Recombinant escherichia coli for producing taurine, and construction method and application thereof

Abstract

The application relates to the field of microbial genetic engineering technology, and discloses a recombinant Escherichia coli for producing taurine as well as a construction method and application thereof, which comprises knocking out endogenous genes of the recombinant Escherichia coli tauD , integrating genes driven by strong promoters trc to express CDO genes, CSAD genes, FMO1 genes, pntA genes, pntB genes and gdhA genes; the construction method is targeted editing by using a recombinant pTarget plasmid to transform a bottom cell competent, and gradually eliminating the plasmid by combining isopropylthio-galactoside induction and high-temperature conditions; the application comprises the steps of culturing seed liquid to access a fermentation liquid to accumulate taurine. The application realizes de novo synthesis and stable accumulation of a target product by knocking out a degradation pathway, introducing a heterologous synthesis route, strengthening supply of cofactors and precursors, and constructing a complete synthetic metabolic network; and the multi-gene targeted integration and vector elimination strategy guarantees genetic stability of the strain and meets safety standards.

Description

Technical Field

[0001] This invention relates to the field of microbial genetic engineering technology, specifically to a recombinant Escherichia coli that produces taurine, its construction method, and its application. Background Technology

[0002] Taurine is a sulfur-containing amino acid with wide applications in the pharmaceutical, food additive, and feed industries. Fermentation of taurine using microbial chassis cells such as *E. coli* is an important method due to its mild reaction conditions. However, wild-type *E. coli* lacks a complete synthetic pathway for converting cysteine ​​to taurine, making de novo synthesis of the target product impossible. When introducing exogenous synthetic genes to construct engineered bacterial strains, the taurine dioxygenase endogenously present in the *E. coli* genome can recognize and degrade intracellularly generated taurine, leading to continuous consumption of the synthesized product within the fermentation system and hindering high-level accumulation.

[0003] The metabolic balance within the chassis cells also limits the fermentation yield of taurine. The biosynthetic pathway of taurine involves a series of oxidation reactions that consume reduced coenzyme II, and the synthesis of upstream sulfur-containing amino acids is highly dependent on the supply of intracellular amino acid donors. The natural metabolic network within conventional engineered *E. coli* cannot provide sufficient reducing power and precursors for the aforementioned heterologous synthetic pathway. This lack of cofactors and metabolic precursors limits the continuation of the product synthesis reaction, thus restricting overall conversion efficiency.

[0004] Existing methods for constructing engineered bacterial strains mostly employ plasmids as gene expression vectors. Recombinant strains carrying free expression plasmids are prone to plasmid loss during long-term, multi-generation industrial fermentation, resulting in poor genetic stability. To maintain the strain's production capacity, continuous antibiotic selection pressure is typically applied during fermentation, which not only increases material costs but also raises concerns about fermentation waste treatment and product application due to residual antibiotic-labeled vectors, making it difficult to meet current biosafety standards for industrial biomanufacturing. Summary of the Invention

[0005] To address the shortcomings of existing technologies, this invention provides a recombinant Escherichia coli that produces taurine, its construction method, and its application. This invention solves the problems of endogenous degradation consumption leading to product accumulation, insufficient supply of cofactors and metabolic precursors restricting synthesis efficiency during the fermentation of taurine by engineered strains, easy loss of free expression plasmids, and biosafety hazards caused by residual resistance markers in industrial fermentation.

[0006] To achieve the above objectives, the present invention provides the following technical solution:

[0007] In a first aspect, the present invention provides a recombinant Escherichia coli that produces taurine, wherein the recombinant Escherichia coli has endogenous knockout... tauD Genes, and integration by strong promoters trc Driven expression CDO Gene, CSAD Gene, FMO1 Gene, pntA Gene, pntB Genes and gdhA Genes, by knocking out endogenous degradation pathways and enhancing the supply of cofactors and precursors.

[0008] By employing the above technical solution, and through the comprehensive utilization of gene knockout and multi-target genome integration technologies, the metabolic network of chassis cells was reshaped, thus obtaining recombinant *E. coli* capable of de novo synthesis and accumulation of taurine. The specific mechanism of action and reaction process are as follows: Taurine dioxygenase, endogenously present in wild-type Escherichia coli, can degrade and convert taurine. To address this consumption issue, the gene encoding taurine dioxygenase was knocked out. tauD This interrupts the degradation and consumption pathway of taurine, ensuring that the synthesized taurine can accumulate stably in cells and fermentation broth.

[0009] Through integrated expression CDO Gene, CSAD Genes and FMO1 Genes establish a synthetic pathway from cysteine ​​to taurine within chassis cells. Specifically, cysteine ​​is catalyzed by cysteine ​​dioxygenase and, with the participation of oxygen, to produce cysteine ​​sulfinic acid. Cysteine ​​sulfinic acid then undergoes carbon dioxide removal under the action of cysteine ​​sulfinic acid decarboxylase, converting it into taurine. The aforementioned taurine is further oxidized under the catalysis of flavin monooxygenase 1, ultimately producing the target product, taurine.

[0010] In the oxidation of taurine to flavin monooxygenase 1, the reduced coenzyme II, NADPH, is continuously consumed. This is achieved by integrating and expressing the genes encoding two subunits of pyridine nucleotide transhydrogenase. pntA and pntB It catalyzes the reduction of coenzyme I (NADH) and the oxidation of coenzyme II (NADP). + The reversible reaction between them promotes the transfer of NADH's reducing power to NADPH. This conversion effectively increases the supply of NADPH within the basal cells, relieving the limitation imposed by cofactor deficiency on the catalytic activity of flavin monooxygenase 1.

[0011] Integrated expression gdhA Gene encoding NADP +Glutamate-dependent dehydrogenases catalyze the synthesis of glutamate from ammonia and α-ketoglutarate. Glutamate, as a key amino acid donor, participates in the synthesis of cysteine ​​and related metabolic precursors. Increased glutamate supply raises the substrate concentration for de novo synthesis of sulfur-containing amino acids, thereby driving overall carbon and nitrogen metabolism toward taurine synthesis.

[0012] Preferably, the CDO The gene is a Bacillus subtilis-derived cysteine ​​dioxygenase encoding gene with codon optimization in Escherichia coli, and its nucleotide sequence is SEQ ID NO:1; CSAD The gene is a human-derived cysteine ​​sulfinate decarboxylase encoding gene optimized with E. coli codons, and its nucleotide sequence is SEQ ID NO:2; FMO1 The gene is a human-derived flavin monooxygenase 1 encoding gene optimized with E. coli codons, and its nucleotide sequence is SEQ ID NO:3.

[0013] By adopting the above technical solution, the external source... CDO Gene, CSAD Genes and FMO1 The codon optimization of the gene in E. coli improved the codon bias problem when the above-mentioned foreign gene was expressed in the host, improved the corresponding translation efficiency and protein folding accuracy, eliminated the rare codon restriction in the heterologous expression process, and ensured the catalytic activity of key enzymes in the taurine synthesis pathway.

