Streptococcus zooepidemicus for high yield of medium and high molecular weight hyaluronic acid and application thereof

Abstract

The present application relates to a kind of high yield of high molecular weight hyaluronic acid of streptococcus zooepidemicus and its application, belong to the field of bioengineering technology.The present application is by knocking out lactate dehydrogenase gene (ldh) to remove growth inhibition, knock out endogenous hyaluronidase gene (hyl) to prevent product degradation, overexpressing the hyaluronic acid synthase gene (hasA) and UDP-glucose dehydrogenase gene (hasB) optimized by promoter and copy number system to strengthen synthesis pathway, introduce codon-optimized Vibrio globigii hemoglobin gene (vgb) to break through the limitation of dissolved oxygen, and overexpressing cysteine transporter gene (fliY1) to realize the directional regulation of medium molecular weight, construct the streptococcus zooepidemicus of multi-gene synergistic modification.

Description

Technical Field

[0001] This invention relates to the field of bioengineering technology, and in particular to a Streptococcus vesiculosus strain that produces high-molecular-weight hyaluronic acid and its applications. Background Technology

[0002] Hyaluronic acid (HA) is a linear high-molecular-weight mucopolysaccharide composed of D-glucuronic acid and N-acetylglucosamine. Due to its unique moisturizing properties, viscoelasticity, and biocompatibility, it is widely used in pharmaceuticals, cosmetics, and food. High molecular weight hyaluronic acid (molecular weight ≥ 1 × 10⁻⁶) 6 Due to its excellent viscoelasticity, moisturizing properties, anti-inflammatory effects, and lubrication, HA can be used for intra-articular injection to restore the viscoelasticity of joint tissues and repair cartilage degeneration. Currently, the main strain for industrial production of HA is Streptococcus equisubsp. zooepidemicus, because it has the natural ability to synthesize high molecular weight HA and its yield is relatively high.

[0003] However, the production of HA using wild-type Streptococcus vesicularis remains a challenge. First, HA synthesis requires significant energy and precursors (UDP-glucuronic acid and UDP-N-acetylglucosamine), competing for carbon sources with cell growth and the synthesis of byproducts such as lactic acid. In particular, lactate dehydrogenase (ldh) catalyzes the conversion of pyruvate to lactic acid, consuming not only carbon sources but also inhibiting cell growth and product synthesis due to lactic acid accumulation. Second, HA fermentation is a highly aerobic process; as fermentation progresses, the cell density (OD) decreases. 600 The increase in dissolved oxygen leads to a sharp rise in the viscosity of the fermentation broth, making dissolved oxygen a limiting factor and restricting further cell proliferation and the continuous synthesis of HA. Third, regulating the molecular weight of HA has always been a challenge in the industry; different applications have different requirements for HA molecular weight, but currently there is a lack of effective methods for molecular weight regulation. Fourth, the lack of existing gene manipulation tools limits the metabolic engineering modification of Streptococcus vesiculosus.

[0004] In recent years, although some studies have reduced byproducts by knocking out the ldh gene, single modification has limited effect on improving cell density and yield; some studies have improved growth under hypoxic conditions by introducing the *Vibrio hygroscopicus* hemoglobin gene (vgb), but did not simultaneously enhance the synthetic pathway; and some studies have prepared small molecule HA by heterologous expression of hyaluronidase, but this is often accompanied by a decrease in yield. Currently, there are no reports of achieving high cell density, high yield, and controllable high molecular weight simultaneously through a multi-gene synergistic strategy. Summary of the Invention

[0005] Therefore, the technical problem to be solved by the present invention is to overcome the lack of a Streptococcus vesiculosus strain capable of producing high-molecular-weight hyaluronic acid in the prior art.

