Pichia kudriavzevii PK-Y3 capable of degrading ethyl acetate and application thereof

Abstract

The application provides a Pichia kudriavzevii PK-Y3 capable of degrading ethyl acetate and an application thereof, and belongs to the technical field of microorganisms. The Pichia kudriavzevii PK-Y3 capable of utilizing ethyl acetate is screened from a microbial perspective. The maximum tolerance concentration of the strain to ethyl acetate is 3.5%, and the strain grows well under the condition of 2.0%, which indicates that the strain has a certain ethyl acetate utilization basis. The strain does not grow obviously in the culture medium with ethyl butyrate and ethyl hexanoate as carbon sources, and can grow normally when ethyl acetate is used as the carbon source, which indicates that the utilization of different ester substrates by the strain has certain differences, and can provide an experimental basis for the subsequent research on the regulation of ethyl acetate in a liquor fermentation system.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, and in particular relates to a strain of Pichia kudrica PK-Y3 that can degrade ethyl acetate and its applications. Background Technology

[0002] The flavor quality of strong-aroma baijiu mainly depends on the various volatile flavor compounds formed during fermentation, among which esters are key components determining the aroma characteristics and typical style of the liquor. Ethyl hexanoate, ethyl acetate, ethyl lactate, and ethyl butyrate collectively constitute the aroma basis of strong-aroma baijiu, but different esters play different roles in the liquor. Ethyl hexanoate is generally considered an important contributor to the main aroma of strong-aroma baijiu, reflecting the cellar aroma, grain aroma, and typical strong aroma characteristics. Ethyl acetate has more pronounced fruity and initial aroma characteristics; when present in appropriate amounts, it can enhance the aroma release of the liquor. However, when its content is too high or the ratio with ethyl hexanoate is unbalanced, it can easily cause problems such as an overly strong initial aroma, a sharp aroma, an unprominent main aroma, and an uncoordinated aftertaste, thus affecting the quality of the base liquor and the stability of the finished liquor's style.

[0003] In actual production, excessive ethyl acetate is a common quality problem in the brewing of strong-aroma baijiu. Factors such as the commissioning of new cellars, insufficient aging of cellar mud, unstable cellar microecology, abnormal acidity of the mash, changes in dissolved oxygen conditions, and fluctuations in the quality of the starter culture can all lead to an imbalance in acid and ester production metabolism, resulting in excessive accumulation of ethyl acetate. Especially when the phenomenon of "ethyl acetate greater than hexanoate" occurs, the initial aroma of ethyl acetate in the liquor will mask the main aroma represented by ethyl hexanoate, weakening the cellar aroma and fullness that strong-aroma baijiu should have. Therefore, reducing the abnormally accumulated ethyl acetate is not simply about reducing a certain aroma component, but about restoring the harmonious ratio between the main esters, highlighting the main style of strong-aroma baijiu, and improving the harmony and typicality of the liquor.

[0004] Currently, to address the issue of excessive ethyl acetate levels, production often involves adjusting fermentation processes, maintaining fermentation pits, optimizing starter cultures, extending storage time, or subsequent blending. While these methods can alleviate flavor imbalances to some extent, they are mostly indirect control or post-processing measures, suffering from long treatment cycles, insufficient targeting, significant susceptibility to production environment fluctuations, and difficulty in directly treating already formed ethyl acetate. In particular, subsequent blending often consumes a large amount of high-quality base liquor, increasing production costs, and cannot fundamentally solve the problem of abnormal ethyl acetate accumulation in the fermentation system.

[0005] Therefore, screening functional strains capable of utilizing or degrading ethyl acetate from a microbial perspective and establishing bioregulation methods for ethyl acetate is of significant research value and application significance. If the strain can grow using ethyl acetate as a carbon source and has weak utilization of other important aroma esters such as ethyl butyrate and ethyl hexanoate, it is expected to reduce the impact on the main aroma components while decreasing ethyl acetate levels, thereby improving the selectivity of regulation. Summary of the Invention

[0006] In view of this, the purpose of this invention is to provide a strain of *Pichia kudriezvichi* PK-Y3 capable of degrading ethyl acetate and its applications. This invention screens *Pichia kudriezvichi* PK-Y3 capable of degrading ethyl acetate from vinegar mash, and investigates its tolerance, substrate utilization characteristics, and conditions of action. This provides a new strain resource and experimental basis for the targeted regulation of ethyl acetate in the fermentation system of strong-aroma baijiu, the optimization of the "increase ethyl acetate and decrease ethyl acetate" flavor, and the improvement of base liquor quality.

