyledons was placed in a solid co-medium (CCM) containing a 1 / 2 mixture of Mourasig and Skog basal salts, 3.9 g / L MES, 30 g / L sugar, 1 mL / L Gamberg vitamin solution, 150 mg / L DTT, 40 mg / L AS, 2 mg / L zeatin, and 7 g / L agar (pH 5.4) with a Whatman filter paper placed on it, and then incubated at 22°C in the dark for 5 days.

[0416] 1.2.5. Recovery Culture and Selection Culture

[0417] After co-culturing, the explants were then transferred to recovery medium (SIMO) containing 3.1 g / L Gamborghini basal salt mixture, 0.98 g / L LMES, 30 g / L sucrose, 1 mL / L Gamborghini vitamin solution, 150 mg / L cefotaxime, 450 mg / L termethin, 1 mg / L 6-benzylaminopurine (6-BA), and 7 g / L agar (pH 5.7) and incubated at 28°C for 7 days. Seven days after recovery, the explants were transferred to selective medium (SIM6) containing 3.1 g / L Gamborghäuser basal salt mixture, 0.98 g / L MES, 30 g / L sucrose, 1 mL / L Gamborghäuser vitamin solution, 150 mg / L cefotaxime, 450 mg / L termethin, 1 mg / L 6-BA, 7 g / L agar and 6 mg / L glufosinate (pH 5.7) and incubated at 28°C for 21 days.

[0418] C.1.2.6. Bud elongation and rooting

[0419] After selection and culture, cotyledons and brown leaves were excised from the explants. The remaining tissue was transferred to shoot elongation medium (SEM) containing a mixture of 4.0 g / L Mulasig and Skog basal salts, 0.6 g / L MES, 30 g / L sucrose, 1 mL / L Gamberg vitamin solution, 150 mg / L cefotaxime, 450 mg / L termethin, 0.1 mg / L 3-indoleacetic acid (IAA), 0.5 mg / L gibberellic acid (GA), 1 mg / L zeatin, 7 g / L agar, and 6 mg / L glufosinate (pH 5.6) and incubated at 28°C. The medium was changed every two weeks. Simultaneously with changing the SEM, cut off the elongated shoots (5-8 cm) from the base of the buds and immerse the stems in 1 mg / L indole-3-butyric acid (IBA) for 1 min. Then place them in rooting medium (RCM) containing a 1 / 2 mixture of Mourasig and Skog base salts, 0.6 g / L MES, 20 g / L sucrose, 1 mL / L Gamberg vitamin solution, 7 g / L agar, and 3 mg / L glufosinate (pH 5.7) and incubate at 28°C for 7 days. After rooting, transfer the plants to pots and grow them in a greenhouse.

[0420] C.1.3 Screening for gmft5a mutant plants by sequencing analysis

[0421] Genomic DNA was extracted from the leaves of each individual plant in the T0 generation, and then the region across the target site was analyzed using Phanta. ® Ultra-fidelity DNA polymerase (Vazyme Biotech) was used for PCR amplification with the GmFT5a forward primer (5'-ATCGACCGATCGAGGACAAC-3', SEQ ID NO: 41) and reverse primer (5'-TGGGAGACTACAGAAGCAAAGA-3', SEQ ID NO: 42), followed by purification using the Zymoclean™ gel DNA recovery kit and sequencing by Tsingke (Beijing). Different types of gene editing can be identified by sequence peaks. Short base insertions or deletions induced by CRISPR / Cas9 (not multiples of three) result in frameshift mutations. Heterozygous mutations show overlapping peaks from the target site to the ends. Wild-type and homozygous mutations do not have overlapping peaks at the target site. Homozygous mutants were then identified by sequence alignment with wild-type sequences. This method was also used for T1 and T2 generations. In this study, we detected only one type of homozygous mutation at the target site of GmFT5a in generation T1. The mutation type (SEQ ID NO: 15) was a 1-bp insertion (4 to 5 bp, with the A in the start codon ATG considered to be position 1).

