A system for cell receptor signal activation and applications thereof

Abstract

The application discloses a system for cell receptor signal activation and application thereof, and relates to the technical field of biology.The system comprises a probe M1, a probe M1-C, a probe M2, a probe M2-C and a probe MS; the probe M1 comprises a nucleic acid aptamer which is specific to a first receptor, and the probe M2 comprises a nucleic acid aptamer which is specific to a second receptor; the first receptor and the second receptor are dimerized to activate a downstream signal path.The probe M1 and the probe M1-C are complementary to each other to obtain a sensor, the probe M2 and the probe M2-C are complementary to each other to obtain an activator, and the sensor and the activator are matched with a catalytic type cyclic trigger chain probe MS, so that signal exponential amplification of entropy-driven DNA cyclic chain replacement can be realized.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a system for activating cell receptor signals and its applications. Background Technology

[0002] Cell surface receptor tyrosine kinases (such as Met) play a crucial role in cell proliferation, migration, and differentiation. Chimeric receptor technologies based on nucleic acid aptamers have been developed to regulate cell behavior in response to specific ligands. However, in clinical applications and basic research, situations often arise where the concentration of the target receptor is extremely low. Therefore, traditional nucleic acid aptamer regulatory systems require high concentrations of ligands to activate the receptor, resulting in insufficient response sensitivity.

[0003] Therefore, there is an urgent need to provide an ultrasensitive cell regulation scheme that can respond to extremely small trigger signals and achieve exponential signal amplification. Summary of the Invention

[0004] The present invention aims to at least solve one of the technical problems existing in the prior art. To this end, the present invention proposes a system that responds to extremely small trigger signals and achieves exponential signal amplification.

[0005] The present invention also provides a method for constructing the above system.

[0006] The present invention also provides a method for regulating the activation of cell receptor signals for non-disease diagnosis and treatment purposes.

[0007] The present invention also provides applications of the above system.

[0008] A system according to a first aspect of the present invention includes: Probe M1, from 5' to 3', includes sequences A, B, C, D, and E in sequence. Sequence B includes a nucleic acid aptamer that specifically targets the first receptor. Sequence A and sequence C hybridize and pair complementaryly to form an inverted stem-loop structure. Probe M1-C, wherein the E sequence of probe M1-C is inversely complementary to that of probe M1; Probe M2, from 5' to 3', includes F sequence, G sequence, H sequence, I sequence and J sequence in sequence. The I sequence includes a nucleic acid aptamer that specifically targets the second receptor. The H sequence and the J sequence hybridize and pair complementaryly to form an inverted stem-loop structure. The nucleic acid sequence composed of the D and E sequences of probe M1 is complementary to the nucleic acid sequence composed of the F and G sequences of probe M2. Probe M2-C, wherein the G sequence of probe M2-C is inversely complementary to that of probe M2; The probe MS is complementary to a portion of the D and E sequences of the probe M1; The dimerization of the first receptor and the second receptor activates downstream signaling pathways.

[0009] The system according to embodiments of the present invention has at least the following beneficial effects: The sensor is obtained by complementary pairing of probe M1 and probe M1-C, and the activator is obtained by complementary pairing of probe M2 and probe M2-C. Both the sensor and the activator adopt a modular structure with an aptamer recognition domain, a complementary hybridization domain, and a closed strand. Combined with a catalytic cycle trigger strand (probe MS, which cannot form a stable secondary structure and whose displacement reaction kinetics are much faster than nonspecific dissociation), the signal of entropy-driven DNA cycle strand displacement is exponentially amplified.

[0010] The system described in this embodiment is based on a catalytic chain cyclic amplification mechanism, achieving nanomolar (nM) level detection and response thresholds for the trigger chain. It exhibits ultra-high sensitivity, with a 1 nM trigger chain rapidly assembling in situ on the cell membrane surface. Its precise spatial localization and clear signal cascade pathways significantly activate the dimerization of the first and second receptors, and activate downstream signaling pathways. Furthermore, the system demonstrates high biosafety, avoiding the drawbacks of nonspecific responses and preventing receptor overphosphorylation and the resulting cytotoxicity or abnormal differentiation at the source. Constructed from whole DNA components, it carries no risk of gene integration. By changing the aptamer or trigger chain sequence, it can rapidly adapt to different target receptors and stimulation signals, exhibiting strong universality. The system described in this embodiment is suitable for real-time live-cell imaging and dynamic regulation, and can be directly used for cell therapy responding to low-abundance biomarkers, intelligent modification of molecular responses, and precise microenvironment regulation in regenerative medicine, showing broad application prospects.

[0011] According to some embodiments of the present invention, the length of the region where probe M1-C is complementary to probe M1 is less than the length of the region where probe MS is complementary to probe M1. The difference between the length of the region where probe M1-C is complementary to probe M1 and the length of the region where probe MS is complementary to probe M1 is not less than 3 nt (e.g., it can be 3nt, 4nt, 5nt, 6nt, 7nt, 8nt, 9nt, or 10nt). The length of the region where probe M1-C is complementary to probe M1 is 12-14 nt. The length of the region where probe MS is complementary to probe M1 is 15-17 nt.

[0012] According to some embodiments of the present invention, the length of the region of the E sequence that is not complementary to the probe MS is <7 nt. Preferably, it is 4 nt-7 nt. For example, it can be 4 nt, 5 nt, 6 nt or 7 nt. The region of the E sequence that is not complementary to the probe MS is located at the 3' end of the E sequence. Thus, this region has a low melting temperature (Tm) at physiological temperature (37°C) (Tm<37°C), which prevents the formation of a stable double strand, ensuring that the probe M1-C can spontaneously and rapidly detach, avoiding kinetic traps, and exposing the sticky ends, which is beneficial for subsequent dimer assembly.