[0006] To address the aforementioned technical problems, this invention provides a Streptococcus vesiculosus strain that produces high-molecular-weight hyaluronic acid and its applications. This invention targets five core bottlenecks in the fermentation production of hyaluronic acid from Streptococcus vesiculosus: inhibition by lactic acid byproducts, degradation of products during high-density fermentation, insufficient supply of synthetic precursors, oxygen limitation in high-viscosity systems, and the inability to simultaneously achieve targeted synthesis and yield of medium-to-high molecular weight hyaluronic acid. The invention constructs a multi-gene synergistically modified Streptococcus vesiculosus strain by: knocking out the lactate dehydrogenase gene (ldh) to relieve growth inhibition; knocking out the endogenous hyaluronidase gene (hyl) to prevent product degradation; overexpressing the promoter- and copy number-optimized hyaluronic acid synthase gene (hasA) and UDP-glucose dehydrogenase gene (hasB) to enhance the synthetic pathway; introducing the codon-optimized *Vibrio hysterosus* hemoglobin gene (vgb) to overcome dissolved oxygen limitations; and overexpressing the cysteine ​​transporter gene (fliY1) to achieve targeted regulation of medium molecular weight hyaluronic acid.

[0007] The first objective of this invention is to provide a Streptococcus vesiculosus strain that produces high-molecular-weight hyaluronic acid, wherein the Streptococcus vesiculosus strain has lactate dehydrogenase and hyaluronidase knocked out, and hyaluronic acid synthase, UDP-glucose dehydrogenase and hemoglobin overexpressed, wherein the hyaluronic acid synthase, UDP-glucose dehydrogenase and hemoglobin are expressed using the PENO promoter.

[0008] Furthermore, the Streptococcus vesiculosus also overexpresses a cysteine ​​transporter protein, wherein the Gene ID of the cysteine ​​transporter protein is 878270.

[0009] Furthermore, the cysteine ​​transporter is expressed using the Pgap promoter.

[0010] Furthermore, the NCBI number of the lactate dehydrogenase is WP_012515644.1, the NCBI number of the hyaluronidase is WP_012515900.1, the NCBI number of the hyaluronic acid synthase is WP_012514859.1, the NCBI number of the UDP-glucose dehydrogenase is WP_012514860.1, and the NCBI number of the hemoglobin is WP_019959060.1.

[0011] Furthermore, the gene sequence of the PENO promoter is shown in SEQ ID NO.1.

[0012] SEQ ID NO.1:

[0013]

[0014] Furthermore, the gene sequence of the Pgap promoter is shown in SEQ ID NO.2.

[0015] SEQ ID NO.2:

[0016] Tttttgtagaaatgtcttggtgtcctcgtccaatcaggtagccatctctgaaatatctggctccgttgcaactccgaacgacctgctggcaacgtaaaattctccggggtaaaacttaa atgtggagtaatggaaccagaaacgtctcttcccttctctctccttccaccgcccgttaccgtccctaggaaattttactctgctggagagcttcttctacggcccccttgcagcaatgc tcttcccagcattacgttgcgggtaaaacggaggtcgtgtacccgacctagcagcccagggatggaaaagtcccggccgtcgctggcaataatagcgggcggacgcatgtcatgagatt attggaaaccaccagaatcgaatataaaaggcgaacacctttcccaattttggtttctcctgacccaaagactttaaatttaatttatttgtccctatttcaatcaattgaacaactat.

[0017] A second objective of this invention is to provide an enzyme preparation containing the aforementioned Streptococcus vesiculosus.

[0018] A third objective of this invention is to provide the application of the above-mentioned Streptococcus vesiculosus or the above-mentioned enzyme preparation in the production of hyaluronic acid.

[0019] The fourth objective of this invention is to provide a method for regulating the molecular weight of hyaluronic acid, wherein the method involves constructing Streptococcus vesicatoria and inoculating the Streptococcus vesicatoria into a fermentation medium for culture.

[0020] Among them, when the molecular weight is 0.7×10 6 Da-1.2×10 6When Da produces hyaluronic acid, the Streptococcus vesiculosus knocks out lactate dehydrogenase and hyaluronidase, and overexpresses hyaluronic acid synthase, UDP-glucose dehydrogenase, cysteine ​​transporter and hemoglobin, wherein the hyaluronic acid synthase, UDP-glucose dehydrogenase and hemoglobin are expressed using the PENO promoter, and the cysteine ​​transporter is expressed using the Pgap promoter. When producing a molecular weight of 1.8 × 10 6 Da-2.4×10 6 When Da produces hyaluronic acid, the Streptococcus vesiculosus knocks out lactate dehydrogenase and hyaluronidase, and overexpresses hyaluronic acid synthase, UDP-glucose dehydrogenase and hemoglobin, wherein the expression of hyaluronic acid synthase, UDP-glucose dehydrogenase and hemoglobin is initiated by the PENO promoter.