[0422] C.1.4 Phenotypic characteristics of gmft5a mutant plants under different photoperiods

[0423] To verify whether GmFT5a is involved in regulating photoperiodic flowering, wild-type (WT) plants and gmft5a mutants were grown under long-day (LD, 16 h light / 8 h dark) and short-day (SD, 12 h light / 12 h dark) photoperiodic conditions. Flowering time for each soybean plant was recorded as the number of days from emergence to stage R1 (the first flower appearing at any node on the main stem). Maturity time was recorded as the number of days from emergence to stages R7 (any pods turning mature color) and R8 (95% of pods turning mature color). Statistical analysis and significance tests were performed using Microsoft Excel. Significance between control and treatment was considered at the 0.01 probability level. Flowering and maturity times are shown as mean ± standard deviation. Under SD conditions, the flowering time of the gmft5a mutant was almost identical to that of the WT plants (20.4 ± 0.5 DAE for the gmft5a mutant versus 21.0 ± 0.5 DAE for WT). The maturation time of the gmft5a mutant at stage R7 was 66.6 ± 1.3 DAE for the gmft5a mutant and 67.3 ± 1.0 DAE for the WT. The maturation time of the gmft5a mutant at stage R8 was 71.5 ± 1.4 DAE for the gmft5a mutant and 72.6 ± 0.5 DAE for the WT (Table C.1.1). Under LD conditions, the gmft5a mutant showed a flowering time approximately 44 days later than the WT plants (87.3 ± 1.0 DAE for the gmft5a mutant and 43.6 ± 1.4 DAE for the WT). The gmft5a mutant showed a maturation time approximately 28 days later in the R7 stage (175.8 ± 2.1 DAE for gmft5a mutants compared to 147.0 ± 2.5 DAE for WT) and approximately 57 days later in the R8 stage (204.8 ± 2.9 DAE for gmft5a mutants compared to 163.1 ± 4.1 DAE for WT) (Table C.1.2). These results indicate that CRISPR / Cas9-mediated directed mutagenesis of gmft5a slows down flowering and maturation of soybean under LD conditions.

[0424] Table C.1.1 Phenotypes of WT and gmft5a plants under SD conditions.

[0425]

[0426] Table C.1.2 Phenotypes of WT and gmft5a plants under LD conditions.

[0427]

[0428] This indicates that p < 0.01.

[0429] C.2: CRISPR / Cas9-mediated gmELF3 directed mutagenesis slows down soybean flowering

[0430] C.2.1 SgRNA Design and Construction of CRISPR / Cas9 Expression Vector

[0431] The genome sequence of GmELF3 (SEQ ID NO:7) was obtained from the Phytozome database based on the Glyma.04G050200 gene located on chromosome 4. The target site of GmELF3 (GmELF3-TS) was designed using CRISPR-P software (World Wide Web, cbi.hzau.edu.cn / cgi-bin / CRISPR). The sequence of GmELF3-TS is AAGGATGATGAGAAGGTGATGGG (SEQ ID NO: 43).

[0432] To obtain the CRISPR / Cas9-GmELF3 vector, GmELF3-TS (GmELF3-significant: 5'-TTG) was synthesized. AAGGATGATGAGAAGGTGAT -3', SEQ ID NO: 44; GmELF3-Antonym: 5'-AAC ATCACCTTCTCATCATCCTT Primers (-3', SEQ ID NO: 45, and the underlined area represents the target site) were used to polymerize the mixture into a double strand, which was then subcloned into a CRISPR / Cas9 vector (Vishang Lide Biotechnology Co., Ltd., VK005-15, Beijing) using T4 ligase. The recombinant vector was confirmed by sequencing and named CRISPR / Cas9-GmELF3. CRISPR / Cas9-GmELF3 was then transformed into Agrobacterium EHA105 strain by electroporation, which was verified by PCR and sequencing. The PCR reaction system was as follows: 2×Taq master mixture, 12.5 μL; bacterial culture (200 ng / μL), 1 μL; Cas9-F (10 pmol / μL), 1 μL; Cas9-R (10 pmol / μL), 1 μL; ddH2O 9.5 μL, total volume 25 μL. The PCR reaction was set as follows: 94°C for 3 min; 94°C for 30 s, 55°C for 30 s, and 72°C for 1 min, for 35 cycles; and a final extension at 72°C for 10 min.

[0433] C.2.2 Conversion of CRISPR / Cas9-GmELF3 in Soybeans

[0434] See C.1.2.