[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a strain of *Pichia kudriezvichi* PK-Y3 that can degrade ethyl acetate. Pichia kudriavzevii The accession number for PK-Y3 is CGMCC No. 32432.

[0008] This invention provides the application of the aforementioned Kudria zwibbichi yeast PK-Y3 in the degradation of ethyl acetate.

[0009] Preferably, the volume concentration of the ethyl acetate is ≤3.5%.

[0010] Preferably, the pH of the ethyl acetate degradation process is 5.0-7.0, the temperature is 25-35°C, the rotation speed is 100-200 r / min, and the nitrogen source includes tryptone or ammonium sulfate.

[0011] Preferably, the concentration of the *Pichia kudrica* PK-Y3 is 5 × 10⁻⁶. 4 ~5×10 5 CFU / mL.

[0012] This invention provides the application of the aforementioned Kudriazwibich yeast PK-Y3 in brewing, wherein the brewing process includes adjusting the ethyl acetate content in the wine.

[0013] Compared with the prior art, the present invention has the following beneficial effects: This invention provides a strain of Pichia kudrizia PK-Y3 capable of degrading ethyl acetate and its applications. Firstly, from a microbial perspective, this invention screened Pichia kudrizia PK-Y3, which can utilize ethyl acetate. The maximum ethyl acetate concentration tolerated by this strain is 3.5%, with better growth at 2.0%, indicating that this strain possesses a certain foundation for ethyl acetate utilization. This strain did not show significant growth in media using ethyl butyrate and ethyl hexanoate as carbon sources, but it grew normally with ethyl acetate as the carbon source, indicating that its utilization of different ester substrates has certain differences. This provides an experimental basis for subsequent research on the regulation of ethyl acetate in the Baijiu (Chinese liquor) fermentation system. Attached Figure Description

[0014] Figure 1 For technology roadmap; Figure 2 Colony morphology of Pichia kudrica PK-Y3; Figure 3 Microscopic morphology of Pichia kudrica PK-Y3; Figure 4 Phylogenetic tree of *Pichia kudrica* PK-Y3; Figure 5 The growth of Pichia kudrica PK-Y3 under different ethyl acetate concentrations; Figure 6 This is the standard curve for ethyl acetate; Figure 7 Effects of pH on the growth and ethyl acetate degradation of Pichia kudrica PK-Y3; Figure 8 Effects of temperature on the growth and ethyl acetate degradation of Pichia kudrica PK-Y3; Figure 9 Effects of rotational speed on the growth and ethyl acetate degradation of Pichia kudrica PK-Y3; Figure 10 The effect of inoculum size on the growth and ethyl acetate degradation of Pichia gondii PK-Y3; Figure 11 The effects of nitrogen source on the growth and ethyl acetate degradation of Pichia kudrica PK-Y3.

[0015] Biological Preservation Instructions

[0016] The present invention provides the Kudria zweipichia yeast ( Pichia kudriavzeviiPK-Y3 is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 32432, deposited on October 30, 2024, at the Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing. Detailed Implementation

[0017] This invention provides a strain of *Pichia kudriezvichi* PK-Y3, wherein *Pichia kudriezvichi* (… Pichia kudriavzevii The accession number for PK-Y3 is CGMCC No. 32432.