[0021] Furthermore, the fermentation medium includes glucose, yeast extract, monosodium glutamate, and K₂HPO₄. 4、 MgSO4·7H2O and MnSO4.

[0022] Compared with the prior art, the above-described technical solution of the present invention has the following advantages:

[0023] The engineered bacteria of this invention showed OD in a 5L fermenter 600 The OD value reached 28.5, and the hyaluronic acid yield reached 16.2 g / L, an increase of 161.3% compared to the wild type; after optimization of the fermentation process, the OD value was further improved. 600 The yield reached 18.5 g / L, with a sugar-acid conversion rate of 17.8%, and 2.05 × 10⁻⁶ g / L could be stably synthesized. 6 This invention also achieves high molecular weight hyaluronic acid (HHA) with a molecular weight of 0.8 × 10⁻⁶ through a combination of expression element optimization and strain modification. 6 Up to 2.45×10 6 Customized production of high molecular weight hyaluronic acid provides an efficient cell factory for the industrial-scale high-density fermentation of hyaluronic acid. Detailed Implementation

[0024] The present invention will be further described below with reference to specific embodiments, so that those skilled in the art can better understand and implement the present invention, but the embodiments are not intended to limit the present invention.

[0025] Example 1: Establishment of a gene editing system

[0026] Using the industrial production strain SD-1 of Streptococcus vesiculosus as the starting strain, an optimized electroporation method (collecting cells during the logarithmic growth phase, electroporating at 3 kV and 200 Ω, followed by a 3-hour recovery period) significantly improved transformation efficiency. Highly efficient gene editing was achieved using a RecT-assisted endogenous CRISPR / SzCas9 system: sgRNAs targeting specific genes were designed, a small CRISPR array was constructed, and co-expressed with the RecT recombinase, increasing gene knockout efficiency from less than 10% to over 60%. This enabled marker-free gene deletion, gene substitution, and stop codon insertion.

[0027] Example 2: Construction and Validation of Single-Gene Modified Strains

[0028] 1. Knockout of lactate dehydrogenase gene (ldh) – relieve growth inhibition

[0029] A CRISPR array targeting ldh and a homology repair template were constructed, and the ldh knockout strain SZ-Δldh was obtained through transformation and screening. Shake-flask fermentation results (Table 1) showed that lactic acid accumulation in SZ-Δldh decreased from 8.7 g / L to 1.5 g / L (-82.8%), and OD... 600 The concentration of lactic acid (LDH) increased from 4.5 to 6.2 (+37.8%), and the HA yield increased from 2.3 g / L to 3.8 g / L (+65.2%). This indicates that knocking out LDH significantly relieved the inhibition of growth by lactic acid, increased cell density, and thus improved HA yield.

[0030] Table 1. Effects of ldh knockout on bacterial growth and HA production.

[0031]

[0032] 2. Knock out the hyaluronidase gene (hyl) – to prevent product degradation under high density.

[0033] A hyl knockout strain, SZ-Δhyl, was constructed. Hyaluronidase activity assays showed that the wild-type fermentation supernatant exhibited significant enzyme activity, while SZ-Δhyl was almost undetectable. Extending fermentation to 48 h reduced the wild-type HA yield from 2.3 g / L to 1.8 g / L, and the molecular weight decreased to 1.20 × 10⁻⁶. 6 Da; while the yield of SZ-Δhyl increased from 2.4 g / L to 2.6 g / L, and the molecular weight remained at 1.90 × 10⁻⁶. 6 Da indicates that knocking out hyl can prevent product degradation in the later stages of high-density fermentation, ensuring that the high yield potential brought by high OD is realized.

[0034] Table 2. Effects of hyl knockout on hyaluronidase activity, cell growth, and HA stability.