[0435] C.2.3 Screening for gmELF3 mutant plants by sequencing analysis

[0436] Genomic DNA was extracted from the leaves of each individual plant in the T0 generation, and then the region across the target site was analyzed using Phanta. ® Ultra-fidelity DNA polymerase (Vazyme Biotech) was used for PCR amplification with GmELF3 forward primer (5'-CTCACGAGTTCAGTTCTGTAC-3', SEQ ID NO: 46) and reverse primer (5'-CAGAACACCTGAATTGAACC-3', SEQ ID NO: 47), followed by purification using the Zymoclean™ gel DNA recovery kit and sequencing by Tsingke (Beijing). Different types of gene editing can be identified by sequence peaks. Short base insertions or deletions induced by CRISPR / Cas9 (not multiples of three) result in frameshift mutations. Heterozygous mutations show overlapping peaks from the target site to the ends. Wild-type and homozygous mutations do not have overlapping peaks at the target site. Homozygous mutants were then identified by sequence alignment with wild-type sequences. This method was also used for T1 and T2 generations. In this study, we detected only one type of homozygous mutation at the GmELF3 target site in the T1 generation. The mutant (SEQ ID NO:17) is a 1-bp insertion (29, where the A of the start codon ATG is considered to be position 1).

[0437] C.2.4 Phenotypic characteristics of gmELF3 mutant plants under different photoperiods

[0438] To verify whether GmELF3 is involved in regulating photoperiodic flowering, wild-type (WT) plants and gmELF3 mutants were grown under long-day (LD, 16 h light / 8 h dark) and short-day (SD, 12 h light / 12 h dark) photoperiodic conditions. Flowering time for each soybean plant was recorded as the number of days from emergence to stage R1 (the first flower appearing at any node on the main stem). Maturity time was recorded as the number of days from emergence to stages R7 (any pods turning mature color) and R8 (95% of pods turning mature color). Statistical analysis and significance tests were performed using Microsoft Excel. Significance between control and treatment was considered at the 0.01 probability level. Flowering and maturity times are shown as mean ± standard deviation. Under SD conditions, the gmELF3 mutant showed approximately 2 days later flowering time compared to WT plants (23.5 ± 1.1 DAE for gmELF3 mutants vs. 21.0 ± 0.5 DAE for WT). The maturation time of the gmELF3 mutant at stage R7 was 65.8 ± 1.3 DAE for the gmELF3 mutant and 67.3 ± 1.0 DAE for the WT. The maturation time of the gmELF3 mutant at stage R8 was 73.4 ± 0.5 DAE for the gmELF3 mutant and 72.6 ± 0.5 DAE for the WT (Table C.2.1). Under LD conditions, the gmELF3 mutant showed a flowering time approximately 4 days later than the WT plants (47.5 ± 0.5 DAE for the gmELF3 mutant and 43.6 ± 1.4 DAE for the WT). The gmELF3 mutant showed a maturation time approximately 5 days later in the R7 stage (152.9 ± 8.0 DAE for gmELF3 mutants compared to 147.0 ± 2.5 DAE for WT) and approximately 7 days later in the R8 stage (170.3 ± 3.6 DAE for gmELF3 mutants compared to 163.1 ± 4.1 DAE for WT) (Table C.2.2). These results indicate that CRISPR / Cas9-mediated gmELF3 directed mutagenesis slows down flowering and maturation in soybean under SD and LD conditions.

[0439] Table C.2.1 Phenotypes of WT and gmELF3 plants under SD conditions.

[0440]

[0441] Table C.2.2 Phenotypes of WT and gmELF3 plants under LD conditions.

[0442]

[0443] This indicates that p < 0.01.

[0444] C.3: In soybeans, CRISPR / Cas9-mediated gmft5a ELF3 directed mutagenesis is expressed very late.