[0014] Preferably, the tauD The gene is the encoding gene for endogenous taurine dioxygenase in *Escherichia coli*, and its nucleotide sequence is SEQ ID NO:7; pntA Genes and pntB The genes are all encoding E. coli endogenous pyridine nucleotide transhydrogenase genes, with nucleotide sequences SEQ ID NO:4 and SEQ ID NO:5, respectively; gdhA The gene is endogenous NADP in E. coli. + The gene encoding glutamate-dependent dehydrogenase has the nucleotide sequence SEQ ID NO:6.

[0015] By adopting the above technical solution, the knockout target was identified. tauD and overexpression targets pntA , pntB and gdhA The specific nucleotide sequence ensures the accuracy of gene manipulation, avoids metabolic disorders in chassis cells caused by non-specific knockout or amplification, and maintains the growth stability of the engineered strain during fermentation.

[0016] Secondly, the present invention provides a method for constructing a recombinant Escherichia coli that produces taurine, comprising the following steps: Will contain tauD A series of recombinant pTarget plasmids containing gene knockout fragments and various target gene insertion fragments were transformed into competent cells of a chassis strain containing pCas plasmids and cultured on solid plates containing spectinomycin hydrochloride and kanamycin sulfate to verify the acquisition of positive clones and single colonies. The positive clones were picked and inoculated into a first liquid culture medium containing kanamycin sulfate and isopropyl thiogalactoside to eliminate the pTarget plasmid and isolate the single colonies that eliminated the pTarget plasmid. The single colony with pTarget plasmid eliminated was picked into the second liquid culture medium and cultured overnight at high temperature to eliminate the temperature-sensitive pCas plasmid, finally obtaining taurine-producing recombinant Escherichia coli without plasmid residue.

[0017] By employing the above technical solution, combining the targeted cleavage capability of the CRISPR-Cas9 system with a stepwise plasmid elimination strategy, it is possible to obtain engineered strains with stable multi-gene integration and no plasmid residue. The specific principles and operation procedures are as follows: The pCas plasmid in the chassis strain expresses the Cas9 nuclease, and a series of recombinant pTarget plasmids transcribe sgRNA and provide a template for homologous recombination. The sgRNA guides the Cas9 nuclease in the chassis strain genome. tauD Double-strand breaks occurred at the gene locus and various target gene insertion sites. Affected by this, the chassis strain utilized the gene knockout fragment carried by the recombinant pTarget plasmid and the target gene insertion fragment as repair templates to initiate homologous recombination repair mechanism. tauD The gene sequence was replaced with the knockout fragment sequence, and the gene sequence was replaced with the knockout fragment sequence. CDO Gene, CSAD Gene, FMO1 Gene, pntA Gene, pntB Genes and gdhA The gene is integrated into the corresponding site in the genome. Solid culture medium containing spectinomycin hydrochloride and kanamycin sulfate exerts resistance selection pressure on recombinant bacteria carrying dual plasmids, thereby enriching positive clones.

[0018] In the first liquid culture medium, isopropyl thiogalactoside acts as an inducer, initiating the transcription of a specific sgRNA on the pCas plasmid that targets the replicon region of the pTarget plasmid. Guided by the specific sgRNA, the Cas9 nuclease cleaves the pTarget plasmid, leading to its degradation within the chakra cells and completing the targeted clearance of the pTarget plasmid.

[0019] The pCas plasmid carries a temperature-sensitive origin of replication. Single colonies with the pTarget plasmid eliminated were placed in a second liquid medium and cultured overnight at high temperature, at which point pCas plasmid replication ceased. As the chassis cells divided and proliferated, the unreplicated pCas plasmids could not be allocated to daughter cells and were eventually lost. This process removed the exogenous vector backbone and resistance genes introduced into the chassis cells, yielding recombinant *E. coli* that meets the safety requirements for industrial fermentation.

[0020] Preferably, a series of recombinant pTarget plasmids are prepared in advance. The preparation process is as follows: gene knockout fusion fragments and gene insertion fusion fragments are obtained separately using fusion PCR technology; the pTarget plasmids are mutated to amplify the sgRNA sequence targeting the corresponding target gene locus, resulting in mutated pTarget fragments; the gene knockout fusion fragments and the gene insertion fusion fragments are ligated to the corresponding mutated pTarget fragments using a one-step cloning reaction. During the preparation process, the reaction conditions for the fusion PCR technology are: pre-denaturation at 95℃ for 5 min, denaturation at 95℃ for 30 s, annealing at 58℃ for 30 s, extension at 72℃ with an extension time calculated at a rate of 30-45 s / kb, repeated for 35 cycles, and a final extension at 72℃ for 10 min. The one-step cloning reaction program is incubation at 37℃ for 30 min.

[0021] By employing the above technical solution, fusion PCR technology is used to ligate the target gene sequence with the homologous sequence of the chassis strain in vitro, ensuring the sequence integrity of the homologous recombination template. The set PCR annealing temperature and extension time parameters are adapted to the amplification requirements of long fragments, reducing the incidence of non-specific amplification reactions. The one-step cloning reaction utilizes recombinase to recognize the overlapping regions at the ends of fragments and complete molecular circularization at 37℃, avoiding interference from restricted restriction sites on plasmid construction and improving the assembly efficiency of long and multi-fragment insertions.

[0022] Preferably, during the transformation of the competent cells of the chassis strain and the culture on a solid plate, the culture temperature is 30°C and the culture time is 12-18h; during the process of picking the positive clone single colony and inoculating it into the first liquid culture medium, the first liquid culture medium contains a final concentration of 50mg / L kanamycin sulfate and 5mM isopropyl thiogalactoside, the culture temperature is 30°C and the culture time is 12h; during the process of picking the single colony with the pTarget plasmid eliminated into the second liquid culture medium for overnight high-temperature culture, the temperature of the overnight high-temperature culture is 42°C.

[0023] By employing the above technical approach, the temperature and concentration parameters for different stages of gene editing were clarified. A temperature of 30°C was set during the solid plate culture and the first liquid culture stage to maintain the normal replication function of the temperature-sensitive pCas plasmid and ensure the continuous expression and catalytic activity of the Cas9 nuclease. A final concentration of 5 mM isopropyl thiogalactoside was added to the first liquid culture medium to provide sufficient transcription induction intensity, prompting the pTarget plasmid to be cleaved and degraded. A temperature of 42°C was set during the second liquid culture stage to disrupt the activity of the temperature-sensitive replicon and accelerate the rate of plasmid loss during cell division.

[0024] Thirdly, the present invention provides the application of recombinant taurine-producing Escherichia coli in the fermentation production of taurine, comprising pre-culturing the recombinant taurine-producing Escherichia coli to obtain a seed liquid; inoculating the seed liquid into a shake-flask fermentation medium for shake-flask fermentation, and finally accumulating taurine in the fermentation broth.

[0025] By employing the above technical solution, and utilizing a microbial culture mode that combines gradient expansion culture with aerobic fermentation, a viable cell population meeting fermentation requirements is obtained, achieving stable accumulation of taurine. The specific biological process is as follows: Recombinant E. coli in preservation is in a metabolic dormant state; direct inoculation into the fermentation system leads to prolonged cell adaptation and growth arrest. By setting up a separate seed culture stage, the chassis cells restart their primary metabolic network in a liquid nutrient environment, accelerating the uptake of external nutrients and the synthesis of intracellular nucleic acids and proteins. The chassis cells proliferate rapidly through binary fission, with the cell number increasing exponentially, resulting in a bacterial population with high mitotic activity and a complete metabolic enzyme system.

