Lactobacillus sakei st084 with antibacterial and probiotic activities and application thereof

Abstract

The application discloses a lactobacillus sakei ST084 with antibacterial and probiotic activities and an application thereof, and belongs to the technical field of probiotics. The probiotic strain is lactobacillus sakei ST084, which is preserved in the China General Microbiological Culture Collection Center, and has a preservation number of CGMCC No.35809. The strain has the biological characteristics of fast growth, acid tolerance, bile salt tolerance and strong acid production capacity. The intestinal probiotic characteristics and good safety performance of the strain, such as the antibacterial activity, the antioxidant activity and the adhesion characteristics, make the strain have great application potential. The probiotic strain is applied to the fermentation of a bamboo shoot and taro probiotic beverage, so that the content of flavor substances and soluble dietary fibers in the beverage is increased, the taste and flavor of the beverage are improved, the beverage is rich in active probiotics, and the human health is promoted.

Description

Technical Field

[0001] This invention belongs to the field of probiotic technology, specifically relating to a type of Lactobacillus sakebi ST084 with antibacterial and probiotic properties and its applications. Background Technology

[0002] Probiotics, as a class of live microorganisms that can regulate the balance of the host's intestinal flora, enhance the host's immune function, and improve intestinal health, have shown broad application prospects in the food industry, clinical medicine, and animal husbandry. Especially in the field of fermented foods, the screening and application of probiotics has become a research hotspot. Lactic acid bacteria are the most widely used microbial category among probiotics, widely used in the industrial production of fermented foods such as dairy and meat products, as well as in home fermentation, playing a core fermentation role. Among them, Lactobacillus strains possess diverse physiological functions such as excellent gastrointestinal tolerance, antibacterial activity, and intestinal flora regulation capabilities. Their gastrointestinal tolerance is crucial for probiotics to colonize the host's intestines and exert their beneficial effects, thus becoming a core research focus in the field of probiotics.

[0003] *Lactobacillus cereus*, belonging to the genus *Lactobacillus*, is a typical facultative heterotrophic fermenting lactic acid bacterium that has been proven to possess antibacterial activity and various probiotic functions. In 2014, this strain was officially approved for inclusion in the list of edible microorganisms in China. As a recognized hallmark lactic acid bacterium in meat products, it is primarily used in the production of meat and fermented meat products. However, precisely because of this, current research on this strain is highly focused on strains derived from meat and meat products, while the isolation and functional evaluation of strains derived from vegetables are relatively scarce. This situation has resulted in its application being largely confined to the meat processing field, hindering its expansion into emerging areas such as fermented vegetable foods and plant-based probiotic products, thus restricting the full realization of the strain's industrialization potential.

[0004] In conclusion, screening for Lactobacillus strains widely distributed in sake from vegetable sources and expanding their application scenarios have become urgent technical problems to be solved in the current field of probiotic research. Summary of the Invention

[0005] To address the above issues, the present invention aims to provide a *Lactobacillus cereus* strain with antibacterial activity, its preparation method, and its applications. Through a comprehensive evaluation of the probiotic viability and safety of multiple identified and isolated antibacterial strains, *Lactobacillus cereus* ST084 with the best overall performance was selected. The growth characteristics of this strain and the nature of its antibacterial substances were further determined. Furthermore, the present invention also provides the application of *Lactobacillus cereus* ST084 in the preparation of probiotic beverages. Specifically, this includes the following: This invention provides a probiotic strain with antibacterial activity, namely Lactobacillus sakebi ST084. This probiotic strain was isolated and purified from traditionally fermented vegetables and deposited at the China General Microbiological Culture Collection Center on September 8, 2025, with the accession number CGMCC No. 35809.

[0006] Furthermore, the specific steps for obtaining the *Lactobacillus sacchariformis* with antibacterial and probiotic properties are as follows: Vegetable fermentation food samples are taken and diluted and cultured using MRS medium. White colonies resembling lactic acid bacteria are selected. Through morphological observation and phylogenetic homology analysis of the strains, they are finally identified as *Lactobacillus sacchariformis*. Latilactobacillus sakei It was named Lactobacillus sakebi ST084.

[0007] The Lactobacillus thuringiensis ST084 described above has the following characteristics: (1) Colony morphology: The colonies grown in MRS agar medium are spherical, milky white, protruding upwards, moist, with neat edges and smooth surfaces.

[0008] (2) Microscopic morphology: Gram staining positive, the bacteria are rod-shaped, do not form spores, and have round ends.

[0009] (3) Fermentation kinetics: The fermentation cycle is short, entering the logarithmic growth phase after 4 hours and the stationary phase after 16 hours. It has a strong acid-producing capacity, eventually reducing the pH of the fermentation system to 3.67. The inhibition zone diameters against Escherichia coli and Staphylococcus aureus reached 23.33 mm and 22.33 mm, respectively.

[0010] This invention also provides a comprehensive functional characteristic evaluation of the *Lactobacillus spp.* ST084 used in sake, including the following steps: (1) Determine the probiotic characteristics of the strain: acid and bile salt tolerance, survival rate in simulated gastrointestinal transport, antioxidant capacity, adhesion characteristics, and bile salt hydrolytic enzyme activity; (2) Safety evaluation of the strain: hemolytic activity and antibiotic sensitivity.

[0011] This invention also provides the application of the aforementioned *Lactobacillus thuringiensis* in the preparation of antibacterial products; Specifically, in the antibacterial product, the inhibited bacterial strain is selected from Escherichia coli (E. coli). Escherichia coli Staphylococcus aureus ( Staphylococcus aureus ).

[0012] This invention also provides a method for determining antibacterial substances in the fermentation broth of *Lactobacillus thuringiensis* ST084 in sake, comprising the following steps: (1) Eliminating interference from organic acids: The pH of the fermentation broth was measured, and the pH was adjusted to 3.0, 4.0, 5.0, 6.0, 7.0 and 7.5 with HCl and NaOH solutions before the antibacterial experiment was conducted and the diameter of the inhibition zone was measured; (2) Protease sensitivity test: After adjusting the pH of the fermentation broth to 7.5, proteinase K and trypsin were added respectively. After reacting at 37℃ for 1 hour, the enzymes were inactivated by boiling in a water bath for 5 minutes, and the diameter of the inhibition zone was measured.

[0013] The present invention also provides a microbial preparation containing the above-mentioned Lactobacillus spp. ST084.

[0014] In one embodiment of the present invention, the microbial preparation is a liquid or solid microbial agent containing live cells of Lactobacillus sakebi ST084, or a fermentation broth containing Lactobacillus sakebi ST084.

[0015] In one embodiment of the present invention, the Lactobacillus sakebi ST084 live cells are freeze-dried Lactobacillus sakebi ST084 dried cells or immobilized Lactobacillus sakebi ST084 cells.

[0016] The present invention also provides the application of the above-mentioned *Lactobacillus thuringiensis* ST084 in sake, or its bacterial suspension, or its culture medium, or its fermentation product, or the above-mentioned microbial preparation in the preparation of antibacterial or antioxidant products, or in the preparation of fermented foods.