[0035]

[0036] 3. Overexpression of UDP-glucose dehydrogenase gene (hasB) – matching precursor requirements under high OD conditions

[0037] A hasB overexpression strain, SZ-OEhasB, was constructed. Enzyme activity assays showed that the HasB specific enzyme activity reached 0.85 U / mg, which is 4 times that of the wild type (0.21 U / mg). Shake-flask fermentation (Table 3) showed that OD... 600 Slightly improved (+6.7%), but HA production increased from 2.3 g / L to 3.6 g / L (+56.5%), and molecular weight increased from 1.85 × 10⁻⁶. 6 Da increased to 2.10×10 6 Da. This indicates that enhanced precursor supply significantly improves the unit cell production capacity under high OD conditions.

[0038] Table 3. Effects of hasB overexpression on HA yield and molecular weight

[0039]

[0040] 4. Introduction of the Vibrio hygroscopicus hemoglobin gene (vgb) – overcoming dissolved oxygen limitations

[0041] The synthetic codon-optimized vgb gene, placed under the constitutive promoter PENO, was integrated into the genome to obtain SZ-VHb. Under hypoxic conditions (100 mL / 500 mL shake flask, 150 rpm), the OD was measured after 24 h. 600 The concentration of HA increased from 3.8 to 5.6 (+47.4%), and the HA yield increased from 1.5 g / L to 2.4 g / L (+60.0%). This indicates that Vibrio hygroscopicis hemoglobin (VHb protein) effectively improves respiratory efficiency under hypoxic conditions, significantly increases cell density, and thus promotes HA synthesis.

[0042] Table 4. Effects of hasB overexpression on HA yield and molecular weight

[0043]

[0044] 5. Overexpression of the cysteine ​​transporter gene (fliY1) – regulating molecular weight without sacrificing OD. 600

[0045] An integration expression cassette for the fliY1 gene was designed, and a CRISPR integration vector was constructed using the Pgap promoter. Electroporation screening yielded the fliY1 gene overexpressing strain SZ-OEfliY1. The shake-flask fermentation results are shown in Table 5: OD500 of strain SZ-OEfliY1... 600The concentration of HA increased from 4.5 to 5.0, an increase of 11.1%; HA production increased from 2.3 g / L to 3.0 g / L, an increase of 30.4%; while the molecular weight of HA increased from 1.85 × 10⁻⁶ g / L. 6 Da decreased to 0.95×10 6 Da, precisely falling into the core region of medium molecular weight HA. After adding 2 g / L cysteine ​​to the fermentation system, the OD of the SZ-OEfliY1 strain... 600 The concentration was further increased to 5.2, HA production increased to 3.5 g / L, and the molecular weight further decreased to 0.80×10. 6 Da.

[0046] The results showed that overexpression of the fliY1 gene can enhance the uptake of extracellular cysteine. By regulating the intracellular cysteine ​​concentration, the chain elongation activity of HA synthase is moderately reduced. At the same time, while increasing cell density and HA production, the molecular weight of HA is precisely regulated to the medium molecular weight range, which solves the defect of "decrease in yield accompanied by regulation of molecular weight" in the existing technology.

[0047] Table 5. Effects of fliY1 overexpression on HA molecular weight and yield.

[0048]

[0049] Example 3: Validation of the mechanism by which the fliY1 gene regulates the molecular weight of HA

[0050] To clarify the difference in the principle of molecular weight regulation between the overexpression of fliY1 in this invention and the knockout of fliY in the prior art, the fliY gene knockout strain SZ-ΔfliY and the fliY1 overexpression strain SZ-OEfliY1 were constructed respectively. The intracellular cysteine ​​concentration, glutathione redox ratio (GSH / GSSG), and HA synthase activity were measured. The results are shown in Table 6.

[0051] Table 6 Comparison of the control mechanisms of different modification methods for fliY1

[0052]

[0053] The results show that:

[0054] After knocking out the fliY gene, extracellular cysteine ​​uptake was completely blocked, intracellular cysteine ​​concentration dropped sharply, the GSH / GSSG ratio decreased significantly, intracellular redox homeostasis was disrupted, HA synthase activity was significantly reduced, ultimately leading to a decrease in HA molecular weight. At the same time, cell growth and HA synthesis were inhibited, resulting in a decrease in yield.