[0018] The ITS sequence of the *Pichia kudrica* PK-Y3 is shown in SEQ ID NO.1; SEQ ID NO.1: TGCTTGTATAGTACTACCTGCGTGAGCGGACGAAACAACAACACCTAAAATGTGGAATATAGCATATAGTCGACAAGAGAAATCTACGAAAAACAAACAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACCTAGTGTGAATTGCAGCCATCGTGAATCATCGAGTTCTTGAACGCACATTGCGCCCCTCGGCATTCCGGGGGGCATGCCTGTTTGAGCGTCGTTTCCATCTTGCGCGTGCGCAGAGTTGGGGGAGCGGAGCGGACGACGTGTAAAGAGCGTCGGAGCTGCGACTCGCCTGAAAGGGAGCGAAGCTGGCCGAGCGAACTAGACTTTTTTTCAGGGACGCTTGGCGGCCGAGAGCGAGTGTTGCGAGACAACAAAAAGCTCGACCTCAAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAAAAGCCCGGGAGGAAGAACTGGCATCTACTGATTTGAGGTCGAGCTTTTTGTTGTCTCGCAACACTCGCTCTCGGCCGCCAAGCGTCCCTGAAAAAAAGTCTAGTTCGCTCGGCCAGCTTCGCTCCCTTTCAGGCGAGTCGCAGCTCCGACGCTCTTTACACGTCGTCCGCTCCGCTCCCCCAACTCTGCGCACGCGCAAGATGGAAACGACGCTCAAACAGGCATGCCCCCCGGAATGCCGAGGGGCGCAATGTGCGTTCAAGAACTCGATGATTCACGATGGCTGCAATTCACACTAGGTATCGCATTTCGCTGCGCTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTGTTTGTTTTTCGTAGATTTCTCTTGTCGACTATATGCTATATTCCACATTTTAGGTGTTGTTGTTTTCGTTCCGCTCACGCAGTGTAGTACTAAATCACAGTAATGATCCTTCCGCAGGTCACCCCTAACGGAA; This invention provides the application of the aforementioned Kudria zwibbichi yeast PK-Y3 in the degradation of ethyl acetate.

[0019] In this invention, the volume concentration of ethyl acetate is preferably ≤3.5%, more preferably 1.0%~2.5%, and even more preferably 2.0%. The pH for degrading ethyl acetate is preferably 5.0~7.0, more preferably 5.5~6.5, and even more preferably 6.0; the temperature is preferably 25~35℃, more preferably 28~32℃, and even more preferably 30℃; the rotation speed is preferably 100~200 r / min, more preferably 130~180 r / min, and even more preferably 160 r / min; the nitrogen source preferably includes tryptone or ammonium sulfate, more preferably tryptone; the concentration of Pichia pastoris PK-Y3 is preferably 5×10⁻⁶. 4 ~5×10 5 CFU / mL, further preferably 1×10⁻⁶ 5 ~4×10 5 CFU / mL, more preferably 3×10⁻⁶ 5 CFU / mL; the *Pichia kudriezvichirosa* PK-Y3 strain further includes an activation step before use: Under aseptic conditions, a typical single colony is picked from the *Pichia kudriezvichirosa* PK-Y3 solid preservation slant using a sterile inoculation loop and inoculated into an Erlenmeyer flask containing 100 ml of sterile liquid YPD medium; activation culture is carried out at 28℃ and 150 r / min for 20 h to obtain the seed stock solution. Viable cell counts of the seed stock solution are performed using the plate plating method, and based on the count results, the viable cell concentration is adjusted to 1×10⁻⁶ using a serial dilution with sterile YPD medium. 7 A standardized inoculum solution was prepared by using CFU / mL. During fermentation, the inoculum solution was inoculated into the brewing fermentation substrate. The inoculation amount was preferably 0.5% to 5% (V / V) of the total liquid volume of the fermentation substrate, more preferably 1% to 4%, and even more preferably 3%.

[0020] This invention provides the application of the aforementioned Kudriazwibich yeast PK-Y3 in brewing, wherein the brewing process includes adjusting the ethyl acetate content in the wine.

[0021] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0022] Source of materials

[0023] The vinegar mother liquor was purchased from Sichuan Taiyuanjing Vinegar Industry Co., Ltd. YPD tablets were purchased from Hunan Bickman Biotechnology Co., Ltd. The WLN-1 tablet was purchased from Hunan Bickman Biotechnology Co., Ltd. Ethyl acetate was purchased from Sinopharm Chemical Reagent Co., Ltd. ITS1 and ITS4 primers were purchased from Beijing Solarbio Technology Co., Ltd. The fungal genomic DNA extraction kit, DNA agarose gel recovery kit, and DNA product purification kit were all purchased from Beijing Solarbio Science & Technology Co., Ltd. Example 1 Screening and purification of Pichia kudrica PK-Y3 The mother liquor from sun-dried vinegar was cultured on YPD plates, WLN-1 plates, and ethyl acetate-based screening plates at 28–30°C. After colonies appeared on the plates, yeast-like colonies were picked and further purified by streaking. This purification process was repeated 3–5 times to obtain single colonies with consistent morphology.