[0026] The highly viable seed culture obtained from propagation was transferred into a fermentation medium. As the culture progressed, the cells gradually entered a stationary phase, and the metabolic focus shifted towards product synthesis. Supported by the carbon, nitrogen, and inorganic salts provided by the fermentation medium, the heterologous genes introduced into the recombinant *E. coli* were fully transcribed and translated. In specific cellular metabolism, enhanced precursor amino acids and cofactors were continuously transported to the taurine synthesis pathway, where cysteine ​​underwent continuous oxidation and decarboxylation to generate taurine. Since the corresponding endogenous degradation pathway was blocked, the generated taurine was spared internal consumption and secreted across the cell membrane into the culture environment based on the intracellular and extracellular concentration gradient, accumulating continuously in the fermentation broth and completing the entire biomanufacturing process.

[0027] Preferably, the seed culture process is as follows: recombinant Escherichia coli producing taurine is inoculated into a solid culture medium for activation, a single colony is picked and inoculated into a seed culture medium, and cultured with shaking at 37°C and 200-220 rpm for 12 hours.

[0028] By employing the above-mentioned technical solution, single colonies with uniform morphological characteristics were isolated through streak culture on solid culture media, eliminating the risk of contamination by other microorganisms and the occurrence of reversion mutations in the bacterial cells. Setting a growth temperature of 37℃ and a shaking speed of 200-220 rpm in the seed culture medium ensured the oxygen mass transfer rate between the gas and liquid phases within the culture system. A 12-hour culture time allowed the recombinant *E. coli* population to reach the mid-to-late logarithmic growth phase, at which point various intracellular synthetic enzyme systems were most active, providing starting materials with relatively consistent physiological states for the fermentation stage.

[0029] Preferably, the fermentation parameters are controlled within the following range: inoculum volume of 1-2%, fermentation temperature of 37℃, oscillation speed of 200-220 rpm, and fermentation time of 48 h.

[0030] By adopting the above technical solution, the physical and temporal control boundaries for maintaining high-intensity taurine synthesis in recombinant *E. coli* were established. Setting an inoculum size of 1-2% balanced the initial biomass and nutrient load of the culture medium, avoiding growth retardation caused by insufficient initial cell count and premature depletion of carbon and nitrogen sources caused by excessive initial cell count. Maintaining conditions of 37℃ and 200-220 rpm provided a suitable kinetic environment and dissolved oxygen supply for rate-limiting enzymes such as flavin monooxygenase, which require oxygen for catalytic reactions. Setting the fermentation endpoint at 48 hours ensured that the taurine concentration in the fermentation broth reached its peak, while preventing large-scale cell autolysis due to nutrient deficiency in the later stages of fermentation, thus maintaining the stability of the fermentation broth system.

[0031] This invention provides a recombinant Escherichia coli that produces taurine, its construction method, and its applications. It has the following beneficial effects: 1. This invention achieves its goal by knocking out the endogenous recombinant Escherichia coli. tauD Genes and integration expression CDO Gene, CSAD Genes and FMO1 Genes that construct a taurine-producing metabolic network within chassis cells, knocked out tauD The gene blocked the taurine double oxygenation degradation pathway, and the introduction of three exogenous genes opened up a continuous catalytic route for the conversion of cysteine ​​to taurine. Through gene combination, the recombinant strain was able to synthesize the target product de novo, preventing the generated taurine from being consumed by intracellular metabolism and ensuring the stable accumulation of taurine during fermentation.

[0032] 2. This invention integrates and expresses [the substance] into the genome of recombinant Escherichia coli. pntA Gene, pntB Genes and gdhA The genes specifically enhance the supply of cofactors and precursor substances within the chassis cells. pntA and pntBThe gene-encoded transhydrogenase increases the concentration of reduced coenzyme II in the cell, which meets the reducing power requirements of the oxidation reaction stage. gdhA The gene-encoded glutamate dehydrogenase increased the concentration of key amino donors, improved the substrate supply level for de novo synthesis of sulfur-containing amino acids, and solved the limitation of taurine synthesis caused by insufficient cofactors and precursors through genetic modification, thereby improving the overall synthesis efficiency of recombinant Escherichia coli.

[0033] 3. This invention employs a CRISPR-Cas9-based genome editing method combined with a targeted elimination strategy to construct recombinant E. coli. By utilizing a series of recombinant pTarget plasmids as repair templates, the target gene is integrated into the chassis cell genome, avoiding the problem of easy loss of plasmids during free expression and ensuring the genetic stability of the engineered strain during fermentation passages. With the addition of specific inducers and the increase of culture temperature, the edited plasmids carrying resistance markers are induced and eliminated, ultimately obtaining a vector-free strain that meets the biosafety standards for industrial-scale fermentation. Attached Figure Description

[0034] Figure 1 This is a comparison of HPLC chromatographic analysis of intracellular free amino acids in fermentation broth samples from the embodiments and comparative examples of the present invention; Figure 2 This is a partial chromatogram of taurine in the fermentation broth sample analyzed by HPLC derivatization. Detailed Implementation

[0035] The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0036] Preparation Examples 1-3: Preparation Example 1: This preparation example provides a method for preparing a series of targeting vectors for constructing recombinant Escherichia coli, including the following steps: (1) Using the genome of the chassis strain as a template, the endogenous taurine dioxygenase encoding gene was amplified. tauD The upstream and downstream homologous arms (whose nucleotide sequence is shown in SEQ ID NO:7) were connected by fusion PCR to obtain the gene knockout fusion fragment. The PCR reaction conditions were: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension at a rate of 30 s / kb, repeated for 35 cycles; and finally, 72℃ extension for 10 min. (2) Using the genome of the chassis strain as a template, the upstream and downstream homologous arms of each insertion site were amplified, and simultaneously amplified using strong promoters. trc Furthermore, the gene encoding cysteine ​​dioxygenase from Bacillus subtilis, which has undergone codon optimization in E. coli, is being studied. CDO (Its nucleotide sequence is shown in SEQ ID NO:1), and it has a strong promoter. trc Furthermore, the human-derived cysteine ​​sulfinate decarboxylase encoding gene has undergone codon optimization in E. coli. CSAD (Its nucleotide sequence is shown in SEQ ID NO:2), and it has a strong promoter. trc Furthermore, the human-derived flavin monooxygenase 1 encoding gene has undergone codon optimization in E. coli. FMO1 (Its nucleotide sequence is shown in SEQ ID NO:3), and it has a strong promoter. trc E. coli endogenous pyridine nucleotide transhydrogenase encoding gene pntA (Its nucleotide sequence is shown in SEQ ID NO:4) and the gene pntB (Its nucleotide sequence is shown in SEQ ID NO:5), and it has a strong promoter. trc E. coli endogenous NADP + Glutamate-dependent dehydrogenase encoding gene gdhA (The nucleotide sequence is shown in SEQ ID NO:6) The target gene fragment was amplified, and the corresponding upstream homologous arm, the target gene fragment and the downstream homologous arm were connected by fusion PCR technology to obtain each gene insertion fusion fragment; the PCR reaction conditions were the same as in step (1). (3) Using pTarget plasmid as a template, primers were designed to induce mutations and sgRNA sequences that could target the corresponding gene loci were amplified to obtain the mutated pTarget fragments. The PCR reaction conditions were the same as in step (1). (4) Using a one-step cloning reaction, the gene knockout fusion fragment prepared in step (1) and the gene insertion fusion fragment prepared in step (2) are respectively linked to the mutated pTarget fragment in step (3) to obtain a series of recombinant pTarget plasmids; the reaction program is: incubate at 37℃ for 30 min.