[0445] C.3.1 Generation of the gmft5a ELF3 double mutant

[0446] To generate the gmft5a ELF3 double mutant, we used a T1 homozygous gmft5a mutant (1-bp insertion) as the male parent and a gmELF3 mutant (5-bp deletion) as the female parent for hybridization. F2 plants were obtained through self-pollination. Genomic DNA was extracted from the leaves of each individual F2 plant. The region spanning the target sites of GmFT5a or GmELF3 was then amplified by PCR using Phanta® Ultra Fidelity DNA Polymerase (Novizan Biotechnology Co., Ltd.) with GmFT5a forward primer (5'-ATCGACCGATCGAGGACAAC-3', SEQ ID NO: 41) and reverse primer (5'-TGGGAGACTACAGAAGCAAAGA-3', SEQ ID NO: 42), and GmELF3 forward primer (5'-CTCACGAGTTCAGTTCTGTAC-3', SEQ ID NO: 46) and reverse primer (5'-CAGAACACCTGAATTGAACC-3', SEQ ID NO: 47). The DNA was purified using the Zymoclean™ Gel DNA Recovery Kit and sequenced by Qingke Biotechnology Co., Ltd. (Beijing). Homozygous gmft5a ELF3 double mutants were used for subsequent experiments.

[0447] C.3.2 Phenotypic characteristics of gmft5a ELF3 mutant plants under different photoperiods

[0448] To verify whether GmFT5a and GmELF3 are involved in regulating photoperiodic flowering, wild-type (WT) plants and gmft5a ELF3 mutants were grown under long-day (LD, 16 h light / 8 h dark) and short-day (SD, 12 h light / 12 h dark) photoperiodic conditions. Flowering time for each soybean plant was recorded as the number of days from emergence to stage R1 (the first flower appearing at any node on the main stem). Maturity time was recorded as the number of days from emergence to stages R7 (any pods turning mature color) and R8 (95% of pods turning mature color). Statistical analysis and significance tests were performed using Microsoft Excel. Significance between control and treatment was considered at the 0.01 probability level. Flowering and maturity times are shown as mean ± standard deviation. Under SD conditions, the gmft5a ELF3 mutant showed a flowering time approximately 3 days later than WT plants (24.5 ± 0.8 DAE for gmft5a ELF3 mutant, compared to 21.0 ± 0.5 DAE for WT). The maturity time at R7 stage for the gmft5a ELF3 mutant was 66.9 ± 1.0 DAE for gmft5a ELF3 mutant, compared to 67.3 ± 1.0 DAE for WT. The maturity time at R8 stage for the gmft5a ELF3 mutant was 71.1 ± 2.1 DAE for gmft5a ELF3 mutant, compared to 72.6 ± 0.5 DAE for WT (Table C.3.1). Under LD conditions, the gmft5a ELF3 mutant showed a flowering time approximately 49 days later than WT plants (92.3 ± 1.8 DAE for gmft5a ELF3 mutant, compared to 43.6 ± 1.4 DAE for WT). The gmft5a ELF3 mutant showed a maturation time approximately 34 days later in the R7 stage (181.3 ± 4.3 DAE for the gmft5a ELF3 mutant compared to 147.0 ± 2.5 DAE for the WT) and approximately 51 days later in the R8 stage (214.5 ± 6.7 DAE for the gmft5a ELF3 mutant compared to 163.1 ± 4.1 DAE for the WT) (Table C.3.2). These results indicate that CRISPR / Cas9-mediated directed mutagenesis of gmft5a ELF3 slows down flowering and maturation of soybean under LD conditions.

[0449] Table C.3.1 Phenotypes of WT and gmft5a ELF3 plants under SD conditions.

[0450]

[0451] Table C.3.2 Phenotypes of WT and gmft5a ELF3 plants under LD conditions.

[0452]

[0453] This indicates that p < 0.01.

Claims

1. A method for generating soybean plants with modified maturity time or modified flowering time, the method comprising introducing a mutation at a first locus of FT2a, FT2b, FT5a and ELF3 loci selected from the genome of a soybean plant, and selecting plants with modified maturity time or modified flowering time relative to control plants.

2. The method of claim 1, wherein the method further comprises introducing a mutation at a second locus of the FT2a, FT2b, FT5a and ELF3 loci selected from the genome of the soybean plant, and selecting plants having mutations at the first locus and the second locus.

3. The method of claim 1, wherein the mutation is selected from: i. The mutant allele at the FT2a locus is optionally inserted 1-bp relative to nucleotide position 153 of SEQ ID NO: 10; ii. The mutant allele at the FT2b locus, optionally with a 4-bp deletion at nucleotide positions 10-13 of SEQ ID NO: 12; iii. The mutant allele at the FT5a locus is optionally inserted at nucleotide position 2 relative to SEQ ID NO: 14, with a 1-bp insertion. iv. The mutant allele at the ELF3 locus, optionally inserted 1-bp at nucleotide position 28 relative to SEQ ID NO: 16; or v. The mutant allele at the ELF3 locus, optionally with a 5-bp deletion at nucleotide positions 24-28 of SEQ ID NO:

16.