[0055] Overexpression of the fliY1 gene significantly enhanced extracellular cysteine ​​uptake, moderately increased intracellular cysteine ​​concentration, elevated GSH / GSSG ratio, enhanced bacterial antioxidant capacity, and more vigorous bacterial growth. Simultaneously, cysteine, as an allosteric inhibitor of HA synthase, moderately reduced the chain elongation rate of HA synthase, ultimately achieving a positive effect of precise downregulation of HA molecular weight and simultaneous increase in bacterial density and HA production. This is completely opposite to the regulatory mechanism of the knockout scheme and has achieved unexpected technical results.

[0056] Example 4: Optimization of promoter and copy number system for overexpression elements

[0057] This embodiment systematically carried out promoter screening and optimization and integration copy number optimization experiments for four overexpressed genes: hasA, hasB, vgb, and fliY1. It determined the optimal expression regulation scheme for the synthesis of medium and high molecular weight HA, which solved the industry pain point that the overexpression intensity, HA molecular weight, and bacterial growth could not be balanced in the existing technology.

[0058] 1. Cloning of candidate promoters and construction of expression vectors

[0059] In this embodiment, four commonly used endogenous constitutive promoters from *Streptococcus vesicae* were selected as candidates: the strong promoter PENO for glycolysis, the promoter Pgap for glyceraldehyde-3-phosphate dehydrogenase, the endogenous promoter Pldh for lactate dehydrogenase, and the promoter Psod for superoxide dismutase. Using the genome of *Streptococcus vesicae* strain SD-1 as a template, primers were designed to amplify the full-length sequences of the four promoters. The primer sequences are shown in Table 7 below.

[0060] Table 7 Primers and their sequences

[0061]

[0062] The gene sequence of the Pldh promoter is shown in SEQ ID NO.3:

[0063] CTTAAGGAATGCTCCTTTTCTAGTCAATACTCTTTTAATTATACCATAAAATCCTTATTTTTTCTGGTTGGAAACGCTATCCGAAAACAATTTTCATAATTTGGTCGAATATCATGACAAAGACATTACAATGTGTTAAAATAAGATCGTATGAGCAATTTGCTCTAACTAAAATGAAGGAGATGTTTAGAA.

[0064] The gene sequence of the Psod promoter is shown in SEQ ID NO.4:

[0065] AGGCATAATCAGCCAACGACCAACGTTACAGTGGATAAAACAAAGCTCAA.

[0066] PCR amplification system: 25 μL 2×PhantaMax Buffer, 1 μL dNTP Mix (10 mM), 2 μL each of forward and reverse primers (10 μM), 0.5 μL genomic template, 1 μL PhantaMax high-fidelity DNA polymerase, and sterile water to a final volume of 50 μL. PCR reaction conditions: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 56℃ annealing for 15 s, 72℃ extension for 30 s, 30 cycles; final extension at 72℃ for 5 min.

[0067] The amplified promoter fragments were digested with EcoRI / BamHI and ligated into the pSET4s integration vector to construct four promoter-driven egfp fluorescent reporter vectors for quantitative determination of the relative expression intensity of the promoters. At the same time, genome integration vectors driving the hasA, hasB, vgb, and fliY1 genes were constructed using the RecT-assisted CRISPR / SzCas9 system in Example 1 and integrated into the ldh site of the SD-1 strain genome to obtain single-gene overexpression strains driven by different promoters.

[0068] 2. Quantitative fluorescence verification of the relative expression intensity of the promoter

[0069] The four constructed fluorescent reporter vectors were electroporated into the SD-1 strain and cultured at 37°C until OD200. 600 =0.6-0.8, the fluorescence intensity of the bacteria was measured using an enzyme-linked immunosorbent assay (ELISA) reader (excitation wavelength 488nm, emission wavelength 509nm), and the bacterial OD value was used as the OD value. 600 After normalization, the relative expression intensity of each promoter was calculated, and the results are shown in Table 8 below.

[0070] Table 8. Relevant information about promoters

[0071]

[0072] The results showed that there were significant differences in the expression intensity of the four promoters. PENO was the constitutive promoter with the highest expression intensity, while Pgap was a medium-strong promoter, which can meet the differential expression needs of different genes.