[0037] Preparation Example 2: This preparation example provides a method for preparing a series of targeting vectors for constructing recombinant Escherichia coli, including the following steps: (1) Using the genome of the chassis strain as a template, the endogenous taurine dioxygenase encoding gene was amplified. tauDThe upstream and downstream homologous arms (whose nucleotide sequence is shown in SEQ ID NO:7) were connected by fusion PCR to obtain the gene knockout fusion fragment. The PCR reaction conditions were: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension at a rate of 38 s / kb, repeated for 35 cycles; and finally, 72℃ extension for 10 min. (2) Using the genome of the chassis strain as a template, the upstream and downstream homologous arms of each insertion site were amplified, and simultaneously amplified using strong promoters. trc Furthermore, the gene encoding cysteine ​​dioxygenase from Bacillus subtilis, which has undergone codon optimization in E. coli, is being studied. CDO (Its nucleotide sequence is shown in SEQ ID NO:1), and it has a strong promoter. trc Furthermore, the human-derived cysteine ​​sulfinate decarboxylase encoding gene has undergone codon optimization in E. coli. CSAD (Its nucleotide sequence is shown in SEQ ID NO:2), and it has a strong promoter. trc Furthermore, the human-derived flavin monooxygenase 1 encoding gene has undergone codon optimization in E. coli. FMO1 (Its nucleotide sequence is shown in SEQ ID NO:3), and it has a strong promoter. trc E. coli endogenous pyridine nucleotide transhydrogenase encoding gene pntA (Its nucleotide sequence is shown in SEQ ID NO:4) and the gene pntB (Its nucleotide sequence is shown in SEQ ID NO:5), and it has a strong promoter. trc E. coli endogenous NADP + Glutamate-dependent dehydrogenase encoding gene gdhA (The nucleotide sequence is shown in SEQ ID NO:6) The target gene fragment was amplified, and the corresponding upstream homologous arm, the target gene fragment and the downstream homologous arm were connected by fusion PCR technology to obtain each gene insertion fusion fragment; the PCR reaction conditions were the same as in step (1). (3) Using pTarget plasmid as a template, primers were designed to induce mutations and sgRNA sequences that could target the corresponding gene loci were amplified to obtain the mutated pTarget fragments. The PCR reaction conditions were the same as in step (1). (4) Using a one-step cloning reaction, the gene knockout fusion fragment prepared in step (1) and the gene insertion fusion fragment prepared in step (2) are respectively linked to the mutated pTarget fragment in step (3) to obtain a series of recombinant pTarget plasmids; the reaction program is: incubate at 37℃ for 30 min.

[0038] Preparation Example 3: This preparation example provides a method for preparing a series of targeting vectors for constructing recombinant Escherichia coli, including the following steps: (1) Using the genome of the chassis strain as a template, the endogenous taurine dioxygenase encoding gene was amplified. tauD The upstream and downstream homologous arms (whose nucleotide sequence is shown in SEQ ID NO:7) were connected by fusion PCR to obtain the gene knockout fusion fragment. The PCR reaction conditions were: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension at a rate of 45 s / kb, repeated for 35 cycles; and finally, 72℃ extension for 10 min. (2) Using the genome of the chassis strain as a template, the upstream and downstream homologous arms of each insertion site were amplified, and simultaneously amplified using strong promoters. trc Furthermore, the gene encoding cysteine ​​dioxygenase from Bacillus subtilis, which has undergone codon optimization in E. coli, is being studied. CDO (Its nucleotide sequence is shown in SEQ ID NO:1), and it has a strong promoter. trc Furthermore, the human-derived cysteine ​​sulfinate decarboxylase encoding gene has undergone codon optimization in E. coli. CSAD (Its nucleotide sequence is shown in SEQ ID NO:2), and it has a strong promoter. trc Furthermore, the human-derived flavin monooxygenase 1 encoding gene has undergone codon optimization in E. coli. FMO1 (Its nucleotide sequence is shown in SEQ ID NO:3), and it has a strong promoter. trc E. coli endogenous pyridine nucleotide transhydrogenase encoding gene pntA (Its nucleotide sequence is shown in SEQ ID NO:4) and the gene pntB (Its nucleotide sequence is shown in SEQ ID NO:5), and it has a strong promoter. trc E. coli endogenous NADP + Glutamate-dependent dehydrogenase encoding gene gdhA (The nucleotide sequence is shown in SEQ ID NO:6) The target gene fragment was amplified, and the corresponding upstream homologous arm, the target gene fragment and the downstream homologous arm were connected by fusion PCR technology to obtain each gene insertion fusion fragment; the PCR reaction conditions were the same as in step (1). (3) Using pTarget plasmid as a template, primers were designed to induce mutations and sgRNA sequences that could target the corresponding gene loci were amplified to obtain the mutated pTarget fragments. The PCR reaction conditions were the same as in step (1). (4) Using a one-step cloning reaction, the gene knockout fusion fragment prepared in step (1) and the gene insertion fusion fragment prepared in step (2) are respectively linked to the mutated pTarget fragment in step (3) to obtain a series of recombinant pTarget plasmids; the reaction program is: incubate at 37℃ for 30 min.

[0039] Examples 1-3: Example 1: This embodiment provides a recombinant Escherichia coli that produces taurine, its construction method, and its application, including the following steps: (1) The series of recombinant pTarget plasmids prepared in Preparation Example 1 were sequentially transformed into competent cells of the chassis strain containing pCas plasmid, plated on LB solid plates containing 50 mg / L spectinomycin hydrochloride and 50 mg / L kanamycin sulfate, and cultured at 30°C for 12 h to verify the positive clones. (2) Pick the above verified positive clones into LB liquid medium containing 50 mg / L kanamycin sulfate and 5 mM isopropyl thiogalactoside, and incubate at 30°C for 12 h to eliminate pTarget plasmid. (3) A single colony that successfully eliminated the pTarget plasmid was picked into a test tube containing 10 mL of LB liquid medium and cultured overnight at 42°C to eliminate the temperature-sensitive pCas plasmid, ultimately yielding a taurine-producing recombinant Escherichia coli without plasmid residue; this recombinant Escherichia coli had its endogenous genomic knockout eliminated. tauD The gene (whose nucleotide sequence is shown in SEQ ID NO:7) is integrated with a strong promoter. trc Driven expression CDO Gene (its nucleotide sequence is shown in SEQ ID NO:1), CSAD Gene (its nucleotide sequence is shown in SEQ ID NO:2), FMO1 Gene (its nucleotide sequence is shown in SEQ ID NO:3), pntA Gene (its nucleotide sequence is shown in SEQ ID NO:4), pntB Gene (whose nucleotide sequence is shown in SEQ ID NO:5) and gdhA Gene (its nucleotide sequence is shown in SEQ ID NO:6); (4) Seed culture: The above-mentioned recombinant Escherichia coli producing taurine, which was stored at -80℃, was streaked onto LB solid medium and activated by culturing at 37℃ for 12h; a single colony was picked and inoculated into 10mL of seed culture medium and cultured at 37℃ and 200rpm for 12h to obtain seed culture. (5) Shake flask fermentation: Inoculate the above seed liquid into a 500mL shake flask containing 100mL shake flask fermentation medium at a volume of 1%, and culture at 37℃ and 200rpm for 48h.