[0017] In one embodiment of the present invention, the antibacterial effect refers to the inhibition of Escherichia coli (E. coli). Escherichia coli Staphylococcus aureus.

[0018] In one embodiment of the present invention, the product is a pharmaceutical product.

[0019] In one embodiment of the present invention, the pharmaceutical product further contains pharmaceutically acceptable excipients; the pharmaceutical excipients refer to conventional drug carriers in the pharmaceutical field.

[0020] In one embodiment of the present invention, the excipients include one or more of the following: binders such as cellulose derivatives, alginate, gelatin, and polyvinylpyrrolidone; diluents such as starch, pregelatinized starch, dextrin, sucrose, lactose, and mannitol; fillers such as starch and sucrose; humectants such as glycerin; disintegrants such as sodium carboxymethyl starch, cross-linked polyvinylpyrrolidone, and dry starch; absorption promoters such as quaternary ammonium compounds; surfactants such as polysorbate, fatty acid sorbitan, and fatty acid glycerides; colorants such as titanium dioxide, sunset yellow, methylene blue, and pharmaceutical iron oxide red; lubricants such as hydrogenated vegetable oil, talc, and polyethylene glycol; coating materials such as acrylic resin, hydroxypropyl methylcellulose, povidone, and cellulose acetate; and other excipients such as flavoring agents and sweeteners may also be added to the composition.

[0021] In one embodiment of the present invention, the dosage form of the drug includes oral dosage form, injectable dosage form, and inhaled dosage form.

[0022] In one embodiment of the present invention, the oral dosage form includes tablets, capsules, granules, oral liquids, and oral suspensions.

[0023] In one embodiment of the present invention, the injectable dosage form includes an injection solution and an injection powder for injection.

[0024] In one embodiment of the present invention, the inhalation dosage form includes an aerosol or a powder inhaler.

[0025] The present invention also provides a fermentation agent comprising Lactobacillus sacchariformis ST084, or a suspension of Lactobacillus sacchariformis ST084, or a fermentation broth of Lactobacillus sacchariformis ST084.

[0026] This invention also provides a method for preparing a taro and bamboo shoot probiotic beverage. The method includes: mixing bamboo shoot juice, taro paste, white sugar, and skim milk powder, sterilizing and cooling to obtain a fermentation substrate liquid; adding the above-mentioned Lactobacillus thuringiensis ST084 of sake, or its bacterial suspension, or its culture medium, or its fermentation product, or the above-mentioned microbial preparation, or the above-mentioned fermenting agent to the fermentation substrate liquid, and then fermenting to prepare a taro and bamboo shoot probiotic beverage.

[0027] In one embodiment of the present invention, the following steps are included: (1) Preparation of Lactobacillus spp. ST084 for sake brewing; (2) Mix bamboo shoot juice and taro paste in a mass ratio of 6:4 to obtain a mixed liquid; take 2% of the weight of white sugar and 4% of skim milk powder in the mixed liquid, mix them evenly and add them to the mixed liquid, stir and dissolve thoroughly, sterilize at 121℃ for 10 min, cool to 37℃ to obtain fermentation substrate liquid; (3) Add ST084 bacterial suspension to the substrate solution at 0.25% of the volume of the mixed liquid, and ferment in a constant temperature incubator at 37℃ for 12 hours to obtain taro and bamboo shoot probiotic beverage.

[0028] The present invention also provides a taro and bamboo shoot probiotic beverage prepared by the above method.

[0029] Beneficial effects (1) This invention provides a strain of *Lactobacillus spp.* selected from traditional vegetable fermentation products. Latilactobacillus sakeiST084. In vitro functional evaluation showed that this strain possesses both excellent probiotic properties and safety: hemolytic activity and antibiotic susceptibility testing results showed that the strain had no hemolytic activity and was sensitive to most common clinical antibiotics, demonstrating a good safety profile; it exhibited excellent broad-spectrum antibacterial activity against common foodborne pathogens such as *Escherichia coli* and *Staphylococcus aureus* (inhibition zone diameters reached 23.33 mm and 22.33 mm, respectively), effectively inhibiting the proliferation of intestinal pathogens; its self-aggregation rate reached 95.15%, which is conducive to the rapid aggregation of bacteria in the intestinal environment to form a dominant bacterial population, enhancing competitive colonization ability and improving the population survival resistance in gastrointestinal stress environments; simultaneously, this strain has good acid and bile salt tolerance and bile salt hydrolase activity, maintaining a high survival rate in simulated gastrointestinal environments, ensuring that the bacteria successfully reach the intestinal target site to exert their probiotic function; in addition, this strain also has certain antioxidant activity. In terms of fermentation performance, strain ST084 exhibits rapid growth and strong acid production, which facilitates the rapid establishment of dominance in the fermentation system, inhibits contamination by other microorganisms, shortens the fermentation cycle, and reduces production costs. These comprehensive performance indicators demonstrate that strain ST084 possesses excellent adaptability to the gastrointestinal environment and outstanding anti-pathogenic activity, making it a novel probiotic strain with significant development potential.

[0030] (2) The present invention applies the *Lactobacillus thuringiensis* ST084 from sake to the fermentation of plant-based beverages, achieving several positive effects: the strain exhibits good compatibility in bamboo shoot-taro-based plant-based beverages, with a high level of viable bacteria count at the fermentation endpoint, allowing for convenient probiotic supplementation during daily consumption; the total dietary fiber content of the product increases significantly by 10.47% after fermentation, and dietary fiber and probiotics can synergistically enhance the intestinal health promotion effect; in terms of antioxidant performance, the DPPH free radical scavenging rate after fermentation is 72.58% (80.93% before fermentation), and ABTS... + The free radical scavenging rate was 77.67% (79.53% before fermentation), indicating that the strain can maintain the antioxidant activity of plant-based raw materials well during fermentation. At the same time, the types and contents of characteristic flavor substances such as esters and alcohols increased significantly after fermentation, effectively improving the taste harmony and flavor acceptability of the product.

[0031] Preservation of biological materials A strain of Lactobacillus widely distributed in sake ( Latilactobacillus sakei ST084, taxonomically named *Lactobacillus sakebi*. Latilactobacillus sakei It was deposited on September 8, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 35809. The deposit address is No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences. Attached Figure Description

[0032] Figure 1 Colony morphology (A) and Gram staining (B) of Lactobacillus sakebi ST084 provided in the embodiments of the present invention.

[0033] Figure 2 Phylogenetic tree of Lactobacillus sakebi ST084 provided in this embodiment of the invention.

[0034] Figure 3 Fermentation kinetics curves of *Lactobacillus thuringiensis* ST084 for sake production provided in this embodiment of the invention.

[0035] Figure 4 The survival rate of *Lactobacillus sacchariflorus* ST084 in artificially simulated gastrointestinal fluid provided in this embodiment of the invention.