[0073] 3. Effects of different promoters on target gene expression, HA production, and molecular weight

[0074] The single-gene overexpression strains of hasA, hasB, vgb, and fliY1 driven by different promoters were cultured under the shake-flask fermentation conditions in Example 2. The relative expression level of the target gene was determined by qPCR, and the HA yield and molecular weight at the fermentation endpoint were detected to screen the optimal promoters for different genes. The results are shown in Table 9.

[0075] Table 9. Effects of different promoters on target gene expression and HA synthesis.

[0076]

[0077] Results analysis and determination of the optimal solution:

[0078] For the three genes hasA, hasB, and vgb, the expression level of the target gene was the highest and the HA production was the greatest when driven by the PENO strong promoter, and the HA molecular weight did not decrease. On the contrary, the molecular weight of the hasB overexpressing strain increased to 2.10 × 10⁻⁶. 6 Da is perfectly suited to the synthesis requirements of high molecular weight HA. The core reason is that the high-intensity expression driven by the PENO promoter can fully make up for the precursor supply gap in HA synthesis under high cell density, while enhancing the chain elongation activity of HA synthase, thus achieving a simultaneous increase in yield and molecular weight.

[0079] For the fliY1 gene, using a strong promoter driven by Pgap can achieve moderate gene expression and precisely regulate the molecular weight of HA to 0.8-1.0 × 10⁻⁶. 6 The optimal driver promoter for the fliY1 gene is Pgap, which is located in the mid-molecular molecular weight range of Da and simultaneously increases HA production. However, when using the strong PENO promoter, the expression level of fliY1 is too high, causing the HA molecular weight to decrease beyond the target range, and increasing the metabolic burden on the cells, thus limiting the increase in production. Therefore, Pgap was determined to be the optimal driver promoter for the fliY1 gene.

[0080] This experiment eliminates the conventional technical bias in the field that "the stronger the promoter, the better." It screens out the optimal promoters that are differentiated according to the function and regulatory target of different genes, and achieves precise matching between gene expression and HA synthesis and molecular weight regulation, rather than the conventional selection of universal strong promoters.

[0081] 4. Optimization of gene integration copy number and verification of genetic stability

[0082] For the two core HA synthesis genes, hasA and hasB, based on the determination of the optimal promoter, the expression effects and industrial adaptability of three integration methods were further compared: single-copy genome integration, double-copy genome integration, and multi-copy cell-free plasmid expression. Using the CRISPR system described in Example 1, strains with the three integration methods were constructed. The single-copy integration site was the ldh gene site, the double-copy integration site was the ldh site + hyl site, and the multi-copy plasmid used was the pSET4s cell-free plasmid. Spectinomycin resistance screening was used for maintenance.

[0083] The three strains were fermented in a 5L fermenter to verify the HA yield and molecular weight of the initial batch. At the same time, the strains were continuously streaked on THB-free solid medium for 20 generations, and the HA yield and molecular weight were measured every 5 generations to verify the genetic stability of the strains. The results are shown in Table 10.

[0084] Table 10 Comparison of expression effects and genetic stability at different integration copy numbers

[0085]

[0086] Results analysis and determination of the optimal solution:

[0087] In the initial batches, the HA yield of double-copy integration and multi-copy plasmid expression was slightly higher than that of single-copy integration, but the HA molecular weight decreased significantly, with the molecular weight of multi-copy plasmid expression strains decreasing to 1.56 × 10⁻⁶. 6 The expression of D cannot meet the requirements for the synthesis of high molecular weight HA. The core reason is that the overexpression of hasA and hasB leads to an excessive shift of the bacterial metabolic flux towards HA synthesis. The supply of precursors such as UDP-glucose required for normal bacterial growth is insufficient, which affects bacterial proliferation. At the same time, the chain elongation process of HA synthase is interfered with by the fluctuation of intracellular precursor concentration, making it impossible to synthesize long-chain high molecular weight HA.

[0088] In terms of genetic stability, single-copy genome-integrated strains exhibit excellent propagation stability, with HA yield retention rate still ≥95% after 20 generations and molecular weight fluctuation <5%, fully meeting the requirements of industrial continuous fermentation and seed propagation. In contrast, double-copy genome-integrated strains experience gene loss due to homologous recombination during propagation, while multi-copy plasmid strains experience significant plasmid loss during antibiotic-free fermentation, resulting in severe phenotypic degradation and making them unsuitable for the production requirements of industrial antibiotic-free fermentation.