[0040] Example 2: This embodiment provides a recombinant Escherichia coli that produces taurine, its construction method, and its application, including the following steps: (1) The series of recombinant pTarget plasmids prepared in Preparation Example 2 were sequentially transformed into competent cells of the chassis strain containing pCas plasmid, plated on LB solid plates containing 50 mg / L spectinomycin hydrochloride and 50 mg / L kanamycin sulfate, and cultured at 30°C for 15 h to verify the positive clones. (2) Pick the above verified positive clones into LB liquid medium containing 50 mg / L kanamycin sulfate and 5 mM isopropyl thiogalactoside, and incubate at 30°C for 12 h to eliminate pTarget plasmid. (3) A single colony that successfully eliminated the pTarget plasmid was picked into a test tube containing 10 mL of LB liquid medium and cultured overnight at 42°C to eliminate the temperature-sensitive pCas plasmid, ultimately yielding a taurine-producing recombinant Escherichia coli without plasmid residue; this recombinant Escherichia coli had its endogenous genomic knockout eliminated. tauD The gene (whose nucleotide sequence is shown in SEQ ID NO:7) is integrated with a strong promoter. trc Driven expression CDO Gene (its nucleotide sequence is shown in SEQ ID NO:1), CSAD Gene (its nucleotide sequence is shown in SEQ ID NO:2), FMO1 Gene (its nucleotide sequence is shown in SEQ ID NO:3), pntA Gene (its nucleotide sequence is shown in SEQ ID NO:4), pntB Gene (whose nucleotide sequence is shown in SEQ ID NO:5) and gdhA Gene (its nucleotide sequence is shown in SEQ ID NO:6); (4) Seed culture: The above-mentioned recombinant Escherichia coli producing taurine, which was stored at -80℃, was streaked onto LB solid medium and activated by culturing at 37℃ for 12h; a single colony was picked and inoculated into 10mL of seed culture medium and cultured at 37℃ and 210rpm for 12h to obtain seed culture. (5) Shake flask fermentation: The above seed liquid was inoculated into a 500 mL shake flask containing 100 mL of shake flask fermentation medium at a volume of 1.5%, and cultured at 37℃ and 210 rpm for 48 h.

[0041] Example 3: This embodiment provides a recombinant Escherichia coli that produces taurine, its construction method, and its application, including the following steps: (1) The series of recombinant pTarget plasmids prepared in Preparation Example 3 were sequentially transformed into competent cells of the chassis strain containing pCas plasmid, plated on LB solid plates containing 50 mg / L spectinomycin hydrochloride and 50 mg / L kanamycin sulfate, and cultured at 30°C for 18 h to verify the positive clones. (2) Pick the above verified positive clones into LB liquid medium containing 50 mg / L kanamycin sulfate and 5 mM isopropyl thiogalactoside, and incubate at 30°C for 12 h to eliminate pTarget plasmid. (3) A single colony that successfully eliminated the pTarget plasmid was picked into a test tube containing 10 mL of LB liquid medium and cultured overnight at 42°C to eliminate the temperature-sensitive pCas plasmid, ultimately yielding a taurine-producing recombinant Escherichia coli without plasmid residue; this recombinant Escherichia coli had its endogenous genomic knockout eliminated. tauD The gene (whose nucleotide sequence is shown in SEQ ID NO:7) is integrated with a strong promoter. trc Driven expression CDO Gene (its nucleotide sequence is shown in SEQ ID NO:1), CSAD Gene (its nucleotide sequence is shown in SEQ ID NO:2), FMO1 Gene (its nucleotide sequence is shown in SEQ ID NO:3), pntA Gene (its nucleotide sequence is shown in SEQ ID NO:4), pntB Gene (whose nucleotide sequence is shown in SEQ ID NO:5) and gdhA Gene (its nucleotide sequence is shown in SEQ ID NO:6); (4) Seed culture: The above-mentioned recombinant Escherichia coli producing taurine, which was stored at -80℃, was streaked onto LB solid medium and activated by culturing at 37℃ for 12h; a single colony was picked and inoculated into 10mL of seed culture medium and cultured with shaking at 37℃ and 220rpm for 12h to obtain seed culture. (5) Shake flask fermentation: Inoculate the above seed liquid into a 500mL shake flask containing 100mL shake flask fermentation medium at a volume inoculation rate of 2%, and culture at 37℃ and 220rpm for 48h.

[0042] Comparative Examples 1-5: Comparative Example 1: Compared with Example 2, the difference is that no genome editing was performed on the chassis strain. Instead, the L-cysteine-producing chassis strain derived from E. coli MG1655 without gene editing was directly used for seed culture and shake-flask fermentation. All other aspects are the same.

[0043] Comparative Example 2: The difference compared to Example 2 is that the targeting vector did not contain the gene encoding the knockout of endogenous taurine dioxygenase. tauD The steps, namely the final construction of recombinant E. coli without knocking out endogenous [products / bacteria], are as follows: tauD Genes are identical, everything else is the same.

[0044] Comparative Example 3: Compared to Example 2, the difference lies in that the preparation of the targeting carrier did not include the introduction of... pntA Gene, pntB Genes and gdhA The genetic steps, namely the final construction of recombinant E. coli that is not integrated into the endogenous E. coli... pntA Gene, pntB Genes and gdhA Genes are identical, everything else is the same.

[0045] Comparative Example 4: The difference compared to Example 2 lies in the integration of [specific components / elements] during the construction of recombinant E. coli. CDO Gene, CSAD Gene, FMO1 Gene, pntA Gene, pntB Genes and gdhA None of the genes used strong promoters. trc Instead of using a conventional E. coli endogenous promoter for expression, the expression was driven by a standard E. coli endogenous promoter; all other aspects remained the same.

[0046] Comparative Example 5: Compared with Example 2, the difference is that in step (5) of the shake flask fermentation process, the volume inoculum amount is replaced with 5%, and the shaking rotation speed is replaced with 150 rpm, while the rest are the same.

[0047] Test Example 1-3: Test Example 1: This test case aims to verify the promoting effect of increased intracellular cofactor levels and precursor pool capacity in recombinant Escherichia coli on the heterologous synthesis of taurine.