4. The method of claim 2, wherein the mutation is selected from: i. The mutant allele at the FT2a locus is optionally inserted at nucleotide position 153 of SEQ ID NO: 10; and the mutant allele at the FT2b locus is optionally deleted at nucleotide positions 10-13 of SEQ ID NO:

12. ii. The mutant allele at the FT2a locus is optionally inserted 1-bp relative to nucleotide position 153 of SEQ ID NO: 10; and the mutant allele at the FT5a locus is optionally inserted 1-bp relative to nucleotide position 2 of SEQ ID NO: 14; iii. The mutant allele at the FT2a locus is optionally inserted 1-bp relative to nucleotide position 153 of SEQ ID NO: 10; and the mutant allele at the ELF3 locus is optionally inserted 1-bp relative to nucleotide position 28 of SEQ ID NO: 16; iv. The mutant allele at the FT2a locus, optionally inserted at nucleotide position 153 of SEQ ID NO: 10; and the mutant allele at the ELF3 locus, optionally deleted at nucleotide positions 24-28 of SEQ ID NO: 16; v. The mutant allele at the FT2b locus, optionally with a 4-bp deletion at nucleotide positions 10-13 of SEQ ID NO: 12; and the mutant allele at the FT5a locus, optionally with a 1-bp insertion at nucleotide position 2 of SEQ ID NO: 14; vi. The mutant allele at the FT2b locus is optionally deleted at nucleotide positions 10-13 of SEQ ID NO: 12 by 4-bp; and the mutant allele at the ELF3 locus is optionally inserted at nucleotide position 28 of SEQ ID NO: 16 by 1-bp. vii. The mutant allele at the FT2b locus, optionally with a 4-bp deletion at nucleotide positions 10-13 of SEQ ID NO: 12; and the mutant allele at the ELF3 locus, optionally with a 5-bp deletion at nucleotide positions 24-28 of SEQ ID NO: 16; viii. The mutant allele at the FT5a locus is optionally inserted 1-bp relative to nucleotide position 2 of SEQ ID NO: 14; and the mutant allele at the ELF3 locus is optionally inserted 1-bp relative to nucleotide position 28 of SEQ ID NO: 16; or ix. The mutant allele at the FT5a locus, optionally with a 1-bp insertion at nucleotide position 2 of SEQ ID NO: 14; and the mutant allele at the ELF3 locus, optionally with a 5-bp deletion at nucleotide positions 24-28 of SEQ ID NO:

16.

5. The method of any one of claims 1-4, wherein the mutation is selected from: i. The mutated allele at the FT2a locus; ii. The mutant allele at the FT2a locus and the mutant allele at the FT2b locus; iii. The mutant allele at the FT2a locus and the mutant allele at the ELF3 locus; iv. The mutated allele at the FT2b locus; v. The mutated allele at the FT5a locus; vi. The mutant alleles at the FT5a locus and the mutant alleles at the ELF3 locus; or vii. The mutated allele at the ELF3 locus.

6. The method of claim 5, wherein i. The mutated allele at the FT2a locus corresponds to SEQ ID NO: 11; ii. The mutated allele at the FT2a locus corresponds to SEQ ID NO: 11, and the mutation at the FT2b locus corresponds to SEQ ID NO: 13; iii. The mutant allele at the FT2a locus corresponds to SEQ ID NO: 11, and the mutant allele at the ELF3 locus corresponds to SEQ ID NO: 17; iv. The mutated allele at the FT2b locus corresponds to SEQ ID NO: 13; v. The mutated allele at the FT5a locus corresponds to SEQ ID NO: 15; vi. The mutant allele at the FT5a locus corresponds to SEQ ID NO: 15, and the mutant allele at the ELF3 locus corresponds to SEQ ID NO: 18; or vii. The mutated allele at the ELF3 locus corresponds to SEQ ID NO: 17 or 18.

7. The method of any one of claims 1-6, wherein the introduction comprises transforming plant cells with an expression cassette, the expression cassette comprising: (i) the nucleic acid encoding the site-directed nuclease; and (ii) A nucleic acid encoding at least one guide RNA (gRNA) targeting a target sequence at the FT2a, FT2b, FT5a, or ELF3 locus.