[0036] Figure 5 The effects of different factors on sensory scores are as follows: (A) the effect of the ratio of bamboo shoot juice to taro paste on the sensory score of compound probiotic beverage; (B) the effect of the amount of starter culture added on the sensory score of compound probiotic beverage; and (C) the effect of fermentation time on the sensory score of compound probiotic beverage.

[0037] Figure 6 The effects of different factors on sensory scores are as follows: (A) the effect of the interaction between the amount of taro pulp added and the amount of bamboo shoot juice added on the sensory score of the compound probiotic beverage; (B) the effect of the interaction between the amount of taro pulp added and the amount of starter culture inoculation on the sensory score of the compound probiotic beverage; and (C) the effect of the interaction between the amount of bamboo shoot juice added and the amount of starter culture inoculation on the sensory score of the compound probiotic beverage.

[0038] Figure 7 The results of the scavenging rates of DPPH free radicals and ABTS free radicals of the beverage before and after fermentation with Lactobacillus sp. ST084 in sake provided in the embodiments of the present invention are shown in (A) for DPPH free radical scavenging rate and (B) for ABTS free radical scavenging rate.

[0039] Figure 8 The graphs showing the changes in viable count (A), pH value (B), and titratable acidity (C) of a beverage fermented using Lactobacillus sp. ST084 in sake, provided as an embodiment of the present invention, during storage at 4°C and 25°C. Detailed Implementation

[0040] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0041] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0042] The present invention will now be described in further detail with reference to the illustrations and embodiments.

[0043] The Escherichia coli involved in the following examples is ATCC 25922, and the Staphylococcus aureus is ATCC25923. The above strains have been preserved for a long time in the Food Science and Engineering Laboratory of Kunming University of Science and Technology.

[0044] The culture media involved in the following examples are: MRS medium (purchased from OXOID) and LB medium (purchased from Qingdao Haibo Biotechnology Co., Ltd.).

[0045] Columbia blood platelets: purchased from Guangdong Huankai Microbial Technology Co., Ltd.

[0046] Example 1: Isolation and identification of multiple strains of Lactobacillus saccharidus from sake 1. Isolation and Identification of Strains (1) Samples were collected from fermented vegetables characteristic of Yuxi, Yunnan Province, sealed in sterile boxes, and frozen at -80℃. 100 μL of sample was added to 900 μL of physiological saline, shaken to mix thoroughly, and then serially diluted. 10 μL of the diluted sample was taken. 5 10 6 10 7 The bacterial suspensions were evenly spread onto MRS plates and incubated in an anaerobic incubator at 37°C for 24 h. Colonies morphologically consistent with lactic acid bacteria were selected for streak purification and Gram staining. The colony morphology and Gram staining results are shown below. Figure 1 .

[0047] (2) The above isolates were sent to a sequencing company for 16S rRNA gene sequencing. Universal primers 27F and 5' were used. AGAGTTTGATCCTGGCTCAG 3' vs 1492R: 5' GGTTACCTTGTTACGACTT The 16S rRNA fragment was amplified by 3' PCR and sequenced. The sequencing results were compared with those in the NCBI database, and homology analysis confirmed that this strain is *Lactobacillus sakei* (see [link to article]). Figure 2 ).

[0048] The 16S rDNA sequence is as follows (SEQ ID NO.1): 2. Preservation of microbial strains The selected Lactobacillus sacchariformis ST084 was deposited on September 8, 2025, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with accession number CGMCC No. 35809.

[0049] 3. Fermentation kinetics of the strain (1) Growth and acid production curves The bacterial strain stored at -80℃ was streaked onto MRS solid medium and incubated at 37℃ for 36 h. Single colonies from the plate were picked and inoculated into MRS liquid medium and incubated at 37℃ for 18 h to obtain the activated solution. The activated solution was then transferred to fresh MRS liquid medium at an inoculation rate of 1% (v / v) and incubated for another 18 h under the same conditions. The above transfer operation was repeated once, and the resulting culture medium was the seed culture. The activated seed culture was inoculated into fresh MRS medium at a volume ratio of 1%. During the culture process, samples were collected at predetermined time points to measure their OD values. 600 Value and pH value.

[0050] (2) Antibacterial activity curve The *Lactobacillus spp.* ST084 seed culture obtained in step (1) was inoculated at 1% (v / v) in sterile MRS liquid medium and anaerobically cultured at 37°C for 36 h. Samples were taken at the preset time for growth and acid production curve determination (the growth cycle of the strain needs to be determined first, and then the sampling time for determining the growth and acid production curve is used to determine the antibacterial activity curve). The fermentation broth was filtered through a 0.22 μm filter membrane to obtain the supernatant for later use.

[0051] The antibacterial test was performed using the agar well diffusion method, with *Escherichia coli* and *Staphylococcus aureus* as indicator bacteria. 0.1 mL of indicator bacterial suspension (OD200) was then added to each suspension. 600 ≈0.1) Evenly spread on LB agar plates, make holes using a sterile punch (6.5 mm diameter), and take 100 μL of the prepared *Lactobacillus spp.* ST084 supernatant (the supernatant sample is taken after culturing to an OD concentration of 100 μL). 600 The supernatant obtained after filtration of the fermentation broth (≈2.0) was added to the well; the petri dish was placed upright at 4℃ for 2 h, and then incubated at 37℃ for 10 h. The size of the inhibition zone was measured, and each indicator bacterium was repeated three times.

[0052] The results show: When Escherichia coli was used as the indicator bacterium, the inhibition zone was approximately 23.33 mm. When Staphylococcus aureus is used as the indicator bacterium, the inhibition zone is approximately 22.33 mm.

[0053] The results showed that Lactobacillus sacchariformis ST084 had a good antibacterial effect.

[0054] Growth curves, acid production curves, and antimicrobial activity curves are collectively referred to as fermentation kinetics measurements. Results are as follows: Figure 3 As shown.

[0055] The results show: Growth and acid production curves: The results showed that this strain exhibited significant characteristics of rapid growth and high acid production rate. The strain had a short lag phase, entering a rapid growth phase between 4 and 14 hours, after which the growth rate gradually slowed down, exhibiting a typical S-shaped curve. Correspondingly, ST084 also showed a high acid production rate between 4 and 14 hours, which gradually decreased as cell growth slowed down. P <0.05); acid production tended to stabilize after 24 h, and the final pH of the fermentation broth dropped to 3.67, indicating that this strain possesses both rapid growth and efficient acid production characteristics. This characteristic is beneficial for the strain to quickly establish a dominant population in the fermentation system, inhibit contamination by other microorganisms through rapid acid production, thereby ensuring the safety of the fermentation process, effectively shortening the fermentation cycle for industrial production, and reducing production costs.