[0048] Experimental steps: Take 5 mL of each of the fermentation broth from Examples 1 to 3 and Comparative Examples 1 to 5, which were cultured in shake flasks for 24 h, as the experimental subjects. Centrifuge at 8000 rpm for 10 min at 4 °C, pour off the supernatant and retain the bottom cell precipitate. Then add pre-cooled 0.1 M phosphate buffer and gently resuspend. Repeat centrifugation and washing twice to remove the attached culture medium components.

[0049] The washed bacterial cells were suspended in an extraction buffer containing 0.5% Triton X-100 at a solid-liquid ratio of 1:5. The cells were then placed in an ice-water bath and subjected to cell disruption using an ultrasonic cell disruptor. The instrument power was set to 300W, and the working mode was 3 seconds of sonication followed by 5 seconds of intermittent sonication, for a total duration of 15 minutes. The disrupted solution was centrifuged at 12,000 rpm at 4°C for 15 minutes, and the clear supernatant was collected as the crude extract of intracellular metabolites for testing.

[0050] A portion of the test solution was transferred to a micro-volume quartz cuvette, and a cofactor cycling detection system was constructed by adding specific dehydrogenase and phenazine dimethyl sulfate. The absorbance change was dynamically monitored at 340 nm using a UV-Vis spectrophotometer, and the NADP was calculated based on a pre-prepared standard curve. + The absolute molar concentration of NADPH was used as the basis for calculating the ratio between the two based on the sample volume of the fermentation broth.

[0051] Add an equal volume of 10% trifluoroacetic acid solution to the remaining test solution, shake thoroughly, allow to stand to precipitate impurities, centrifuge to obtain the supernatant, and perform pre-column derivatization reaction with phthalaldehyde and fluorenemethyloxycarbonyl chloride under weakly alkaline conditions for 30 min. Filter the reaction solution through a 0.22 μm microporous membrane and inject it into a high-performance liquid chromatograph equipped with a C18 reversed-phase analytical column. Use a gradient elution with a sodium acetate buffer system containing tetrahydrofuran and an acetonitrile-methanol mixture as the mobile phase, controlling the flow rate at 1.0 mL / min. Record the peak area of ​​each substance using a detector and substitute it into the external standard curve to accurately quantify the intracellular glutamate and L-cysteine ​​content.

[0052] Table 1. Intracellular cofactor and precursor concentration test data of the examples and comparative examples

[0053] in conclusion: Based on the data in Table 1 and the appendix Figure 1 The feasibility of altering the metabolic flux in recombinant *E. coli* has been validated at the biochemical level. In its unmodified state, wild-type *E. coli* exhibits a predominantly catabolic NADH balance, while its NADPH reserves, involved in anabolism, are relatively low. The introduced heterologous taurine synthesis pathway requires higher molecular oxygen activation, particularly flavin monooxygenase. FMO1Catalytic substrate oxidation processes require a large amount of NADPH as an electron donor. The example strain overexpressed the gene encoding an endogenous membrane-bound transhydrogenase gene from *E. coli*. pntA and pntB This promotes the conversion of NADH to NADP driven by the proton transmembrane gradient. + Electron transfer. Test results show that the NADPH / NADP ratio in the example group... + The ratios all reached above 1.8, which was significantly increased compared with the control group 1, which relied solely on basal metabolism. This indicates that the intracellular reducing power level was improved, which could meet the electron requirements of heterologous oxygenation.

[0054] The taurine synthesis pathway is based on sulfur-containing amino acids, with L-cysteine ​​as a direct precursor. Its concentration directly affects the overall efficiency of downstream enzymatic cascade reactions. In the *E. coli* L-cysteine ​​synthesis pathway, the reaction of hydrogen sulfide with O-acetylserine requires a stable amino donor. The example strain overexpressed the glutamate dehydrogenase gene. gdhA At higher NADPH levels, the efficiency of inorganic ammonia assimilation into free glutamate is improved. (From the attached...) Figure 1 The differences in chromatographic signal responses show that the peak area of ​​glutamate in Example 2 is significantly larger than that in Comparative Example 3. The increased glutamate leads to a higher steady-state concentration of L-cysteine ​​through transamination. Comparative Example 3, lacking the aforementioned two metabolic modifications, even with the expression of a complete synthetic gene cluster, struggles to maintain multi-step continuous catalytic reactions due to limitations in precursor and cofactor concentrations. These test results demonstrate, from a biochemical perspective, that simultaneously enhancing the supply of cofactors and precursors has a practical effect on promoting heterologous synthesis.

[0055] Test Example 2: This test case aims to verify the actual situation of cascade enzymatic reactions constructing taurine biosynthetic flux within recombinant Escherichia coli, and the effect of knocking out endogenous genes in the genome on blocking product degradation.

[0056] Experimental steps: Ten mL of fermentation broth from Examples 1 to 3 and Comparative Examples 1 to 2, fermented for 48 h, was extracted as experimental subjects. The bacterial cell precipitate was collected by centrifugation at 8000 rpm for 10 min at 4 °C and washed twice with pure water. The bacterial cells were added to a pre-cooled methanol-water mixture at a solid-liquid ratio of 1:10, and the cell walls were broken by three freeze-thaw cycles between liquid nitrogen and room temperature. The mixture was then centrifuged at 12000 rpm for 15 min at 4 °C. The supernatant was filtered through a 0.22 μm microporous membrane to prepare the intracellular metabolite analysis solution.

[0057] The above analytical solution was injected into a liquid chromatography-tandem mass spectrometry (LC-MS / MS) system equipped with a hydrophilic interaction column. The mobile phase consisted of acetonitrile and water containing 0.1% formic acid, with gradient elution performed at a flow rate of 0.3 mL / min. Mass spectrometry was run using an electrospray ionization source in positive ion mode. Based on the retention times and characteristic fragment ions of the standards, the peak area responses of L-cysteine ​​sulfinic acid and taurine in the system were measured and recorded.

[0058] Separately, bacterial cultures of the aforementioned strains were collected at the late logarithmic growth stage during fermentation. The cells were collected by centrifugation and washed three times with 0.1M phosphate buffer to remove residual nutrients from the fermentation medium. The cleaned bacterial cells were resuspended in the same buffer, and the absorbance (OD600) of the cell suspension was adjusted to approximately 10.0 to prepare a resting cell suspension for testing.

[0059] Taurine standard at a final concentration of approximately 100 mg / L was added to a test vial containing a suspension of resting cells, and the vial was incubated at 37°C and 200 rpm for 12 hours. Samples were taken at the initial addition and at the end of the incubation to obtain the supernatant. The initial and residual concentrations of taurine in the buffer system were determined using high-performance liquid chromatography combined with pre-column derivatization with phthalaldehyde, and the degradation and consumption rate of taurine in the system by the corresponding bacterial strain was then calculated.

[0060] Table 2. Relative abundance of intermediate metabolites and taurine degradation rate test data in the examples and comparative examples

[0061] Note: "Not detected" means that the concentration of the target metabolite in the sample is below the detection limit of the liquid chromatography-tandem mass spectrometry instrument, and no effective chromatographic peak response signal can be collected.