[0013] According to some embodiments of the present invention, the sum of the lengths of probe M1-C and probe M2-C is not less than the total length of the D and E sequences. The difference between the sum of the lengths of probe M1-C and probe M2-C and the total length of the D and E sequences is 0 nt to 6 nt. For example, it can be 0 nt, 1 nt, 2 nt, 3 nt, 4 nt, 5 nt, or 6 nt. This avoids non-specific self-assembly of the binding strands of probe M1, probe M2, and probe M2-C, facilitating efficient and specific hybridization of probe M1 and probe M2 to form homodimers.

[0014] According to some embodiments of the present invention, the total length of the D sequence and the E sequence is 25 nt-27 nt.

[0015] According to some embodiments of the present invention, the length of the A sequence is 7 nt-9 nt.

[0016] According to some embodiments of the present invention, the length of the B sequence is 33 nt-35 nt.

[0017] According to some embodiments of the present invention, the length of the C sequence is 7 nt-9 nt.

[0018] According to some embodiments of the present invention, the length of the D sequence is 12 nt-14 nt.

[0019] According to some embodiments of the present invention, the length of the E sequence is 12 nt-14 nt.

[0020] According to some embodiments of the present invention, the nucleic acid sequence of sequence A is shown in positions 1 to 8 of SEQ ID NO: 1. The nucleic acid sequence of sequence B is shown in positions 9 to 42 of SEQ ID NO: 1. The nucleic acid sequence of sequence C is shown in positions 43 to 50 of SEQ ID NO: 1. The nucleic acid sequence of sequence D is shown in positions 51 to 63 of SEQ ID NO: 1. The nucleic acid sequence of sequence E is shown in positions 43 to 76 of SEQ ID NO: 1.

[0021] According to some embodiments of the present invention, the length of the probe M1-C is 12 nt-14 nt.

[0022] According to some embodiments of the present invention, the nucleic acid sequence of the probe M1-C is shown in SEQ ID NO: 2.

[0023] According to some embodiments of the present invention, the length of the F sequence is 12 nt-14 nt.

[0024] According to some embodiments of the present invention, the length of the G sequence is 12 nt-14 nt.

[0025] According to some embodiments of the present invention, the length of the H sequence is 7 nt-9 nt.

[0026] According to some embodiments of the present invention, the length of the I sequence is 33 nt-35 nt.

[0027] According to some embodiments of the present invention, the length of the J sequence is 7 nt-9 nt.

[0028] According to some embodiments of the present invention, the nucleic acid sequence of the F sequence is shown in positions 1 to 13 of SEQ ID NO: 3. The nucleic acid sequence of the G sequence is shown in positions 14 to 26 of SEQ ID NO: 3. The nucleic acid sequence of the H sequence is shown in positions 27 to 34 of SEQ ID NO: 1. The nucleic acid sequence of the I sequence is shown in positions 35 to 68 of SEQ ID NO: 3. The nucleic acid sequence of the J sequence is shown in positions 69 to 76 of SEQ ID NO: 3.

[0029] According to some embodiments of the present invention, the length of the probe M2-C is 12 nt-14 nt.

[0030] According to some embodiments of the present invention, the nucleic acid sequence of the probe M2-C is shown in SEQ ID NO: 4.

[0031] According to some embodiments of the present invention, the length of the probe MS is 15 nt-17 nt.

[0032] According to some embodiments of the present invention, the nucleic acid sequence of the probe MS is shown in SEQ ID NO: 5.

[0033] According to some embodiments of the present invention, the first receptor and / or the second receptor include, but are not limited to, Met, HER, or EGFR. The first receptor and the second receptor can be the same receptor or different receptors, as long as they can activate downstream pathways after dimerization.

[0034] The method for constructing the system according to the first aspect embodiment of the second aspect of the present invention includes the following steps: mixing the probe M1 and the probe M1-C in an equimolar ratio and then annealing and hybridizing to obtain hybrid chain M1S; mixing the probe M2 and the probe M2-C in an equimolar ratio and then annealing and hybridizing to obtain hybrid chain M1A.

[0035] According to some embodiments of the present invention, the conditions for the annealing hybridization include: Treatment at 93℃-97℃ for 3-7 min, at 63℃-67℃ for 25-35 min, at 48℃-52℃ for 25-35 min, at 35℃-39℃ for 25-35 min, at 20℃-24℃ for 25-35 min, and at 2℃-6℃ for 25-35 min.

[0036] According to some embodiments of the present invention, the construction method further includes: mixing and incubating the hybridization strand M1S, hybridization strand M1A, and probe MS to obtain hybridization strand MD. The molar ratio of hybridization strand M1S to hybridization strand M1A is 1:(0.9-1.1). For example, it can be 1:0.90, 1:0.91, 1:0.92, 1:0.93, 1:0.94, 1:0.95, 1:0.96, 1:0.97, 1:0.98, 1:0.99, 1:1.00, 1:1.01, 1:1.02, 1:1.03, 1:1.04, 1:1.05, 1:1.06, 1:1.07, 1:1.08, 1:1.09, or 1:1.10.

[0037] According to some embodiments of the present invention, the incubation environment contains Mg 2+ The Mg 2+ The concentration is 4 mM-6 mM. For example, it can be 4 mM, 4.1 mM, 4.2 mM, 4.3 mM, 4.4 mM, 4.5 mM, 4.6 mM, 4.7 mM, 4.8 mM, 4.9 mM, 5.0 mM, 5.1 mM, 5.2 mM, 5.3 mM, 5.4 mM, 5.5 mM, 5.6 mM, 5.7 mM, 5.8 mM, 5.9 mM, or 6.0 mM. This stabilizes the DNA double-stranded structure.

[0038] According to some embodiments of the present invention, the incubation temperature is 36°C-38°C. For example, it can be 36.0°C, 36.5°C, 37°C, 37.5°C, or 38.0°C.

[0039] According to some embodiments of the present invention, the incubation time is 10 min to 30 min. For example, it can be 10 min, 11 min, 12 min, 13 min, 14 min, 15 min, 16 min, 17 min, 18 min, 19 min, 20 min, 21 min, 22 min, 23 min, 24 min, 25 min, 26 min, 27 min, 28 min, 29 min, or 30 min.