[0056] Antimicrobial activity curve: The antimicrobial activity assay results showed that the antimicrobial activity of strain ST084 against *Escherichia coli* began to appear after 4 hours of fermentation; after 6 hours, the antimicrobial activity against both *Escherichia coli* and *Staphylococcus aureus* gradually increased with the extension of fermentation time, reaching a maximum at 36 hours. This dynamic antimicrobial characteristic allows the strain to inhibit the proliferation of miscellaneous bacteria and pathogens in the early stages of fermentation, and maintain its antimicrobial advantage in the middle and late stages. It ensures the safety and stability of the fermentation process without the need for chemical preservatives, and has good industrial application value.

[0057] (3) Carbon source utilization capacity Three groups of MRS culture media were prepared: an experimental group with 20.0 g / L sucrose, a positive control group with 20.0 g / L glucose, and a blank control group with no carbon source. The ST084 seed culture (prepared in the same way as step (1)) was centrifuged at 5000 rpm and 4℃ for 5 min, repeated three times, and the bacterial cells were collected. The bacterial culture was inoculated into the three culture media using a sterile inoculation needle, and after incubation at 37℃ for 24 h, the OD was measured. 600 The value is used to assess the growth of the strain.

[0058] The results showed that the OD of the sucrose experimental group 600The value was 1.79, while the glucose positive control group was 2.07. Even with sucrose as the sole carbon source, strain ST084 still exhibited significant growth activity, reaching 86.47% of the positive control group. The OD value of the blank control group without added carbon source was... 600 The value was 0.21. These results indicate that *Lactobacillus sacchariformis* ST084 can effectively utilize sucrose as a carbon source for growth and reproduction. Its sucrose utilization efficiency is close to that of glucose, demonstrating good carbon source adaptability and providing favorable conditions for its fermentation application in plant-based beverages.

[0059] Example 2: Comprehensive evaluation of the prebiotic activity and safety characteristics of Lactobacillus thuringiensis ST084 in sake Specifically, it includes the following: 1. Bioavailability assay (1) Tests for acid and bile salt tolerance: Preparation of seed solution: Lactobacillus cereus ST084 culture stored at -80℃ was streaked onto MRS solid medium and incubated at 37℃ for 36 h. Single colonies from the plate were picked and inoculated into MRS liquid medium and incubated at 37℃ for 18 h to obtain the activated solution. The activated solution was transferred to fresh MRS liquid medium at an inoculation rate of 1% (v / v) and incubated under the same conditions for another 18 h. The above transfer operation was repeated once, and the resulting culture medium was the seed culture.

[0060] Acid resistance: Seed culture was inoculated at a rate of 1% (v / v) into fresh MRS medium adjusted to pH 3.0 and untreated fresh MRS medium, respectively. The cultures were incubated at 37°C for 24 h, and samples were taken at 3 h and 24 h, with absorbance measured at 600 nm. The tolerance of the strains to different stress conditions was calculated compared with the untreated control group (see Table 1).

[0061] Bile salt tolerance: Seed culture was inoculated at a rate of 1% (v / v) into fresh MRS medium supplemented with 0.3% bile salts and untreated fresh MRS medium, respectively. The cultures were incubated at 37°C for 24 h, and samples were taken at 3 h and 24 h, with absorbance measured at 600 nm. The tolerance of the strains to different stress conditions was calculated compared with the untreated control group (see Table 1).

[0062] Tolerance (%) = (ΔOD) （处理组） / ΔOD （对照组） )×100.

[0063] Table 1: Tolerance of Lactobacillus sacchariflorus ST084 to Acids and Bile Salts time Acid resistance (%) Bile salt tolerance (%) 3 h 36.33±1.53 93.00±2.00 24 h 1.86±0.13 11.11±0.23 (2) Determination of survival rate of in vitro artificial simulated gastrointestinal fluid transport: Preparation of bacterial suspension: The seed culture obtained in step (1) above was centrifuged at 4°C and 5000 rpm for 5 min. The supernatant was discarded, and the bacterial cells were resuspended in PBS (pH 7.4) and the OD was adjusted. 600 ≈1.0, thus obtaining the bacterial suspension.

[0064] Take the bacterial suspension and resuspend it in simulated gastric juice (SGJ, containing 10 mg / mL pepsin, pH 3.0), adjusting the initial concentration to 1×10⁻⁶. 8 CFU / mL was incubated at 37℃ for 3 h. Subsequently, the culture was centrifuged at 4℃ and 5000 rpm for 5 min, the supernatant was discarded, and the bacterial pellet was collected and resuspended in an equal volume of simulated intestinal fluid (SSIJ, containing 0.27 mg / mL trypsin, pH 8.0), and incubated for another 3 h. The viable cell count at each stage was determined using the plate count method (see...). Figure 4 ).

[0065] .

[0066] The results show: The survival rate of the strain *Lactobacillus sakebi* ST084 of this invention in simulated gastric fluid was 55.06%.

[0067] The survival rate after gastrointestinal digestion is 50.15%.

[0068] (3) Determination of oxidative activity: Centrifuge the seed culture obtained in step (1) above at 4℃ and 5000 rpm for 5 min, discard the supernatant, resuspend the bacterial cells in PBS (pH 7.4) and adjust OD600≈1.0 to obtain the bacterial suspension. Mix 0.75 mL of bacterial suspension with 0.75 mL of 0.20 mmol / L 1,1-diphenyl-2-trinitrophenylhydrazine (DPPH), react at 37 °C in the dark for 30 min, centrifuge, and measure the absorbance at 517 nm to calculate the DPPH scavenging rate.

[0069] Take 0.2 mL of bacterial suspension and mix it with 4 mL of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) working solution (prepared by reacting 7.0 mmol / L ABTS with 2.45 mmol / L potassium persulfate for 12-16 h, and diluting with PBS to an absorbance of 0.70±0.02 at 734 nm). Incubate at room temperature in the dark for 30 min, measure the absorbance at 734 nm, and calculate the ABTS scavenging rate.

[0070]

[0071] A b A represents the absorbance of the blank group. s A represents the absorbance of the sample group. c This indicates the absorbance of the control group.

[0072] The results are shown in Table 2: Table 2: Antioxidant activity of Lactobacillus thuringiensis ST084 in sake DPPH removal rate (%) ABTS clearance rate (%) 38.55±0.71 27.81±0.62 (4) Adhesion characteristics determination: Centrifuge the seed culture obtained in step (1) above at 4℃ and 5000 rpm for 5 min, discard the supernatant, resuspend the bacterial cells in PBS (pH 7.4) and adjust OD600≈1.0 to obtain the bacterial suspension. Mix 1.5 mL of bacterial suspension with 0.5 mL of xylene, vortex for 3 min, let stand at 37℃ for 1 h, and measure the OD of the lower aqueous phase. 600 Calculate hydrophobicity (also known as self-aggregation, the calculation formula is shown in "Adhesion Properties" below).

[0073] Take another 4 mL of bacterial suspension, let it stand at 37℃ for 5 h, and take the supernatant to measure OD. 600 Calculate the self-aggregation property (the calculation formula is shown in "Adhesion Properties" below).

[0074] .

[0075] A s This indicates the OD at t=1 or 5 hours. 600 Value; A0 represents the initial OD at t=0 hours. 600 Value; and A b This is the OD of the blank control group. 600 value.