[0089] The optimal integration scheme for integrating a single-copy genome into the hasA and hasB genes was finally determined. This scheme ensures high HA production while fully meeting the stable synthesis requirements of medium and high molecular weight HA, and possesses the genetic stability necessary for industrial production. It solves the core defects of existing technologies with multiple-copy expression, which are characterized by "slightly increased yield, sharp drop in molecular weight, and genetic instability".

[0090] 5. Validation of the optimized scheme in combined strains

[0091] The optimal promoter and copy number scheme described above was applied to the construction of the core combinatorial strain SZ-Combo5, and parallel validation was performed in a 5L fermenter. The results showed that the SZ-Combo5 strain constructed using the optimized scheme had a lower OD5 ratio than the unoptimized combinatorial strain. 600 The concentration of HA increased from 26.1 to 28.5, the HA yield increased from 14.3 g / L to 16.2 g / L, and the HA molecular weight increased from 1.86 × 10⁻⁶. 6 Da steadily increased to 2.05×10 6 Da further verified the positive effect of promoter and copy number optimization scheme on high yield of medium and high molecular weight HA.

[0092] Example 5: Construction and Validation of Multi-Gene Synergistic Modified Strains in a 5L Fermenter

[0093] Based on the validation of the effects of single-gene modification and expression element optimization, multi-gene combination modified strains were constructed according to the synergistic strategy of "metabolic diversion + product degradation blocking + synthesis enhancement + precursor enhancement + oxygen utilization optimization":

[0094] SZ-Combo2: Δldh+OEhasB (knockout of lactate pathway + enhanced precursor UDP-GlcA supply)

[0095] SZ-Combo4: Δldh+OEhasA+VHb (knockout of lactate pathway + enhanced synthase + improved oxygen utilization)

[0096] SZ-Combo5: Δldh+Δhyl+OEhasA+OEhasB+VHb (five-gene synergistic modification)

[0097] SZ-Combo6: Δldh+Δhyl+OEhasA+OEhasB+VHb+OEfliY1 (Based on Combo5, a molecular weight regulator is added to produce medium molecular weight HA strain)

[0098] The above-mentioned strains and wild-type strains were subjected to fed-batch high-density fermentation verification in a 5L fermenter. Fermentation conditions were as follows: inoculum size 5%, fermentation temperature 37℃, pH constant 7.0, dissolved oxygen and agitation speed cascade control to maintain DO ≥ 20%, glucose was added during fermentation to maintain residual sugar concentration of 5-10 g / L, and the fermentation cycle was 36 h. The results are shown in Table 11.

[0099] Table 11 Comparison of fermentation performance of multi-gene synergistic modified strains in 5L tanks

[0100]

[0101] The results show that:

[0102] Single-gene ldh knockout can only reduce OD 600 The OD was increased to 18.2, and the HA yield was increased to 8.9 g / L; while the SZ-Combo5 strain, which was synergistically modified with five genes in this invention, had an OD... 600 The concentration was increased to 28.5, a 128% increase compared to the wild type; HA production reached 16.2 g / L, a 161.3% increase compared to the wild type; OD... 600 The increase in both HA production far exceeded the maximum theoretical value of linear superposition of single-gene modification, proving that multi-target modification achieved a synergistic effect of 1+1>2, and globally optimized the metabolic flux of cell growth and HA synthesis.

[0103] The SZ-Combo5 strain can stably synthesize molecules with a molecular weight of 2.05 × 10⁻⁶. 6 Da's high molecular weight HA, while the accumulation of lactic acid byproducts is only 3.5 g / L, which is 86.2% lower than that of wild type, and the sugar-acid conversion rate is greatly improved, which is suitable for the industrial production needs of HA.

[0104] By introducing fliY1 overexpression, the SZ-Combo6 strain maintained high cell density and high HA production while precisely controlling the HA molecular weight to 0.95 × 10⁻⁶. 6 With Da in the middle molecular weight range, HA production was further increased to 17.0 g / L, achieving a balance between production and molecular weight control.