[0040] According to some embodiments of the present invention, the pH of the incubation is 7.2-7.4.

[0041] A method for regulating cell receptor signal activation for non-disease diagnosis and treatment purposes according to a third aspect of the present invention includes the steps of system regulation described in the first aspect embodiment.

[0042] According to some embodiments of the present invention, the method includes: contacting the target cell with the hybridization chain M1S and hybridization chain M1A, and then continuing to contact the probe MS; the target cell surface has the first receptor and the second receptor distributed thereon.

[0043] According to some embodiments of the present invention, the method includes: contacting the target cell with the hybridization chain MD.

[0044] According to some embodiments of the present invention, the temperature conditions for the target cells to contact the hybridization chains M1S and M1A are 36-38°C. For example, they can be 36.0°C, 36.5°C, 37°C, 37.5°C, or 38.0°C.

[0045] According to some embodiments of the present invention, the contact time between the target cells and the hybridization chains M1S and M1A is 25 min-35 min. For example, it can be 25 min, 26 min, 27 min, 28 min, 29 min, 30 min, 31 min, 32 min, 33 min, 34 min, or 35 min.

[0046] According to some embodiments of the present invention, the pH of the target cell contacting the hybrid chain M1S and hybrid chain M1A is 7.2-7.4.

[0047] According to some embodiments of the present invention, the temperature condition for the target cells to contact the probe MS is 36°C-38°C. For example, it can be 36.0°C, 36.5°C, 37°C, 37.5°C, or 38.0°C.

[0048] According to some embodiments of the present invention, the contact time between the target cells and the probe MS is 25 min-35 min. For example, it can be 25 min, 26 min, 27 min, 28 min, 29 min, 30 min, 31 min, 32 min, 33 min, 34 min or 35 min.

[0049] According to some embodiments of the present invention, the target cells are in contact with the probe MS at a pH of 7.2-7.4.

[0050] According to some embodiments of the present invention, the temperature conditions for contacting the target cells with the hybridization chain MD are 36°C-38°C. For example, they can be 36.0°C, 36.5°C, 37°C, 37.5°C, or 38.0°C.

[0051] According to some embodiments of the present invention, the contact time between the target cells and the hybridization chain MD is 5 min-15 min. For example, it can be 5 min, 6 min, 7 min, 8 min, 9 min, 0 min, 11 min, 12 min, 13 min, 14 min or 15 min.

[0052] According to some embodiments of the present invention, the pH of the target cell contacting the hybrid chain MD is 7.2-7.4.

[0053] According to some embodiments of the present invention, the culture environment of the target cells contains Mg 2+ The Mg 2+ The concentration is 4 mM-6 mM. For example: it can be 4 mM, 4.1 mM, 4.2 mM, 4.3 mM, 4.4 mM, 4.5 mM, 4.6 mM, 4.7 mM, 4.8 mM, 4.9 mM, 5.0 mM, 5.1 mM, 5.2 mM, 5.3 mM, 5.4 mM, 5.5 mM, 5.6 mM, 5.7 mM, 5.8 mM, 5.9 mM or 6.0 mM.

[0054] The use of the system described in the first aspect of the fourth aspect of the present invention in the preparation of products that promote cell proliferation and / or cell migration.

[0055] According to some embodiments of the present invention, the product is selected from reagents and kits.

[0056] According to some embodiments of the present invention, the first receptor and the second receptor are Met.

[0057] Other features and advantages of the invention will be set forth in the description which follows, and will be apparent in part from the description, or may be learned by practicing the invention. Attached Figure Description

[0058] Figure 1 This is a schematic diagram of the sequence structure of the agonist MD, the sensor M1S, and the activator M1A.

[0059] Figure 2 This is a schematic diagram of an ultrasensitive chain cycle reaction process.

[0060] Figure 3 This is a native-pAGE characterization of the ultrasensitive chain cycle reaction. Lane 1: M1 (1 μM); Lane 2: M2 (1 μM); Lane 3: M1S (1 μM); Lane 4: M1A (1 μM); Lane 5: MD (1 μM); Lane 6: M1S+M1A+MS (10 nM); Lane 7: M1S+M1A+MS (100 nM) and Lane 8: M1S+M1A+MS (1 μM).

[0061] Figure 4 These are the fluorescence spectroscopy results of the ultrasensitive chain cycle reaction. a: Schematic diagram of the reaction process, b: Fluorescence spectrum.

[0062] Figure 5 This is a schematic diagram of MD activation of Met initiation of downstream signal transduction and cell migration and proliferation formed by the ultrasensitive chain cyclic substitution reaction.

[0063] Figure 6 This is a cell experiment showing the formation of MD-activated Met through an ultrasensitive chain cyclic substitution reaction. a: Schematic diagram of the action; b: Western blot image; c: Relative expression level of p-Met (n=3). *** indicates a statistically significant difference (p<0.001).

[0064] Figure 7 This study investigates the effects of different concentrations of MS participating in the ultrasensitive chain cyclic substitution reaction to form MD on p-Akt and pErk in A549 cells. a: Immunoblot map; b: relative expression level of p-Akt (n=3); c: relative expression level of p-Erk (n=3). *** indicates statistically significant differences (p<0.001).

[0065] Figure 8 The effect of different concentrations of MS participating in the ultrasensitive chain cyclic substitution reaction to form MD on the migration of A549 cells (yellow line indicates the boundary of the scratch area, scale bar = 200 μm).

[0066] Figure 9The relative cell migration rate (n=21) of A549 cells incubated for 24 h by MD generated from different concentrations of MS participating in the ultrasensitive chain cyclic substitution reaction. *** indicates a statistically significant difference (p<0.001).

[0067] Figure 10 The cell proliferation of A549 cells (n=5) after 24 h of incubation with MD generated from different concentrations of MS participating in the ultrasensitive chain cyclic substitution reaction. * indicates a significant difference (p<0.05), ** indicates a significant difference (p<0.01), and *** indicates a significant difference (p<0.001).

[0068] Figure 11 This is a schematic diagram of the activation of the ultrasensitive chimeric receptor induced by circulating chain MS.