[0076] The adhesion characteristics of Lactobacillus spp. ST084 in sake were studied, and the results are shown in Table 3.

[0077] Table 3: Evaluation of the adhesion characteristics of Lactobacillus sacchariformis ST084 in sake Hydrophobicity (%) Self-aggregation (%) 42.77±0.64 95.15±0.53 The results show: Surface property measurements showed that the hydrophobicity of Lactobacillus sakebi ST084 cells was 42.77%, and the self-aggregation rate was 95.15%.

[0078] Among these factors, moderate hydrophobicity facilitates effective initial adhesion between the bacteria and intestinal epithelial cells, while high self-aggregation promotes the aggregation of colonized bacteria on the intestinal surface to form a biofilm, thereby enhancing their resistance to intestinal peristalsis and prolonging colonization time. These results indicate that *Lactobacillus sacchariflorus* ST084 possesses excellent intestinal colonization potential.

[0079] (5) Bile salt hydrolytic enzyme activity assay: The seed culture obtained in step (1) above was centrifuged at 4°C and 5000 rpm for 5 min. The supernatant was discarded, and the bacterial cells were resuspended in PBS (pH 7.4) and the OD was adjusted. 600 ≈1.0, thus obtaining the bacterial suspension; Add 100 μL of bacterial suspension to the wells of an MRS agar plate containing 0.37 g / L CaCl2 and 5 g / L sodium taurocholate, and incubate at 37°C for 24 h.

[0080] The results show: The results of bile saline hydrolase activity assay showed that strain ST084 formed a distinct white precipitate ring on the selection plate containing sodium taurocholate, indicating that its bile saline hydrolase activity was positive and that it possessed the ability to metabolize and break down conjugated bile acids. This characteristic helps to lower serum cholesterol levels and reduce the damage to bacterial cell membranes caused by high concentrations of bile acids, thereby enhancing the survival ability of the strain in the intestinal bile environment and improving its intestinal colonization stability.

[0081] 2. Safety (1) When performing hemolytic activity identification, the seed liquid to be tested (the preparation method of the bacterial liquid is the same as step (1) above) is streaked and inoculated on Columbia blood agar plates, and cultured at 37°C for 36 h. The hemolytic type is determined by observing whether a clear zone (β-hemolysis), a green zone (α-hemolysis), or no zone (γ-hemolysis) is formed around the colony.

[0082] (2) When identifying antibiotic susceptibility, the paper disc diffusion method was used. 100 μL of the seed solution (OD600≈0.1) obtained in step (1) of step 1 was spread on the surface of an agar plate. After the surface dried, antibiotic susceptibility discs were attached. The plate was incubated at 37℃ for 24 h, and the diameter of the inhibition zone was measured.

[0083] The safety and bile saline hydrolase activity of *Lactobacillus cereus* ST084 were determined, specifically by testing its hemolytic activity and antibiotic susceptibility to determine the strain's safety. The bile saline hydrolase activity was also assessed. Specific test results are shown in Tables 4 and 5.

[0084] Table 4: Antibiotic sensitivity of Lactobacillus sacchariformis ST084 in sake Streptomycin Kanamycin Erythromycin tetracycline Vancomycin penicillin Ampicillin Cephalosporin Gentamicin Lincomycin - ++ +++ + ++ +++ +++ +++ ++ ++ It should be noted that in Table 4, "+" indicates that the diameter of the inhibition zone is <10 mm; "++" indicates that the diameter of the inhibition zone is 10 mm ≤ the diameter of the inhibition zone <20 mm; "+++" indicates that the diameter of the inhibition zone is ≥20 mm; and "-" in Table 4 indicates negative or very weak.

[0085] Table 5: Bile salt hydrolytic enzyme activity and hemolytic activity of Lactobacillus sacchariformis ST084 in sake hemolytic bile salt hydrolytic enzyme activity - + It should be noted that in Table 5, "+" indicates a positive result and "-" indicates a negative result.

[0086] Example 3: Identification of the antibacterial substance of Lactobacillus saccharidus ST084 in sake (1) Effect of pH on antibacterial activity Preparation of fermentation broth: The bacterial strain stored at -80℃ was streaked onto MRS solid medium and incubated at 37℃ for 36 h. Single colonies were picked and inoculated onto MRS liquid medium and incubated at 37℃ for 18 h to obtain the activated solution. The activated solution was transferred to fresh MRS liquid medium at an inoculation rate of 1% (v / v) and incubated under the same conditions for 18 h. This transfer was repeated once, and the resulting culture was the seed culture. The seed culture was inoculated onto fresh MRS liquid medium at a rate of 1% (v / v) and incubated at 37℃ for 36 h. The bacterial cells were removed through a 0.22 μm aseptic filter, and the filtrate (supernatant) was collected to obtain the fermentation broth.

[0087] The pH of the fermentation broth was measured, and the pH was adjusted to 3.0, 4.0, 5.0, 6.0, 7.0, and 7.5 respectively using HCl and NaOH solutions. 100 μl samples were then taken for antibacterial experiments (the specific method is the same as in Example 1; the fermentation broth sampled had a bacterial concentration of OD before filtration). 600 (≈2.0, after filtration, the filtrate was collected), and the diameter of the inhibition zone was measured.

[0088] The results showed that, except for the increase in antibacterial activity at pH 3.0, as the pH increased, the diameter of the inhibition zone of the supernatant against Escherichia coli and Staphylococcus aureus decreased from 23.27 mm (pH 3.75) to 12.47 mm (pH 7.5) and from 21.47 mm (pH 3.75) to 7.93 mm (pH 7.5), respectively.

[0089] The results of the determination of antimicrobial substances in Lactobacillus sacchariformis ST084 are shown in Tables 6 and 7.

[0090] Table 6: Determination of antimicrobial substances in Lactobacillus sacchariformis ST084 (a type of Lactobacillus sacchariformis)

[0091] Note: Different lowercase superscripts indicate that there are significant differences in the inhibitory effect of different fermentation supernatants on the same indicator bacteria. P <0.05).

[0092] The above results indicate that the antibacterial activity is significantly negatively correlated with pH, ​​and an acidic environment is an important condition for the fermentation broth to exert its antibacterial effect.

[0093] (2) Protease sensitivity test: After adjusting the pH of the fermentation broth (the preparation method of the fermentation broth is the same as step (1) above) to 7.5, proteinase K and trypsin were added respectively (the amount added was 1 mg / mL at the final concentration, purchased from Shanghai Lanji Technology Development Co., Ltd.). After reacting at 37℃ for 1 h, the enzymes were inactivated by boiling in a water bath for 5 min. The diameter of the inhibition zone of the supernatant after enzyme inactivation against Escherichia coli and Staphylococcus aureus was detected according to the above method.

[0094] Table 7: Determination of antimicrobial substances in Lactobacillus sacchariformis ST084 (a type of Lactobacillus sacchariformis)

[0095] Note: The "-" sign indicates that no antibacterial activity was detected.