[0105] Example 6: Optimization of Culture Medium and Fermentation Process

[0106] Using strain SZ-Combo5 as the research object, the fermentation medium was optimized by response surface methodology to obtain the optimal medium formulation: glucose 65 g / L, yeast extract 25 g / L, sodium glutamate 8 g / L, K2HPO4 2 g / L, MgSO4·7H2O 0.5 g / L, and MnSO4 0.1 g / L.

[0107] The optimized culture medium, combined with an optimized fed-batch fermentation strategy (maintaining residual sugar of 5-10 g / L, pH 6.8-7.2, and DO ≥ 20%), was validated in a 5 L fermenter. The results are shown in Table 12. The maximum OD of the optimized strain... 600 The concentration of HA increased from 28.5 g / L to 32.0 g / L, an increase of 12.3%; HA production increased from 16.2 g / L to 18.5 g / L, an increase of 14.2%; the sugar-acid conversion rate increased from 16.5% to 17.8%; and the HA molecular weight remained stable at 2.10 × 10⁻⁶. 6 This further improved the economic efficiency of industrialized production.

[0108] Table 12 Comparison before and after process optimization

[0109]

[0110] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. A Streptococcus vesiculosus strain that produces high-molecular-weight hyaluronic acid, characterized in that, The Streptococcus vesiculosus strain has lactate dehydrogenase and hyaluronidase knocked out, and hyaluronic acid synthase, UDP-glucose dehydrogenase and hemoglobin overexpressed, wherein the hyaluronic acid synthase, UDP-glucose dehydrogenase and hemoglobin are expressed using the PENO promoter.

2. The Streptococcus vesiculosus according to claim 1, characterized in that, The Streptococcus vesiculosus also overexpresses a cysteine ​​transporter, wherein the Gene ID of the cysteine ​​transporter is 878270.

3. The Streptococcus vesiculosus according to claim 2, characterized in that, The cysteine ​​transporter was expressed using the Pgap promoter.

4. The Streptococcus vesiculosus according to claim 1, characterized in that, The NCBI number for the lactate dehydrogenase is WP_012515644.1, the NCBI number for the hyaluronidase is WP_012515900.1, the NCBI number for the hyaluronic acid synthase is WP_012514859.1, the NCBI number for the UDP-glucose dehydrogenase is WP_012514860.1, and the NCBI number for the hemoglobin is WP_019959060.

1.

5. The Streptococcus vesiculosus according to claim 1, characterized in that, The gene sequence of the PENO promoter is shown in SEQ ID NO.

1.

6. The Streptococcus veterinaria according to claim 3, characterized in that, The gene sequence of the Pgap promoter is shown in SEQ ID NO.

2.

7. An enzyme preparation containing the Streptococcus vesiculosus according to any one of claims 1-6.

8. The use of the Streptococcus vesiculosus according to any one of claims 1-6 or the enzyme preparation according to claim 7 in the production of hyaluronic acid.

9. A method for regulating the molecular weight of hyaluronic acid, characterized in that, The method involves constructing Streptococcus veterinaria and inoculating it into a fermentation medium for culture. Among them, when the molecular weight is 0.7×10 6 Da-1.2×10 6 When Da produces hyaluronic acid, the Streptococcus vesiculosus knocks out lactate dehydrogenase and hyaluronidase, and overexpresses hyaluronic acid synthase, UDP-glucose dehydrogenase, cysteine ​​transporter and hemoglobin, wherein the hyaluronic acid synthase, UDP-glucose dehydrogenase and hemoglobin are expressed using the PENO promoter, and the cysteine ​​transporter is expressed using the Pgap promoter. When producing a molecular weight of 1.8 × 10 6 Da-2.4×10 6 When Da produces hyaluronic acid, the Streptococcus vesiculosus knocks out lactate dehydrogenase and hyaluronidase, and overexpresses hyaluronic acid synthase, UDP-glucose dehydrogenase and hemoglobin, wherein the expression of hyaluronic acid synthase, UDP-glucose dehydrogenase and hemoglobin is initiated by the PENO promoter.

10. The method according to claim 9, characterized in that, The fermentation medium includes glucose, yeast extract, monosodium glutamate, and K₂HPO₄. 4、 MgSO4·7H2O and MnSO4.

Images