[0069] Figure 12 This illustrates the effect of circulating chain MS on the behavior of M1S-T and M1A-B after binding to cell surface receptors. a: Schematic diagram of the ultrasensitive chimeric receptor response; b: CLSM image (scale bar = 20 μm).

[0070] Figure 13 These are flow cytometry results of cells incubated with ultrasensitive chimeric receptor A549 by MS at different concentrations.

[0071] Figure 14 This diagram illustrates the activation of the Met receptor by MS-induced ultrasensitive chimeric receptor dimer MD. a: Schematic diagram of MS inducing ultrasensitive chimeric receptor dimer MD activation of the Met receptor on the cell membrane; b: Western blot image; c: Relative expression level of p-Met (n=3). *** indicates a statistically significant difference (p<0.001).

[0072] Figure 15 This is a schematic diagram illustrating how MS induces the formation of a dimer from a highly sensitive chimeric receptor, and how MD activates Met to initiate downstream signal transduction, thereby increasing cell migration and proliferation.

[0073] Figure 16 This diagram illustrates the activation of Akt and Erk by MS-induced ultrasensitive chimeric receptor dimerization (MD) on the cell membrane. a: Schematic diagram of MS-induced ultrasensitive chimeric receptor dimerization (MD) activation of Akt and Erk on the cell membrane; b: Western blot image; c: Relative expression level of p-Akt (n=3); d: Relative expression level of p-Erk (n=3). *** indicates statistically significant differences (p<0.001).

[0074] Figure 17 The effect of different concentrations of MS on the migration of A549 cells with ultrasensitive chimeric receptors (yellow lines indicate the boundaries of the scratched areas, scale bar = 200 μm).

[0075] Figure 18 The effect of different concentrations of MS on the relative cell migration rate of A549 cells with ultrasensitive chimeric receptors (n=21). ** indicates a significant difference (p<0.01), and *** indicates a significant difference (p<0.001).

[0076] Figure 19 The study investigated the effect of different concentrations of MS on the proliferation of A549 cells with ultrasensitive chimeric receptors (n=6). * indicates a significant difference (p<0.05), and ** indicates a significant difference (p<0.01).

[0077] Figure 20 This study investigates the effect of different concentrations of MS on the expression level of p-Met in DU145 cells incubated with ultrasensitive chimeric receptors. a: Western blot image; b: relative expression level of p-Met (n=3). *** indicates statistically significant differences (p<0.001). Detailed Implementation

[0078] The following will describe the concept and technical effects of the present invention clearly and completely with reference to embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.

[0079] Unless otherwise specified in the examples, the procedures should be performed under standard conditions or conditions recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0080] When a numerical range is disclosed herein, the range is considered continuous and includes the minimum and maximum values ​​of the range, as well as every value between the minimum and maximum values. Furthermore, when the range refers to integers, it includes every integer between the minimum and maximum values ​​of the range. Additionally, when multiple ranges are provided to describe a feature or characteristic, the ranges may be combined. In other words, unless otherwise specified, all ranges disclosed herein should be understood to include any and all subranges to which they are incorporated.

[0081] "And / or" is used to indicate that one or both of the described situations may occur, for example, A and / or B includes (A and B) and (A or B).

[0082] In the description of this invention, the term "aptamer" refers to a single-stranded DNA or RNA sequence that can specifically recognize and bind to proteins or other small molecules.

[0083] In the description of this invention, the term "entropy-driven DNA strand displacement" refers to a reaction driven by the free energy released from DNA hybridization, used to construct DNA nanomachines without the need for enzymes.

[0084] In the description of this invention, the term "chimeric receptor" refers to a complex receptor structure formed by the binding of a natural receptor on the cell membrane to an exogenous DNA aptamer.

[0085] In the description of this invention, the term "MD" refers to a dimer agonist assembled from a sensor chain (M1S) and an activator chain (M1A).

[0086] In the description of this invention, the term "not less than" means greater than or equal to, and should be understood to include the number itself.

[0087] Unless otherwise specified, the nucleic acid sequences in this invention are in the order from the 5' end to the 3' end.

[0088] The experimental materials, reagents, and instruments used in the embodiments of this invention are described below: (1) Human non-small cell lung cancer cells were A549 cells; human prostate cancer cells were DU145 cells. All cells were cultured in a constant temperature incubator at 37°C and 5% CO2.

[0089] (2) All DNA was synthesized by Shanghai Sangon Biotech Co., Ltd., and prepared to a suitable concentration using ultrapure water and stored in a refrigerator at 4°C for later use.

[0090] (3) Phospho-Met (Y1234 / 1235) antibody, phospho-FGFR1 (Tyr653 / 654) antibody, phospho-EGFR (Tyr1068) antibody, phospho-Akt (Ser473) antibody, and phospho-Erk (Thr202 / Tyr204) antibody were all purchased from Cell Signaling Technology, USA; GAPDH antibody, Tubulin antibody, Goat Anti-Rabbit IgG antibody, and Goat Anti-Mouse IgG antibody were all purchased from Affinity, USA; RPMI 1640 medium, DMEM medium, penicillin-streptomycin solution, and 0.25% Trypsin-EDTA (1×) were all purchased from Thermo Fisher Scientific; premium fetal bovine serum and phosphate buffered saline solution were all purchased from Wuhan Pronosei Life Science Technology Co., Ltd.; enzyme-free digestion solution was purchased from Shanghai Yuanye Biotechnology Co., Ltd.; RIPA lysis buffer, Lipo8000™ transfection reagent, and CCK-8 were also used. All reagents were purchased from Shanghai Beyotime Biotechnology Co., Ltd.; phosphatase inhibitors and protease inhibitors were purchased from Beijing Solarbio Science & Technology Co., Ltd.; protein loading buffer was purchased from Kangwei Century Biotechnology Co., Ltd.; protein marker was purchased from Shanghai Sangon Biotech Co., Ltd.; ECL luminescence solution was purchased from Hangzhou Fode Biotechnology Co., Ltd.; and pEGFP-Actin plasmid was purchased from Wuhan Miaoling Biotechnology Co., Ltd.