[0024] During the isolation process, the focus was on yeast-like strains that could form colonies on the basic screening plates, and these strains were further observed for morphology and screened again. PK-Y3 was one of the target strains screened out.

[0025] PK-Y3 colonies on YPD plates are milky white, with a moist surface, a certain gloss, and relatively neat edges; under a microscope, the cells are mostly oval or short elliptical, and budding is the dominant mode of reproduction (e.g., ...). Figure 2 and Figure 3 ).

[0026] Example 2

[0027] Molecular identification of Pichia kudrica PK-Y3

[0028] After extracting PK-Y3 genomic DNA, the ITS region (SEQ ID NO.1) was amplified using ITS1 and ITS4 primers. The amplified products were then detected by electrophoresis and sequenced. The sequenced sequence was compared with relevant sequences in the database using BLAST, and a phylogenetic tree was constructed.

[0029] The results showed that ( Figure 4 PK-Y3 clustered with the reference sequence of *Kudelazvipichia*, which indicates that the strain was identified as *Kudelazvipichia*.

[0030] Example 3

[0031] PK-Y3's tolerance to ethyl acetate and its utilization of different ester substrates

[0032] PK-Y3 cells were inoculated into basal selection media containing 1.0%, 1.5%, 2.0%, 2.5%, 3.0%, 3.5%, 4.0%, 4.5%, and 5.0% ethyl acetate ((NH4)2SO4 1.0 g / L, KH2PO4 1.0 g / L, MgSO4·7H2O 0.5 g / L, yeast extract 0.01 g / L) and cultured at 30 ℃ and 180 r / min for 3 days. Cell growth was then observed. The results showed that ( Figure 5 PK-Y3 can grow under conditions of 1.0% to 3.5% ethyl acetate, with the best growth at 2.0% concentration. When the ethyl acetate concentration reaches 4.0%, the strain basically stops growing, indicating that it has a certain tolerance to ethyl acetate, with an upper limit of about 3.5%.

[0033] Example 4

[0034] Establishment and optimization of ethyl acetate detection method

[0035] A standard curve for ethyl acetate was prepared using the ferric hydroxamate colorimetric method. Ethyl acetate standard solutions of different concentrations were prepared, and the absorbance was measured at 520 nm after color development. The correlation between ethyl acetate concentration and absorbance was established, serving as the basis for subsequent calculation of the remaining ethyl acetate concentration in the culture medium. The results are shown below. Figure 6 As shown.

[0036] Based on the above detection methods, the conditions for PK-Y3 to utilize ethyl acetate were optimized using the bacterial OD600 and the residual concentration of ethyl acetate in the culture medium as indicators. The culture time for all optimization experiments was 72 h. The method for strain activation was as follows: Under aseptic conditions, typical single colonies were picked from the solid preservation slant of *Pichia pastoris* PK-Y3 using a sterile inoculating loop and inoculated into an Erlenmeyer flask containing 100 ml of sterile liquid YPD medium; the culture was activated by shaking at 28℃ and 150 r / min for 20 h to obtain the seed culture. Viable cell counts were performed on the seed culture using the plate spread method. Based on the count results, the viable cell concentration was adjusted to 1×10⁻⁶ using serial dilutions with sterile YPD medium. 7 A standardized inoculum solution was prepared by using CFU / mL. During fermentation, this inoculum solution was inoculated into the brewing fermentation substrate, with the inoculation amount being a percentage of the total liquid volume of the fermentation substrate.

[0037] pH optimization: The pH of the culture medium was adjusted to 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, and 9.0, respectively, and cultured at 30 ℃ and 180 r / min for 72 h. The initial ethyl acetate concentration was 2%, the temperature was 30 ℃, the speed was 180 r / min, and the inoculum size was 1.5% (V / V). The results showed that ( Figure 7At pH 5, 6 and 7, the concentration of ethyl acetate decreased from the initial 227 mmol / L to 90.71 mmol / L, 58.76 mmol / L and 96.82 mmol / L, respectively. The highest ethyl acetate consumption was observed at pH 6, indicating better cell growth.