[0062] in conclusion: According to the test data in Table 2, the unmodified wild-type E. coli Comparative Example 1 lacked the corresponding specific catalytic enzymes, and its mass spectrometry analysis failed to detect the two characteristic intermediates, L-cysteine ​​sulfinic acid and taurine. In the Example group, after integrating the amino acid decarboxylation and oxidation gene clusters, high abundance of intermediate metabolites was detected intracellularly. The detection results objectively demonstrate that the introduced heterologous cascade enzymes maintained catalytic activity within the chassis cells, shifting the original carbon and nitrogen metabolic flow towards taurine synthesis, and effectively constructing a de novo metabolic pathway intracellularly.

[0063] The resting cell assay system eliminates non-specific uptake interference from the bacterial growth and expansion phase, allowing for a more direct reflection of the degree of pure enzymatic degradation. In the endogenous organosulfur assimilation pathway of *E. coli*, tauDThe gene encodes a dioxygenase that cleaves the carbon-sulfur bond of taurine, converting it into sulfite and an amino aldehyde. Data showed that Comparative Example 2, which retained this gene, exhibited substrate consumption during incubation, resulting in a decreased residual amount at the endpoint. Example strains in the knockout stage... tauD After gene blocking, the taurine concentration in the system remained basically at the initial level, with a degradation rate of less than 1%. This gene blocking of the endogenous degradation bypass cut off the cell's consumption pathway of existing products, avoiding the ineffective cycle of intracellular synthesis and decomposition, and laying the foundation for the stable high concentration accumulation of taurine in the later stage of fermentation.

[0064] Test Example 3: This test case aims to verify the overall effect of genome editing and fermentation process optimization on the ability of Escherichia coli to synthesize taurine through quantitative analysis of the final fermentation yield.

[0065] Experimental steps: Two mL of fermentation culture from Examples 1 to 3 and Comparative Examples 1 to 5 after 72 h of shake-flask fermentation was extracted as experimental subjects. The fermentation broth was transferred to centrifuge tubes and centrifuged at 10,000 rpm for 10 min at 4 °C. The supernatant was collected, and the bacterial precipitate at the bottom was discarded.

[0066] Take 1 mL of the supernatant obtained by centrifugation and add an equal volume of 10% trifluoroacetic acid aqueous solution to precipitate impurities in the fermentation broth. Vortex the mixture vigorously for 1 min, let it stand for 15 min, and then centrifuge again at 12000 rpm for 15 min at 4 °C. Pass the supernatant through a 0.22 μm aqueous microporous membrane to obtain a protein-free pretreated fermentation broth.

[0067] Take 100 μL of the filtered pretreatment solution, add borate buffer to adjust the pH to weakly alkaline, then add dansyl chloride acetone solution and react in the dark for 45 min. The derivatizing reagent reacts with the amino group in the taurine molecule to generate a derivative with high UV absorption properties. After the reaction is complete, add a small amount of methylamine solution to terminate the reaction.

[0068] The derivatized samples were injected into a high-performance liquid chromatograph (HPLC) for separation and analysis. A C18 reversed-phase column was used, with a gradient elution of an aqueous solution containing an appropriate amount of glacial acetic acid and acetonitrile. The flow rate was maintained at 1.0 mL / min, and the column temperature was set to 35 °C. The UV detector wavelength was set to 254 nm. Absolute quantification of taurine in each fermentation broth was performed based on a standard curve generated from taurine standards.

[0069] Table 3. Taurine yield test data from fermentation broths of the examples and comparative examples

[0070] Note: "Not detected" means that the concentration of the target product in the sample is below the limit of quantitation for liquid chromatography, and no effective chromatographic peak is generated.

[0071] in conclusion: Based on the data in Table 3 and the appendix Figure 2 Various genome editing and process optimization measures jointly promoted the increase in taurine production. The unmodified chassis strain (Comparative Example 1) was unable to synthesize taurine, which, at the macroscopic level, confirmed that the chassis cells originally lacked the synthetic pathway for the target compound. In contrast, the final fermentation yields of the Example groups all reached over 60 ng / mL. This accumulation of yield is essentially the result of the combined effects of heterologous cascade enzyme expression, knockout of byproduct degradation pathways, and enhanced supply of precursors and cofactors.

[0072] In the validation of specific genetic modification strategies, the comparative example 2, which did not knock out the degradation gene, had a final fermentation yield of only 12.9 ng / mL. This indicates that the taurine synthesized intracellularly was largely consumed by the chassis's own dioxygenase system, suggesting that knocking out the degradation gene was not the correct approach. tauD Genes are a necessary step in maintaining the stable accumulation of products. Comparative Example 3 did not introduce... pntA Gene, pntB Genes and gdhA Insufficient gene, intracellular reducing power, and direct precursor supply lead to substrate limitation in the synthetic pathway, resulting in yields only about one-third of those in the example group; combined with the appendix Figure 2 The chromatographic signals also show that the peak area corresponding to Example 2 is higher than that of Comparative Example 3. Furthermore, Comparative Example 4 did not use a strong promoter for expression regulation, resulting in lower levels of enzyme protein transcription and translation, which limited the metabolic flux of the tandem catalytic reaction and consequently significantly limited the final product concentration.

[0073] Besides gene-level construction, the process parameters during fermentation also directly affect the actual acid-producing capacity of the engineered strain. In Comparative Example 5, after changing the inoculum size and shaking speed, the growth indicators of the strain declined, and the yield decreased to 7.8 ng / mL. Since the synthetic pathway involves key enzymes that rely on molecular oxygen activation, reducing the shaking speed leads to insufficient dissolved oxygen in the fermentation system, thereby hindering the normal catalytic cycle of oxygenases. At the same time, an unsuitable inoculum size disrupts the original fermentation process, easily causing cells to enter the apoptosis phase prematurely or exacerbating the overall metabolic burden. The fermentation parameters determined in the examples relatively well meet the nutritional and dissolved oxygen requirements of the recombinant strain under multiple metabolic fluxes, thus ensuring an effective increase in taurine fermentation titer.

[0074] Appendix: CDO Nucleotide sequence: SEQ ID NO:1: ATGGAACTGTATGAATGTATTCAGGACATCTTCGGCGGCCTGAAAAATCCGTCTGTCAAAGATCTGGCTACTAGCCTGAAACAGATCCCAAACGCAGCCAAACTGAGCCAGCCGTACATCAAGGAACCAGATCAGTACGCATACGGTCGTAACGCGATCTACCGCAACAACGAACTGGAGATCATCGTGATCAACATTCCGCCGAACAAGGAAACCACCGTCCACGATCACGGTCAGTCTATTGGTTGCGCAATGGTTCTGGAAGGCAAACTGCTGAACTCTATCTACCGTTCTACCGGTGAACATGCTGAACTGAGCAACAGCTACTTCGTACACGAAGGTGAGTGCCTGATCAGCACCAAGGGTCTGATTCACAAAATGTCCAACCCTACCTCTGAACGTATGGTGTCTCTGCATGTTTATTCTCCGCCTCTGGAGGACATGACTGTGTTCGAAGAACAGAAGGAAGTTCTGGAAAACTCTTAA。

[0075] CSAD The nucleotide sequence: SEQ ID NO: 2:

[0076] FMO1 Nucleotide sequence: SEQ ID NO:3:

[0077] pntA Nucleotide sequence: SEQ ID NO:4:

[0078] pntB Nucleotide sequence: SEQ ID NO:5:

[0079] gdhA Nucleotide sequence: SEQ ID NO:6:

[0080] tauD Nucleotide sequence: SEQ ID NO:7: ATGAGTGAACGTCTGAGCATTACCCCGCTGGGGCCGTATATCGGCGCACAAATTTCGGGTGCCGACCTGACGCGCCCGTTAAGCGATAATCAGTTTGAACAGCTTTACCATGCGGTGCTGCGCCATCAGGTGGTGTTTCTACGCGATCAAGCTATTACGCCGCAGCAGCAACGCGCGCTGGCCCAGCGTTTTGGCGAATTGCATATTCACCCTGTTTACCCGCATGCCGAAGGGGTTGACGAGATCATCGTGCTGGATACCCATAACGATAATCCGCCAGATAACGACAACTGGCATACCGATGTGACATTTATTGAAACGCCACCCGCAGGGGCGATTCTGGCAGCTAAAGAGTTACCTTCGACCGGCGGTGATACGCTCTGGACCAGCGGTATTGCGGCCTATGAGGCGCTCTCTGTTCCCTTCCGCCAGCTGCTGAGTGGGCTGCGTGCGGAGCATGATTTCCGTAAATCGTTCCCGGAATACAAATACCGCAAAACCGAGGAGGAACATCAACGCTGGCGCGAGGCGGTCGCGAAAAACCCGCCGTTGCTACATCCGGTGGTGCGAACGCATCCGGTGAGCGGTAAACAGGCGCTGTTTGTGAATGAAGGCTTTACTACGCGAATTGTTGATGTGAGCGAGAAAGAGAGCGAAGCCTTGTTAAGTTTTTTGTTTGCCCATATCACCAAACCGGAGTTTCAGGTGCGCTGGCGCTGGCAACCAAATGATATTGCGATTTGGGATAACCGCGTGACCCAGCACTATGCCAATGCCGATTACCTGCCACAGCGACGGATAATGCATCGGGCGACGATCCTTGGGGATAAACCGTTTTATCGGGCGGGGTAA。

Claims

1. A recombinant Escherichia coli that produces taurine, characterized in that, The recombinant E. coli knockout endogenous tauD Genes, and integration by strong promoters trc Driven expression CDO Gene, CSAD Gene, FMO1 Gene, pntA Gene, pntB Genes and gdhA Genes, by knocking out endogenous degradation pathways and enhancing the supply of cofactors and precursors.

2. The recombinant Escherichia coli producing taurine according to claim 1, characterized in that, The CDO The gene is a cysteine ​​dioxygenase encoding gene derived from Bacillus subtilis with codon optimization in Escherichia coli, and the nucleotide sequence is SEQ ID NO:1; The CSAD The gene is a human-derived cysteine ​​sulfinate decarboxylase encoding gene with codon optimization in E. coli, and its nucleotide sequence is SEQ ID NO:2; The FMO1 The gene is a human-derived flavin monooxygenase 1 encoding gene optimized with E. coli codons, and its nucleotide sequence is SEQ ID NO:

3.

3. The recombinant Escherichia coli producing taurine according to claim 1, characterized in that, The tauD The gene is the gene encoding endogenous taurine dioxygenase in Escherichia coli, and its nucleotide sequence is SEQ ID NO:7; The pntA Genes and pntB The genes are all encoding E. coli endogenous pyridine nucleotide transhydrogenase genes, and their nucleotide sequences are SEQ ID NO:4 and SEQ ID NO:5, respectively. The gdhA The gene is endogenous NADP in E. coli. + The gene encoding glutamate-dependent dehydrogenase has the nucleotide sequence SEQ ID NO:

6.

4. A method for constructing a recombinant taurine-producing *Escherichia coli* according to any one of claims 1-3, characterized in that, Includes the following steps: Will contain tauD A series of recombinant pTarget plasmids containing gene knockout fragments and various target gene insertion fragments were transformed into competent cells of a chassis strain containing pCas plasmids and cultured on solid plates containing spectinomycin hydrochloride and kanamycin sulfate to verify the acquisition of positive clones and single colonies. The positive clones were picked and inoculated into a first liquid culture medium containing kanamycin sulfate and isopropyl thiogalactoside to eliminate the pTarget plasmid and isolate the single colonies that eliminated the pTarget plasmid. The single colony with pTarget plasmid eliminated was picked into the second liquid culture medium and cultured overnight at high temperature to eliminate the temperature-sensitive pCas plasmid, finally obtaining taurine-producing recombinant Escherichia coli without plasmid residue.

5. The construction method according to claim 4, characterized in that, A series of recombinant pTarget plasmids were prepared in advance. The preparation process was as follows: Gene knockout fusion fragments and individual gene insertion fusion fragments were obtained using fusion PCR technology. The pTarget plasmid was mutated to amplify the sgRNA sequence targeting the corresponding gene locus, resulting in the mutated pTarget fragment; The gene knockout fusion fragment and the gene insertion fusion fragments are respectively ligated to the corresponding mutated pTarget fragments using a one-step cloning reaction.

6. The construction method according to claim 5, characterized in that, During the preparation process, the reaction conditions for the fusion PCR technology are as follows: Pre-denaturation at 95℃ for 5 min, denaturation at 95℃ for 30 s, annealing at 58℃ for 30 s, extension at 72℃ with the extension time calculated at a rate of 30-45 s / kb, repeating 35 cycles, and finally extension at 72℃ for 10 min. The procedure for the one-step cloning reaction is incubation at 37℃ for 30 min.

7. The construction method according to claim 4, characterized in that, During the transformation of the competent cells of the chassis strain and their culture on solid plates, the culture temperature was 30℃ and the culture time was 12-18h. During the process of picking the positive clone single colony and inoculating it into the first liquid culture medium, the first liquid culture medium contains a final concentration of 50 mg / L kanamycin sulfate and 5 mM isopropyl thiogalactoside, the culture temperature is 30℃, and the culture time is 12 h. During the process of picking the single colony that eliminated the pTarget plasmid into the second liquid culture medium for overnight high-temperature culture, the temperature of the overnight high-temperature culture was 42°C.

8. The application of a recombinant taurine-producing *Escherichia coli* according to any one of claims 1-3 in the fermentation production of taurine, characterized in that, include: Seed culture was performed on recombinant Escherichia coli that produces taurine to obtain seed solution; The seed culture was inoculated into a shake-flask fermentation medium for shake-flask fermentation, and taurine was eventually accumulated in the fermentation broth.

9. The application according to claim 8, characterized in that, The seed culture process is as follows: Recombinant Escherichia coli producing taurine was inoculated into a solid culture medium for activation. Single colonies were picked and inoculated into a seed culture medium and cultured with shaking at 37°C and 200-220 rpm for 12 h.

10. The application according to claim 8, characterized in that, The fermentation parameter control range is as follows: The inoculum size is 1-2%, the fermentation temperature is 37℃, the shaking speed is 200-220 rpm, and the fermentation time is 48 hours.

Images