[0091] (4) The incubator was purchased from Thermo Fisher Scientific Ltd.; the constant temperature water bath was purchased from Jiangsu Jinyi Instrument Technology Co., Ltd.; the inverted fluorescence microscope was purchased from Nikon Corporation, Japan; the two-photon laser confocal microscope was purchased from Carl Zeiss Optics Ltd.; the flow cytometer and the multi-functional microplate reader were both purchased from Bertek Instruments Ltd., USA; the electrophoresis apparatus was purchased from Bio-Rad Biomedical Products Ltd.; the multi-functional chemical imaging system was purchased from UVP Corporation, USA; the low temperature ultracentrifuge was purchased from Eppendorf GmbH, Germany; the PCR instrument was purchased from Hangzhou Jinglge Scientific Instruments Co., Ltd.; the biosafety cabinet was purchased from Singapore Yisi Gao Technology Co., Ltd.; the gel imaging system was purchased from Shanghai Tianneng Technology Co., Ltd.; the constant temperature mixer was purchased from Hangzhou Aosheng Instruments Co., Ltd.; and the microbial incubator was purchased from Shanghai Yiheng Scientific Instruments Co., Ltd.

[0092] Unless otherwise specified, the starvation medium is RPMI 1640 medium containing 0.2% fetal bovine serum and 1% penicillin-streptomycin. The buffer is PBS (pH 7.2-7.4) containing 5 mM MgCl2.

[0093] Unless otherwise specified, the method for protein immunoblotting in this invention is as follows: The prepared sample was run on an 8% SDS-PAGE gel and then electrophoretically transferred to a 0.45 µm PVDF membrane (300 mA, 120 min). The membrane was blocked with 5% BSA solution for 120 min, and then reacted with primary antibody (1:1000 dilution) overnight at 4 °C. After washing three times with TBST, the membrane was reacted with secondary antibody (1:5000 dilution) at room temperature for 1 h, washed three times with TBST, and finally chemiluminescence images were obtained using a multifunctional molecular imaging system.

[0094] Example 1 This example provides a system for activating cell receptor signals, consisting of the following probes: M1: ATCAGACT GGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCA AGTCTGAT CCCTCATTCAATA CC CTACGTCTCCA (SEQ ID NO: 1); In probe M1, only the underlined portion is sequence A, the unlabeled portion is sequence B (a nucleic acid aptamer specifically targeting the Met receptor), only the italicized portion is sequence C, the bold underlined portion is sequence D, and the italicized underlined portion is sequence E; sequence A and sequence C hybridize and pair complementarily to form an inverted stem-loop structure; M1-C: TGGAGACGTAGGG (SEQ ID NO: 2); the E sequence of probe M1-C is inversely complementary to that of probe M1; M2: TGGAGACGTAGGG TATTGAATGAGGG CGTGTCAC GGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCA GTGACACG (SEQ ID NO: 3); In probe M2, only the underlined portion is the F sequence, only the italicized portion is the G sequence, the bold underlined portion is the H sequence, the unlabeled portion is the I sequence (a nucleic acid aptamer specifically targeting the Met receptor), and the italicized underlined portion is the J sequence. The H and J sequences hybridize and pair complementaryly to form an inverted stem-loop structure. The nucleic acid sequence composed of the D and E sequences of probe M1 is complementary to the nucleic acid sequence composed of the F and G sequences of probe M2. M2-C: CCCTCATTCAATA (SEQ ID NO: 4); the G sequence of probe M2-C is inversely complementary to that of probe M2; MS: CGTAGGGTATTGAATG (SEQ ID NO: 5); The nucleic acid sequence (CATTCAATACCCTACG) at the 3' end of the D sequence and the 5' end of the E sequence of probe M1 is complementary.

[0095] Probe M1 and probe M1-C were mixed in an equimolar ratio in a PCR tube to prepare a reaction system with a final concentration of 1 μM in buffer. The mixture was then annealed and hybridized using a PCR instrument to obtain sensor M1S with a final concentration of 1 μM. This was stored at 4℃ in the dark for later use. The PCR program was as follows: 95℃ for 5 min, 65℃ for 30 min, 50℃ for 30 min, 37℃ for 30 min, 22℃ for 30 min, and 4℃ for 30 min.

[0096] The probes M2 and M2-C were treated in the same way to obtain activator M1A with a final concentration of 1 μM, which was then stored at 4℃ in the dark for later use.

[0097] A schematic diagram of the sequence structure of agonist MD, sensor M1S, and activator M1A is shown below. Figure 1 As shown. The working principle of this system is as follows. Figure 2 As shown. Specifically: Probes M1 and M1-C are annealed to form a closed-state sensor M1S, and probes M2 and M2-C are annealed to form a closed-state activator M1A. After co-incubating the sensor M1S and activator M1A with target cells, the loops in the stem-loop regions of the sensor M1S and activator M1A specifically recognize target receptors on the cell membrane surface, forming a spatially adjacent chimeric receptor array on the cell membrane. Upon addition of the cycling trigger chain probe MS, probe MS preferentially binds to M1S, replacing probe M1-C through an entropy-driven chain displacement reaction to obtain the hybrid chain M1-MS, exposing the 3' sticky end of sequence E (the first complementary hybridization region). Subsequently, M1-MS hybridizes with M1A, and the nucleic acid sequence composed of the D and E sequences of probe M1 pairs complementaryly with the nucleic acid sequence composed of the F and G sequences of probe M2, forming a homodimer agonist (MD), simultaneously displacing probe MS and probe M2-C. The released probe MS can then bind to new M1S, initiating the next cycle. With the catalytic cycle of MS, MD is dynamically and massively assembled in situ on the cell membrane surface.

[0098] Test Example 1 The cell signal activation performance of the system in Example 1 was verified through different experiments.