[0096] The results showed that after treatment with the two enzymes, the inhibition zone diameter of the fermentation supernatant against the two indicator bacteria was zero.

[0097] The above results indicate that antibacterial substances, such as peptides or proteins, are also present in the fermentation supernatant.

[0098] Example 4: Application of Lactobacillus thuringiensis ST084 in the preparation of fermented taro and bamboo shoot probiotic beverage Specifically, the following steps are included: 1. Beverage preparation (1) Preparation of fermentation agent: Lactobacillus cereus ST084 culture stored at -80℃ was streaked onto MRS solid medium and incubated at 37℃ for 36 h. Single colonies from the plate were picked and inoculated into MRS liquid medium and incubated at 37℃ for 18 h to obtain the activated solution. The activated solution was transferred to fresh MRS liquid medium at an inoculation rate of 1% (v / v) and incubated under the same conditions for another 18 h. The above transfer operation was repeated once, and the resulting culture medium was the seed culture. The prepared seed culture was inoculated into MRS medium at an inoculation rate of 2% (v / v) and incubated statically at 37℃ for 24 h to prepare the culture medium. The culture medium was centrifuged at 4℃ and 6000 r / min for 10 min, the supernatant was discarded, and the obtained bacterial pellet was resuspended in an equal volume of 0.85% sterile physiological saline to adjust the bacterial suspension concentration to 1×10⁻⁶.8 CFU / mL yields ST084 starter culture.

[0099] (2) Prepare taro paste and bamboo shoot juice: Take fresh sweet bamboo shoots, peel and cut them into pieces, blanch them in boiling water for 8-10 minutes, place them in a 0.15% (g / 100ml) citric acid solution for 1-2 minutes to protect their color, add water at a ratio of 1:3 (g / mL) and then pulp them (the conditions are: pulping machine at medium speed for 5 minutes), filter and extract the juice to obtain bamboo shoot juice.

[0100] Take fresh Lipu taro, peel it, and soak it in a 0.1% (g / 100ml) citric acid solution for 2 minutes to protect its color. After slicing, blanch it in boiling water for 5 minutes. Add water at a ratio of 1:2 (g / mL) and then pulp it (the conditions are: pulping machine at medium speed for 5 minutes). After pulping, gelatinize it at 90~95℃ for 60 minutes. After cooling to 60℃, adjust the pH to 4.5. Add saccharifying enzyme (purchased from Shanghai Aladdin Biochemical Technology Co., Ltd.) at a ratio of 70 U / g taro and saccharify it at 60℃ for 4 hours to obtain taro pulp.

[0101] (3) Single-factor experimental design: With a fixed fermentation temperature (37℃), a sugar addition of 2% (g / 100ml), and a skim milk powder addition of 4% (g / 100ml), the effects of different ratios of bamboo shoot juice and taro paste (8:2, 7:3, 6:4, 5:5, 4:6), the amount of starter culture added (0.1%, 0.2%, 0.3%, 0.4%, 0.5%), and the fermentation time (4h, 8h, 12h, 16h, 20h) on the sensory quality of the product were preliminarily investigated. The response surface mean was determined, and the percentage of starter culture added was expressed as ml / 100ml.

[0102] The results show: like Figure 5 As shown, the ratio of taro paste to bamboo shoot juice has a highly significant impact on the product's sensory score. p <0.01). When the ratio is 6:4, the product has a moderate sweet and sour taste, a harmonious flavor, and the highest sensory score (85.0 points). Single-factor experiments on inoculum size and fermentation time showed that the optimal parameters were 0.3% (v / v) and 12 h, respectively. Therefore, A: 35-45%, B: 55-65%, and C: 0.25-0.35% were selected as the central range for response surface methodology optimization.

[0103] (4) Response surface optimization experiment (Box-Behnken Design) Based on the results of the single-factor experiments, three factors that significantly affected sensory scores—the amount of taro paste added (A), the amount of bamboo shoot juice added (B), and the amount of starter culture inoculated (C)—were selected as independent variables. Sensory score (Y) was used as the response value, and a Box-Behnken design was employed for a three-factor, three-level response surface methodology optimization experiment. The experimental factors and level codes are shown in Table 8. The experimental design and results were analyzed using Design-Expert 13.0 software.

[0104] Table 8: Factors and Levels in Response Surface Experimental Design

[0105] The results show: Response surface three-dimensional surface plot ( Figure 6 This visually presents the influence of the interaction of various factors on sensory scores. The steeper the slope of the surface, the more significant the influence of that factor on the response value; the closer the contour lines are to an ellipse, the stronger the interaction between the two factors. Figure 6 It is evident that there is a significant interaction effect between the amount of taro paste added and the amount of starter culture (p<0.01). As both increase synergistically, the sensory score rapidly rises to a peak and then drops sharply. The optimal inoculum amount determined in the single-factor experiment was 0.3%. However, excessively high inoculum amounts can lead to over-acidification and adverse phenomena such as whey separation.

[0106] Based on the numerical optimization function of Design-Expert software, the theoretical process parameters with the optimal sensory score are obtained as follows: The initial parameters were: 40.23% taro paste, 59.38% bamboo shoot juice, and 0.25% starter culture. For ease of implementation, the optimal process parameters were adjusted to: 40% taro paste, 60% bamboo shoot juice, and 0.25% starter culture.

[0107] (5) Preparation of substrate solution: Bamboo shoot juice and taro paste were mixed in a mass ratio of 6:4 (40% taro paste and 60% bamboo shoot juice) to obtain a mixed liquid. Take 2% (w / w) of white sugar and 4% (w / w) of skim milk powder by weight of the mixed liquid, mix them evenly and add them to the mixed liquid. Stir thoroughly to dissolve, sterilize at 121°C for 10 min, and cool to 37°C to obtain the fermentation substrate liquid.

[0108] (6) Fermentation: The fermentation agent obtained in step (1) was inoculated into the fermentation substrate liquid prepared in the above steps at an inoculation amount of 0.25% (v / v) of the mixed liquid volume, and fermented in a constant temperature incubator at 37℃ for 12 h to obtain taro and bamboo shoot probiotic beverage.

[0109] 2. Sensory evaluation of the beverage obtained from the fermentation of sake with *Lactobacillus thuringiensis* ST084, specifically including: After fermentation, the product was refrigerated at 4 °C for 24 h, followed by sensory evaluation.

[0110] The evaluation panel consisted of 15 trained graduate students specializing in food science (8 men and 7 women, aged 22-28). Before the evaluation, approximately 50 mL of the bamboo shoot and taro probiotic beverage was dispensed into glass cups and randomly numbered. The evaluators were asked to taste the samples and independently score them based on four dimensions: texture (30 points), taste (30 points), color (20 points), and aroma (20 points), for a total score of 100 points. The final result was the average of all evaluators' scores.