8. The method of claim 8, wherein the nucleic acid encoding a site-directed nuclease is operatively linked to a first promoter of the expression cassette, and wherein the nucleic acid encoding at least one gRNA is operatively linked to a second promoter of the expression cassette.

9. The method of claim 8, wherein the expression box further comprises an enhancer operatively connected to the first promoter or the second promoter.

10. The method of any one of claims 1-9, wherein the site-directed nuclease is selected from the group consisting of: mega-nucleases (MN), zinc finger nucleases (ZFN), transcription activator-like effector nucleases (TALEN), Cas9 nucleases, Cfp1 nucleases, dCas9-Fokl, dCpf1-Fokl, chimeric Cas9-cytidine deaminase, chimeric Cas9-adenine deaminase, chimeric FEN1-Fokl, and Mega-TAL, nickase Cas9 (nCas9), chimeric dCas9 non-Fokl nucleases, and dCpf1 non-Fokl nucleases.

11. The method of claim 1, wherein the mutation introduced into the FT2a, FT2b, FT5a, or ELF3 locus is selected from allelic substitution, insertion of one or more nucleotides, or deletion of one or more nucleotides.

12. The method of any one of claims 1-11, wherein the modification specifying the flowering time and / or maturity time includes specifying the number of days that the flowering time and / or maturity time of the offspring plant is shortened relative to the control plant.

13. The method of claim 12, wherein specifying the change in flowering time includes a reduction in the number of days between the VE stage and the R1 stage of the progeny plant relative to the control plant, and / or wherein specifying the change in maturity time includes a reduction in the number of days between the R1 stage and the R7 or R8 stage of the progeny plant relative to the control plant.

14. The method of claim 7, wherein the introduction further comprises: Transformed T0 plants are regenerated from transformed plant cells, the transformed T0 plants having multiple T1 seeds, wherein the multiple T1 seeds contain multiple unique edits in the FT2a, the FT2b, the FT5a and / or the ELF3 locus; Multiple T1 plants grow from the T1 seed; as well as The T1 plant is self-pollinated for one or more generations to obtain offspring plants in which the mutations introduced at the FT2a, FT2b, FT5a and / or ELF3 loci are homozygous.

15. The method of claim 14, wherein the flowering time of the mutant progeny plant is shorter than that of the control plant.

16. The method of claim 14, wherein the relative maturity group value of the edited progeny plant is different from the relative maturity group value of the control plant.

17. A mutated progeny plant of any one of claims 1-16.

18. A further progeny plant of the mutant progeny plant as described in claim 17, wherein the further progeny plant is obtained by breeding or self-pollination.

19. A non-naturally occurring soybean plant having a modified flowering time, said non-naturally occurring soybean plant comprising one or more allelic variations selected from: i. A mutant allele at the FT2a locus, optionally inserted at nucleotide position 153 relative to SEQ ID NO: 10; ii. A mutant allele at the FT2b locus, optionally with a 4-bp deletion at nucleotide positions 10-13 relative to SEQ ID NO: 12; iii. A mutant allele at the FT5a locus, optionally inserted at nucleotide position 2 relative to SEQ ID NO: 14; iv. The mutant allele at the ELF3 locus, optionally inserted at nucleotide position 28 relative to SEQ ID NO: 16, is inserted as a 1-bp insertion; or The mutant allele at the v.ELF3 locus, optionally with a 5-bp deletion at nucleotide positions 24-28 of SEQ ID NO:

16.

20. The non-naturally occurring soybean plant as described in claim 19, wherein the allelic variation is selected from: i. The mutant allele at the FT2a locus is optionally inserted at nucleotide position 153 of SEQ ID NO: 10; and the mutant allele at the FT2b locus is optionally deleted at nucleotide positions 10-13 of SEQ ID NO:

12. ii. The mutant allele at the FT2a locus is optionally inserted 1-bp relative to nucleotide position 153 of SEQ ID NO: 10; and the mutant allele at the FT5a locus is optionally inserted 1-bp relative to nucleotide position 2 of SEQ ID NO: 14; iii. The mutant allele at the FT2a locus is optionally inserted 1-bp relative to nucleotide position 153 of SEQ ID NO: 10; and the mutant allele at the ELF3 locus is optionally inserted 1-bp relative to nucleotide position 28 of SEQ ID NO: 16; iv. The mutant allele at the FT2a locus, optionally inserted at nucleotide position 153 of SEQ ID NO: 10; and the mutant allele at the ELF3 locus, optionally deleted at nucleotide positions 24-28 of SEQ ID NO: 16; v. The mutant allele at the FT2b locus, optionally with a 4-bp deletion at nucleotide positions 10-13 of SEQ ID NO: 12; and the mutant allele at the FT5a locus, optionally with a 1-bp insertion at nucleotide position 2 of SEQ ID NO: 14; vi. The mutant allele at the FT2b locus is optionally deleted at nucleotide positions 10-13 of SEQ ID NO: 12 by 4-bp; and the mutant allele at the ELF3 locus is optionally inserted at nucleotide position 28 of SEQ ID NO: 16 by 1-bp. vii. The mutant allele at the FT2b locus, optionally with a 4-bp deletion at nucleotide positions 10-13 of SEQ ID NO: 12; and the mutant allele at the ELF3 locus, optionally with a 5-bp deletion at nucleotide positions 24-28 of SEQ ID NO: 16; viii. The mutant allele at the FT5a locus is optionally inserted 1-bp relative to nucleotide position 2 of SEQ ID NO: 14; and the mutant allele at the ELF3 locus is optionally inserted 1-bp relative to nucleotide position 28 of SEQ ID NO: 16; or ix. The mutant allele at the FT5a locus, optionally with a 1-bp insertion at nucleotide position 2 of SEQ ID NO: 14; and the mutant allele at the ELF3 locus, optionally with a 5-bp deletion at nucleotide positions 24-28 of SEQ ID NO:

16.

21. The non-naturally occurring soybean plant as described in claim 19, wherein the allele variation is selected from: i. The mutated allele at the FT2a locus; ii. The mutant allele at the FT2a locus and the mutant allele at the FT2b locus; iii. The mutant allele at the FT2a locus and the mutant allele at the ELF3 locus; iv. The mutated allele at the FT2b locus; v. The mutated allele at the FT5a locus; vi. The mutant alleles at the FT5a locus and the mutant alleles at the ELF3 locus; or vii. The mutated allele at the ELF3 locus.

22. The method of claim 21, wherein i. The mutated allele at the FT2a locus corresponds to SEQ ID NO: 11; ii. The mutated allele at the FT2a locus corresponds to SEQ ID NO: 11, and the mutation at the FT2b locus corresponds to SEQ ID NO: 13; iii. The mutant allele at the FT2a locus corresponds to SEQ ID NO: 11, and the mutant allele at the ELF3 locus corresponds to SEQ ID NO: 17; iv. The mutated allele at the FT2b locus corresponds to SEQ ID NO: 13; v. The mutated allele at the FT5a locus corresponds to SEQ ID NO: 15; vi. The mutant allele at the FT5a locus corresponds to SEQ ID NO: 15, and the mutant allele at the ELF3 locus corresponds to SEQ ID NO: 18; or vii. The mutated allele at the ELF3 locus corresponds to SEQ ID NO: 17 or 18.

23. The non-naturally occurring soybean plant according to any one of claims 19-22, wherein the allelic variation is introduced via genomic modification using a site-directed nuclease.

24. A breeding method, the breeding method comprising: Hybridize the non-naturally occurring soybean plant as described in any one of claims 19-23 with different soybean plants that do not contain allele combinations of the non-naturally occurring soybean plant; as well as Select offspring plants with modified flowering times.

25. The non-naturally occurring soybean plant or a plant part thereof as claimed in any one of claims 19-23, wherein the modified plant has a shorter flowering time than the control plant.

26. The non-naturally occurring soybean plant or a plant part thereof as claimed in claim 25, wherein the shorter flowering time comprises fewer days between the VE phase and the R1 phase of the modified plant relative to the control plant.

27. The non-naturally occurring soybean plant or plant part thereof as claimed in any one of claims 19-23, wherein the modified plant has a shorter maturation time than the control plant.

28. The non-naturally occurring soybean plant or a plant part thereof as claimed in claim 27, wherein the shorter maturation time comprises fewer days between the R1 and R7 stages of the modified plant relative to the control plant.

Images