[0099] 1. M1S and M1A were prepared according to the method described in Example 1. Following the same method and PCR procedure, probe M1 was self-assembled by PCR thermal cycling annealing to obtain sample M1, and probe M2 was self-assembled by PCR thermal cycling annealing to obtain sample M2. Buffers containing 1 μM M1 and 1 μM M2 were incubated at 37°C for 30 min to obtain sample MD. MS was added to buffers containing 1 μM M1S and 1 μM M1A to final concentrations of 10 nM, 100 nM, and 1000 nM, respectively, and incubated at 37°C for 30 min to obtain sample M1S+M1A+MS. The self-assembled products (M1, M2, M1S, and M1A, all at 1 μM) were mixed with loading buffer and loaded onto the sample. Electrophoresis was performed at 80 V for 1 h in 1×TBE buffer (89 mM tris(hydroxymethyl)aminomethane, 2 mM ethylenediaminetetraacetic acid, 89 mM boric acid, pH 8.0). Stain with SYBR Green II for 30 min and scan with a gel imaging system.

[0100] The results are as follows Figure 3 As shown.

[0101] Compared to the sensor M1S in lane 3 and the activator M1A in lane 4, the relative mobility of the dimer MD in lane 5 shows a significant change, and only a single main band appears. This indicates that the MD was successfully assembled.

[0102] When M1S and M1A are simply mixed and then added to the cyclic MS, MD is generated. The intensity of the MD band in lane 7 is close to that in lane 8, indicating that the cyclic MS successfully achieves ultrasensitive chain cyclic substitution to generate a large amount of MD.

[0103] 2. Cyclic chain MS was dissolved in ultrapure water and diluted to 1 nM, 10 nM, and 100 nM, respectively. A fluorescent group TAMRA was attached to the 3' end of probe M1. Following the method in Example 1, it was mixed with probe M1-C in an equimolar ratio and then self-assembled via PCR thermal cycling annealing to obtain M1S-T. A quencher group BHQ2 was attached to the 5' end of probe M2. Following the method in Example 1, it was mixed with probe M2-C in an equimolar ratio and then self-assembled via PCR thermal cycling annealing to obtain M1A-B. A buffer containing 1 μM M1S-T, 1 μM M1A-B, and 1 μM MS was reacted at 37°C in the dark for 30 min to obtain sample MD-F. The fluorescence spectrum at 560-600 nm was detected using a fluorescence spectrometer.

[0104] The results are as follows Figure 4 As shown.

[0105] Compared to the control group, 1 nM MS significantly reduced fluorescence intensity. This indicates that the circulating MS successfully triggered the chain cyclic substitution reaction, generating MD-F and quenching the red fluorescence of TAMRA. The fluorescence of 10 nM MS was almost identical to that of 100 nM MS, and close to that of MD-F. This demonstrates that the circulating MS achieved ultrasensitive DNA chain cyclic reactions through cyclic amplification.

[0106] 3. The dimer MD, formed from the sensor M1S and activator M1A through a highly sensitive chain cyclic substitution reaction, can activate the Met receptor and induce downstream signal transduction when incubated with A549 cells. Akt and Erk are important protein kinases in the Met signaling pathway, and their activation can control cellular behavior (e.g., cell proliferation and migration). Figure 5 As shown.

[0107] M1S and M1A were prepared according to the method described in Example 1. MS was added to buffer solutions containing 100 nM M1S and 100 nM M1A to a final concentration of 0 nM, 1 nM, 10 nM, or 100 nM, respectively, and incubated at 37°C for 10 min to obtain sample M1S+M1A+MS. Buffer solutions containing 100 nM M1 and 100 nM M2 were incubated at 37°C for 30 min to obtain sample MD.

[0108] A549 cells were seeded in 35 mm culture dishes and cultured in RPMI 1640 medium containing L-glutamine, 10% fetal bovine serum, and 1% penicillin-streptomycin. When the cells reached 80% confluence, they were starved in fasting medium for 24 h. After 24 h, the fasting medium was discarded, and sample M1S+M1A+MS or sample MD was added, followed by incubation at 37°C for 10 min. The buffer-treated group served as the control group. After the reaction, the 35 mm culture dishes were placed on ice to stop the reaction. The cells were washed twice with pre-chilled PBS, and then lysed with RIPA buffer containing 1% protease inhibitor and phosphatase inhibitor. The lysed cells were scraped off with a cell scraper and collected in 1.5 mL centrifuge tubes. The cell lysate was centrifuged at 4°C (10000 rcf, 10 min), and the supernatant was retained. The supernatant was then mixed with loading buffer and denatured at 95°C for 5 min to prepare the loading sample. Using GAPDH as an internal control, Western blotting experiments were performed to detect the levels of p-Met, p-Akt, and p-Erk in order to evaluate the activation of the Met receptor.

[0109] The results are as follows Figure 6As shown, A549 cells incubated with MD formed in vitro in buffer solution can still activate Met through homodimerization. MD formed from 1 nM MS via chain-cycle substitution reaction can significantly activate Met, with the activation effect positively correlated with MS concentration. This indicates that chain-cycle substitution reaction can form a large amount of dimeric MD homodimers to activate Met even at relatively low circulating MS concentrations.

[0110] The results are as follows Figure 7 As shown, MD formed by MS through a chain cycle substitution reaction significantly increased the phosphorylation levels of Akt and Erk. This indicates that MD incubation of A549 cells promotes the activation of Met homodiphosphorylation and increases the expression levels of p-Akt and p-Erk through a series of signaling cascade reactions.

[0111] 4. Prepare M1S and M1A respectively according to the method described in Example 1. Add MS to buffer solutions containing 100 nM M1S and 100 nM M1A to a final concentration of 1 nM, 10 nM, or 100 nM, and incubate at 37°C for 10 min to obtain the experimental group samples. Incubate buffer solutions containing 100 nM M1S and 100 nM M1A at 37°C for 10 min to obtain the control group samples. Use the buffer solution as the blank group samples.