[0111] The results showed that the beverage fermented with a formula containing 40% taro pulp, 60% bamboo shoot juice, and 0.25% starter culture achieved a sensory score of 90.3 ± 0.5 points (Table 9). This score was significantly higher than most similar fruit and vegetable compound lactic acid bacteria beverages, indicating that this ingredient combination and optimized process have a clear advantage in flavor and quality. The final product has a uniform, bright pale yellow color, a balanced sweet and sour taste, and combines the delicacy of taro with the freshness of bamboo shoots, resulting in a unique and harmonious flavor.

[0112] Table 9: Sensory Evaluation Results

[0113] 3. To further clarify the overall quality of the taro and bamboo shoot probiotic beverage prepared above, this invention investigated its functional characteristics and shelf-life stability. Specifically, this included: antioxidant activity, dietary fiber content, flavor composition, and storage stability.

[0114] The measurement steps are as follows: (1) Antioxidant capacity of beverages before and after fermentation: DPPH free radical scavenging rate determination: A 0.1 mM DPPH solution was prepared with anhydrous ethanol and used immediately. Beverage samples before and after fermentation were diluted twice with anhydrous ethanol to prepare the test solution. The determination system consisted of three groups: a blank group (0.2 mL test solution plus 1.8 mL anhydrous ethanol); a sample group (0.2 mL test solution, 0.9 mL DPPH solution, and 0.9 mL anhydrous ethanol); and a control group (1.1 mL anhydrous ethanol and 0.9 mL DPPH solution). All groups were thoroughly mixed and reacted at room temperature in the dark for 30 min. The absorbance was measured at 517 nm, and the DPPH free radical scavenging rate was calculated using the formula.

[0115] Assay for ABTS free radical scavenging activity: A 7 mmol / L ABTS solution was mixed with a 2.45 mmol / L potassium persulfate solution at a 1:1 volume ratio, and the mixture was allowed to react at room temperature in the dark for 12–16 h to generate ABTS. + Free radicals. Before use, take the above ABTS... + The stock solution was diluted with anhydrous ethanol to adjust its absorbance at 734 nm to 0.70 ± 0.02, and used as the working solution. Beverage samples before and after fermentation were diluted twice with anhydrous ethanol to prepare the test solutions. The assay system consisted of three groups: a blank group (0.1 mL test solution plus 1.9 mL anhydrous ethanol); a sample group (0.1 mL test solution, 0.1 mL anhydrous ethanol, and 1.8 mL ABTS working solution); and a control group (0.2 mL anhydrous ethanol and 1.8 mL ABTS working solution). Each group was thoroughly mixed, reacted in the dark, and the absorbance was measured at 734 nm. The ABTS free radical scavenging rate was calculated using the formula.

[0116] .

[0117] A b A represents the absorbance of the blank group. s A represents the absorbance of the sample group. c This indicates the absorbance of the control group.

[0118] The results are as follows Figure 7 As shown.

[0119] The results show: After fermentation, the scavenging rate of the beverage against DPPH free radicals decreased from 80.93% to 72.58%, and against ABTS... + The free radical scavenging rate did not change significantly.

[0120] The results showed that although fermentation reduced DPPH scavenging capacity to some extent, the reduction was not significant, and it still maintained scavenging capacity against ABTS. + Free radical scavenging activity.

[0121] (2) Determination of dietary fiber in fermented beverages: The determination was performed according to GB 5009.88—2023, "National Food Safety Standard for Food - Determination of Dietary Fiber in Food". The results are shown in Table 10. Table 10: Changes in dietary fiber content of taro and bamboo shoot compound probiotic beverage before and after fermentation sample Total dietary fiber (g / 100g) Insoluble dietary fiber (g / 100g) Soluble dietary fiber (g / 100g) Before fermentation 0.535±0.014 0.483±0.023 0.052±0.038 After fermentation 0.592±0.024 0.503±0.021 0.089±0.035 Before fermentation, it is a mixture of fermentation substrate liquid and 0.25% bacterial solution.

[0122] The results show: After lactic acid bacteria fermentation, the total dietary fiber content in the product increased by 11.07% compared to before fermentation, with the soluble dietary fiber content increasing by a particularly significant 69.23%. These results indicate that the fermentation process of *Lactobacillus globosum* ST084 strain in sake can effectively modify the dietary fiber composition of the product, thereby improving its nutritional value.

[0123] (3) Determination of flavor compounds in beverages before and after fermentation: Take 5.0 mL of the pre- and post-fermentation beverage samples obtained in step 1 into a 20 mL headspace vial, add 2.0 g NaCl and 10 μL of internal standard (1,2-dichlorobenzene, 10 μg / mL), to bring the final concentration of internal standard in the sample to 0.02 μg / mL. Using a DVB / CAR / PDMS fiber head (50 / 30 μm, Supelco), equilibrate at 60 °C for 15 min, then perform headspace adsorption for 40 min. Desorb at 250 °C for 5 min using the GC inlet, and detect using an Agilent 7890B-5977A GC-MSD. Temperature program: 40 °C for 3 min, ramp to 200 °C at 5 °C / min, then ramp to 230 °C at 10 °C / min and hold for 5 min. Mass spectrometry conditions: EI source, 70 eV, full scan mode (m / z 33–500) for qualitative and relative quantitative analysis. Compounds were identified by comparison with the NIST 17 library (match ≥80%), excluding those affected by column bleed, solvent interference, and those unrelated to food microbial fermentation. Volatile flavor compounds in the fermented beverage were determined using the GC-MS method described above. The results are shown in Table 11.

[0124] Table 11: Changes in flavor compounds of taro and bamboo shoot compound probiotic beverage before and after fermentation

[0125] The results show: The complete disappearance of characteristic esters and squalene from the raw materials indicates that the lactic acid bacteria efficiently utilized or transformed these precursors. The newly generated or significantly increased flavor compounds after fermentation mainly include the following categories: (a) Esters: The number of compounds increased and the types were restructured, especially octyl-2-palmitate (3.61%) and 2,2,4-trimethyl-1,3-pentanediol diisobutyrate (3.08%), which brought fruity and sweet aromas to the product.

[0126] (b) Alcohols: The relative content of acetoin, which was not detected before fermentation, increased significantly to about 5.25% after fermentation. This component is a typical product of lactic acid bacteria in the metabolism of citrate and sugar, and has a mild creamy and milky aroma. Its formation gives the beverage of the present invention a unique and pleasant fermented milky flavor, which is not present in existing non-fermented taro and bamboo shoot beverages.

[0127] (c) Heterocyclic compounds: The total relative content of this class of compounds increased significantly from 3.73% before fermentation to 32.68%, becoming the dominant class. Among them, the relative content of benzothiazole surged from 2.11% to 14.13%, while the content of heterocyclic substances such as 3-pyridinol also increased from 1.62% to 5.89%. These components together add a delicate roasted and nutty aroma to the product.

[0128] (d) In addition, the content of hexadecanoic acid increased from 0.78% to 1.48% after fermentation, and its ester derivatives increased, indicating that the fermentation process effectively promoted lipid hydrolysis and esterification, further enhancing the richness and fruity aroma of the beverage.