[0038] Temperature optimization: Cultured at 15, 20, 25, 30, 35, and 40℃ for 72 h, with an initial ethyl acetate concentration of 2%, pH 5.0, 180 r / min, and an inoculum size of 1.5% (V / V). Results showed ( Figure 8 At 15℃, 20℃, 25℃, 30℃, and 35℃, the concentration of ethyl acetate decreased to 86.41 mmol / L, 84.25 mmol / L, 69.89 mmol / L, 44.76 mmol / L, and 74.20 mmol / L, respectively. The lowest residual amount of ethyl acetate was observed at 30℃, while the highest OD600 of the bacterial cells was 0.921.

[0039] Rotation speed optimization: The incubation speed was set to 130, 140, 150, 160, 170, 180, and 190 r / min, with an initial ethyl acetate concentration of 2%, pH 5.0, 30℃, and an inoculum size of 1.5% (V / V). The results showed that ( Figure 9 Within the range of 130–160 r / min, the growth and ethyl acetate consumption of PK-Y3 gradually increased with increasing rotation speed; however, when the rotation speed was further increased to 170–190 r / min, both cell growth and ethyl acetate utilization decreased. At 160 r / min, the cell OD600 reached 0.894, and the ethyl acetate concentration decreased from 227 mmol / L to 49.79 mmol / L.

[0040] Inoculum size optimization: Inoculum sizes (V / V) were set to 0.5%, 1.0%, 1.5%, 2.0%, 2.5%, 3.0%, and 3.5%, respectively; initial ethyl acetate concentration was 2%; pH was 5.0; temperature was 30℃; and speed was 180 r / min. Results showed ( Figure 10 As the inoculum size increases, the initial biomass of the strain increases, and its ethyl acetate consumption capacity also increases accordingly. At an inoculum size of 3.5%, ethyl acetate can be reduced to a low level within 24 hours, but the OD value decreases slightly in the later stages of culture; considering both the cell growth status and ethyl acetate consumption, the overall performance is better at 3.0%.

[0041] Nitrogen source optimization: Tryptone, ammonium sulfate, ammonium nitrate, and urea were used as nitrogen sources, with an initial ethyl acetate concentration of 2.0%, pH 6, 30℃, 160 r / min, inoculum size of 3.0%, and a culture time of 72 h. The results showed that ( Figure 11Under tryptone conditions, the bacterial cell OD600 reached 0.942 after 72 h, and the final residual concentration of ethyl acetate was 38.66 mmol / L, indicating the best degradation effect; ammonium sulfate conditions were the second best; ammonium nitrate conditions were average; and urea conditions showed poor bacterial growth and ethyl acetate utilization.

[0042] Based on the above results, within the range of conditions already investigated, the optimal conditions for PK-Y3 using ethyl acetate can be summarized as follows: initial ethyl acetate concentration 2.0%, pH 6, 30 ℃, 160 r / min, inoculum size 3.0%, nitrogen source: tryptone, and culture time 72 h.

[0043] Comparative Example

[0044] In Example 3, ethyl acetate was replaced with ethyl butyrate or ethyl hexanoate, while other aspects remained the same as in Example 3. The results showed that no significant bacterial growth was observed in the culture media using ethyl butyrate and ethyl hexanoate as the sole carbon source, suggesting that PK-Y3 exhibits significant differences in its utilization of different ester substrates under the existing experimental conditions.

[0045] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A strain of Pichia kudrizia PK-Y3 that can degrade ethyl acetate, characterized in that, The Kudriazwibichi yeast ( Pichia kudriavzevii The accession number for PK-Y3 is CGMCC No. 32432.

2. The application of the *Pichia kudrica* PK-Y3 as described in claim 1 in the degradation of ethyl acetate.

3. The application according to claim 2, characterized in that, The volume concentration of the ethyl acetate is ≤3.5%.

4. The application according to claim 3, characterized in that, The pH of the ethyl acetate degradation process is 5.0-7.0, the temperature is 25-35℃, the rotation speed is 100-200 r / min, and the nitrogen source includes tryptone or ammonium sulfate.

5. The application according to claim 4, characterized in that, The concentration of the *Pichia kudrica* PK-Y3 was 5 × 10⁻⁶. 4 ~5×10 5 CFU / mL.

6. The application of the Kudriazwijki yeast PK-Y3 as described in claim 1 in brewing, characterized in that, The brewing process includes adjusting the ethyl acetate content in the wine.

Images