[0112] A549 cells were seeded into 96-well plates and cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum and 1% penicillin and streptomycin at 37°C in a 5% CO2 incubator. When the cells reached confluence, scratches were made in the A549 cell layer using a 10 μL pipette tip. After washing twice with PBS, different samples were added, and the cells were cultured for another 24 h. The scratches were then monitored using an optical microscope. A blank control group was used, and a control group was used, treated with only equal concentrations of M1S and M1A. Cell migration was analyzed using ImageJ software (cell migration = (initial scratch area - scratch area after 24 h) / initial scratch area × 100%).

[0113] The results are as follows Figure 8 and Figure 9 As shown.

[0114] The 1 nM MS group, 10 nM MS group, and 100 nM MS group all significantly promoted the migration of A549 cells. Compared with the control group, the MD formed by the 1 nM MS reaction increased the migration rate of A549 cells by 1.6 times, and the MD formed by the 10 nM MS reaction increased the migration rate of A549 cells by 1.68 times. This indicates that the MD formed by MS in the ultrasensitive chain cyclic substitution reaction can significantly increase the migration ability of A549 cells.

[0115] 5. Prepare M1S and M1A respectively according to the method described in Example 1. Add MS to buffer solutions containing 100 nM M1S and 100 nM M1A to a final concentration of 1 nM, 10 nM, or 100 nM, and incubate at 37°C for 10 min to obtain the experimental group samples. Incubate buffer solutions containing 100 nM M1S and 100 nM M1A at 37°C for 10 min to obtain the control group samples. Use the buffer solution as the blank group samples.

[0116] A549 cells were divided into 5×10 3 Cells / wells were seeded in 96-well plates and cultured for 24 h after reaching a suitable cell density and adding different samples. Cell viability was assessed using the CCK-8 assay.

[0117] The results are as follows Figure 10 As shown.

[0118] Compared with the control group, the cell proliferation capacity of all experimental groups increased after 24 h of incubation. Specifically, the MD formed by the 1 nM MS reaction increased the proliferation rate of A549 cells by 1.1 times, and the MD formed by the 10 nM MS reaction increased the proliferation rate of A549 cells by 1.27 times. This indicates that the MD formed by MS participating in the chain cycle substitution reaction can significantly increase the proliferation capacity of A549 cells.

[0119] In summary, the sensor and activator in the system of Example 1 can smoothly generate the dimer MD by replacing the reaction-responsive cycle chain MS with an ultrasensitive chain cycle. Furthermore, MD can activate the Met receptor and downstream Akt and Erk, similar to the homodimer agonists generated in other steps, thereby enhancing cell migration and proliferation. Figure 11 As shown.

[0120] Test Example 2 like Figure 12 As shown in Figure a. The fluorophore TAMRA was attached to the 3' end of probe M1 from Example 1, and the probe M1-C was self-assembled with probe M1-C via PCR thermal cycling annealing to obtain sensor M1S-T. The quencher group BHQ2 was attached to the 5' end of probe M2, and the probe M2-C was self-assembled with probe M2-C via PCR thermal cycling annealing to obtain activator M1A-B. Sensor M1S-T and activator M1A-B were respectively linked to the Met receptor on the cell surface to form a chimeric receptor. Upon addition of the circulating chain MS, a chain cycling substitution reaction was initiated, dynamically forming dimerized MD-F on the cell membrane. The TAMRA fluorophore and the BHQ2 quencher group approached each other, quenching the red fluorescence.

[0121] The following experiments investigate whether the sensors and activators in the system of Example 1, after binding to the Met receptor, can respond to the circulating chain MS on the cell membrane, dynamically assemble MD, and regulate related cell behaviors.

[0122] 1. A549 cells were seeded in 35 mm confocal culture dishes and cultured for 12–18 h in an incubator at 37°C and 5% CO2 in RPMI 1640 medium supplemented with 10% FBS and 1% penicillin and streptomycin. A549 cells were then washed twice with PBS buffer. After incubating the cells with buffer containing 500 nM M1S-T and 500 nM M1A-B at 37°C for 10 min, the cells were washed again with PBS buffer, and then incubated for 30 min with RPMI 1640 medium containing 50 nM circulating chain MS. The cells were then washed with PBS, and 1 mL of RPMI 1640 medium was added. Real-time imaging was performed using a Zeiss LSN880 confocal laser scanning microscope.

[0123] like Figure 12 As shown in Figure b.

[0124] Without the MS chain, M1S-T and M1A-B do not react and attach to the cell membrane surface receptor, forming a ring of red fluorescence on the cell surface. The addition of the circulating MS chain rapidly induces hybridization of M1S-T and M1A-B at the cell membrane surface, leading to MD-F formation and fluorescence resonance energy transfer (FRET). This quenches the red fluorescence of TAMRA, making it impossible to observe red fluorescence on the cell membrane surface. This demonstrates that the circulating MS chain can indeed induce a chain substitution reaction in the ultrasensitive aptamer chimeric receptor at the cell membrane surface.

[0125] 2. A549 cells were seeded in 100 mm culture dishes. When the cells reached 80% confluence, they were washed twice with PBS, digested with enzyme-free digestion solution, and aliquoted into 2 mL centrifuge tubes. The cells were centrifuged at 4°C for 5 min (650 rcf), and the supernatant was discarded. The cells were then incubated with buffer containing 500 nM M1S-T and 500 nM M1A-B at 37°C for 30 min, followed by centrifugation at 4°C for 5 min (650 rcf), and the supernatant was discarded. After washing with PBS, the cells were incubated for 30 min with PBS containing different concentrations (5 nM, 50 nM, 500 nM) of circulating chain MS. The control group consisted of cells without M1S-T, M1A-B, and MS treatment. After incubation, the cells were washed twice with PBS and resuspended in PBS containing 2% FBS. The cells were then analyzed using flow cytometry.

[0126] like Figure 13As shown.

[0127] Compared to the blank control group, the peak shifted to the right, indicating that M1S-T and M1A-B successfully bound to the Met receptor. The addition of circulating chain MS caused the peak to begin shifting to the left, suggesting that circulating chain MS can reduce the red fluorescence intensity of TAMRA. Flow cytometry results further confirm the occurrence of an ultrasensitive circulating chain substitution reaction on the cell membrane surface.