[0129] In conclusion, L. sakei The fermentation process of ST084 is not a simple addition or subtraction of the original flavor of the raw materials, but rather a synergistic interaction of glycolysis, amino acid conversion, and lipid metabolism. This process adds fermentation-derived aromas and a rich, full-bodied flavor to the original taste, ultimately creating a complex and harmonious flavor system. Based on this, this invention scientifically combines sweet bamboo shoots and taro with a fermentation process to successfully produce a novel beverage with a rich aroma, possessing both fermented milky and complex fruity characteristics, demonstrating excellent potential for industrial application.

[0130] (4) Storage stability of fermented beverages: The changes in the fermented beverage obtained in step 1 were determined after 28 days of storage in the dark at 4°C and 25°C. Samples were taken every 7 days to measure relevant indicators in order to examine its storage stability and determine the optimal storage conditions and shelf life.

[0131] Specific testing indicators include: (1) Determine the viable bacteria in the sample according to GB 4789.35-2023; (2) Use a pH meter to measure the pH value; (3) The titration acidity was determined in accordance with GB 5009.239-2016, and the result was expressed as Gilnell degree (°T).

[0132] The changes in viable cell count, pH, and titratable acidity of the product over 28 days at 4 °C and 25 °C are as follows: Figure 8 As shown.

[0133] The results show: During storage at 4 °C, the viable bacterial count decreased from 7.34 (2.20 × 10⁻⁶) to 2.20 × 10⁻⁶. 7 The CFU / mL level slowly decreased to 6.45 (2.80 × 10⁻⁶) on day 28. 6 The number of live bacteria (CFU / mL) remained higher than the national standard (GB 19302-2010) for live-culture fermented milk beverages, consistently exceeding the 1×10⁻⁶ CFU / mL limit throughout the monitoring period. 6 Minimum requirement for CFU / mL.

[0134] The pH value decreased gradually from 5.01 to 4.28, with a gentle increase in titratable acidity, demonstrating a good post-acidification inhibition effect. Low temperature effectively inhibited the metabolic activity and cell death of probiotics, ensuring the long-term stability of the product.

[0135] In contrast, at 25 °C storage, all indicators deteriorated sharply. Although the microbiological indicators barely remained above the critical value for the first 14 days, the viable count plummeted to below 10 from day 21 onwards. 5 CFU / mL, almost no viable bacteria were detected by day 28. A slight increase in pH (3.73 to 3.97) and a slight decrease in acidity were observed from day 14 to day 28.

[0136] In summary, taro and bamboo shoot probiotic beverages must be distributed under a 4°C cold chain condition, under which a shelf life of 21 days is recommended to ensure optimal sensory and functional quality.

[0137] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A strain of Lactobacillus widely distributed in sake ( Latilactobacillus sakei ST084, characterized in that, The Lactobacillus thuringiensis ST084 of sake is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 35809 and deposit date of September 8, 2025.

2. A microbial preparation containing the Lactobacillus spp. ST084 of sake as described in claim 1.

3. The microbial preparation according to claim 2, characterized in that, The microbial preparation is a liquid or solid microbial agent containing live cells of Lactobacillus sacchariformis ST084, or a fermentation broth containing Lactobacillus sacchariformis ST084. Preferably, the Lactobacillus sakebi ST084 live cells are freeze-dried Lactobacillus sakebi ST084 dried cells or immobilized Lactobacillus sakebi ST084 cells.

4. The use of Lactobacillus sp. ST084 of sake brewing, or its bacterial suspension, or its culture medium, or its fermentation product, or the microbial preparation of claim 2 or 3 in the preparation of antibacterial or antioxidant products, or in the preparation of fermented foods.

5. The application according to claim 4, characterized in that, The term "antibacterial" refers to the inhibition of Escherichia coli (E. coli). Escherichia coli Staphylococcus aureus; Preferably, the product is a pharmaceutical product; Preferably, the drug further contains pharmaceutically acceptable excipients; the pharmaceutical excipients refer to conventional drug carriers in the pharmaceutical field; Preferably, the excipients include one or more of the following: binders such as cellulose derivatives, alginate, gelatin, and polyvinylpyrrolidone; diluents such as starch, pregelatinized starch, dextrin, sucrose, lactose, and mannitol; fillers such as starch and sucrose; humectants such as glycerin; disintegrants such as sodium carboxymethyl starch, croscarmellose, and dry starch; absorption promoters such as quaternary ammonium compounds; surfactants such as polysorbate, fatty acid sorbitan, and fatty acid glycerides; colorants such as titanium dioxide, sunset yellow, methylene blue, and pharmaceutical iron oxide red; lubricants such as hydrogenated vegetable oil, talc, and polyethylene glycol; coating materials such as acrylic resin, hydroxypropyl methylcellulose, povidone, and cellulose acetate; and other excipients such as flavoring agents and sweeteners may also be added to the composition. Preferably, the dosage form of the drug includes oral dosage form, injection dosage form, and inhalation dosage form; Preferably, the oral dosage form includes tablets, capsules, granules, oral liquids, and oral suspensions; Preferably, the injectable dosage form includes an injection solution and an injection powder for injection; Preferably, the inhalation dosage form includes aerosols and powder inhalers.

6. A fermenting agent, characterized in that, Includes Lactobacillus spp. ST084 of sake brewing as described in claim 1, or its bacterial suspension, or its culture medium, or its fermentation product, or the microbial preparation described in claim 2 or 3.

7. The fermenting agent according to claim 6, characterized in that, The minimum amount of *Lactobacillus spp.* ST084 added to the fermentation agent is 1 × 10⁻⁶. 8 CFU / mL.

8. A method for preparing a taro and bamboo shoot probiotic beverage, characterized in that, The method includes: mixing bamboo shoot juice, taro paste, white sugar, and skim milk powder, sterilizing and cooling to obtain a fermentation substrate liquid; adding the Lactobacillus thuringiensis ST084 of sake according to claim 1, or its bacterial suspension, or its culture medium, or its fermentation product, or the microbial preparation according to claim 2 or 3, or the fermenting agent according to claim 6 to the fermentation substrate liquid, and then fermenting to prepare a taro and bamboo shoot probiotic beverage.

9. The preparation method according to claim 8, characterized in that, The method includes the following steps: (1) Mix bamboo shoot juice and taro paste in a mass ratio of 6:4 to obtain a mixed liquid; separately take 2-3% of the weight of the mixed liquid, white sugar and 3-4% of the weight of skim milk powder, mix them evenly and add them to the mixed liquid, stir and dissolve thoroughly, sterilize and cool to 35-37℃ to obtain fermentation substrate liquid; (2) Add ST084 bacterial suspension to the substrate solution at 0.25% of the volume of the mixed liquid, and ferment in a constant temperature incubator at 35~37℃ for 10~12h to obtain taro and bamboo shoot probiotic beverage.

10. The taro and bamboo shoot probiotic beverage prepared by the method of claim 8 or 9.

Images