[0128] 3. A549 cells were seeded in 35 mm culture dishes and cultured in RPMI 1640 medium containing L-glutamine, 10% fetal bovine serum, and 1% penicillin-streptomycin. When the cells reached 80% confluence, they were starved in a fasting medium for 24 h. After 24 h, the fasting medium was discarded, and buffer containing sensor M1S (100 nM) and activator M1A (100 nM) was added and incubated for 10 min. The cells were washed twice with PBS, followed by incubation in buffer containing different concentrations (1 nM, 10 nM, and 100 nM) of circulating chain MS for 10 min. The group without M1S-T, M1A-B, and MS treatment was designated as the blank group, and the group treated with M1S-T and M1A-B but without MS treatment was designated as the control group. After washing twice with PBS, MD group cells were incubated for 10 min with a buffer containing 100 nM MD (MD was obtained by incubating M1 and M2 in a buffer solution at 37°C for 30 min, and hybridization of M1 and M2). After the reaction was complete, 35 mm culture dishes were placed on ice to stop the reaction. Cells were washed twice with pre-cooled PBS and then lysed with RIPA buffer containing 1% protease inhibitor and phosphatase inhibitor. Lysed cells were scraped off with a cell scraper and collected in 1.5 mL centrifuge tubes. The cell lysate was centrifuged at 4°C (10000 rcf, 10 min), and the supernatant was retained. The supernatant was then mixed with loading buffer and denatured at 95°C for 5 min to prepare the loading sample. Using GAPDH as an internal control, Western blotting experiments were performed to detect the levels of p-Met, p-Akt, and p-Erk to evaluate the activation of the Met receptor.

[0129] M1S and M1A were incubated in A549 cells for 10 min to form a chimeric receptor with the Met receptor. After washing with PBS, the cells were incubated with buffer containing the corresponding concentration of MS for 10 min to induce the chimeric receptor to respond to MS by forming a dimer MD that activates Met. Figure 14 As shown in Figure a.

[0130] The results are as follows Figure 14Figures b and c show the results. The chimeric receptor response to MS is highly effective in activating the Met receptor; the addition of 1 nM MS can significantly activate the Met receptor, while there is no significant difference between 10 nM and 100 nM MS.

[0131] The Met receptor on the A549 cell membrane surface binds to M1S and M1A to form a highly sensitive aptamer chimeric receptor. This receptor, in response to the dimer MD formed by the circulating MS chain, activates the Met receptor, which can further activate downstream Akt and Erk. Akt and Erk, activated through a series of signaling cascades, alter cell motility, enhancing cell proliferation and migration. For example... Figure 15 and Figure 16 As shown in Figure a.

[0132] The results are as follows Figure 16 The results are shown in the BD diagram. 1 nM MS significantly enhanced the expression levels of p-Akt and p-Erk. The expression levels of p-Akt and p-Erk increased with increasing MS concentration.

[0133] 4. A549 cells were seeded into 96-well plates and cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum and 1% penicillin and streptomycin at 37°C in a 5% CO2 incubator. When the cells reached confluence, a 10 μL pipette tip was used to scratch the A549 cell layer. After washing twice with PBS, the cells were incubated for 10 min in buffer containing 100 nM sensor M1S and activator M1A. After washing twice with PBS, the cells were added to starvation medium containing different concentrations (1 nM, 10 nM, and 100 nM) of circulating chain MS and cultured for another 24 h. The scratches were then monitored using an optical microscope. The group without M1S, M1A, and MS treatment served as the blank group, and the group treated with M1S and M1A but without MS treatment served as the control group. Cell migration was analyzed using ImageJ software.

[0134] The results are as follows Figure 17 and Figure 18 As shown.

[0135] Compared with the control group, the self-assembly of MDs from 1 nM MS on the cell membrane increased the migration rate of A549 cells by 1.48 times, and the self-assembly of MDs from 10 nM MS increased the migration rate of A549 cells by 1.47 times. This indicates that the self-assembly of MDs from chimeric receptor-responsive circulating MS on the cell membrane can significantly increase the migration ability of A549 cells.

[0136] 5. A549 cells were prepared at a ratio of 5 × 10⁻⁶. 3Cells / wells were seeded in 96-well plates and, after reaching a suitable cell density, incubated for 10 min with buffer containing 100 nM sensor M1S and activator M1A. After washing twice with PBS, the cells were incubated for 24 h with starvation medium containing different concentrations (1 nM, 10 nM, and 100 nM) of circulating MS. A blank control group was established without M1S, M1A, and MS treatment, while a control group was established with M1S and M1A treatment but without MS treatment. Cell viability was assessed using the CCK-8 assay.

[0137] The results are as follows Figure 19 As shown.

[0138] Compared with the control group, the addition of circulating MS for 24 h increased the cell proliferation capacity of all experimental groups. Specifically, MD generated by the 1 nM MS reaction increased the proliferation rate of A549 cells by 1.26 times, and MD generated by the 10 nM MS reaction increased the proliferation rate of A549 cells by 1.28 times. This indicates that MD self-assembled by chimeric receptors in response to circulating MS on the cell membrane can increase the proliferation capacity of A549 cells.

[0139] 6. DU145 cells were seeded in 35 mm culture dishes and cultured in RPMI 1640 medium containing L-glutamine, 10% fetal bovine serum, and 1% penicillin-streptomycin. When the cells reached 80% confluence, they were starved in a fasting medium for 24 h. After 24 h, the fasting medium was discarded, and buffer containing sensor M1S (100 nM) and activator M1A (100 nM) was added and incubated for 10 min. The cells were washed twice with PBS, followed by incubation in buffer containing different concentrations (1 nM, 10 nM, and 100 nM) of circulating chain MS for 10 min. A blank control group was used, with no M1S-T, M1A-B, or MS treatment. A control group was used, with M1S-T and M1A-B treatment but no MS treatment. After the reaction, the 35 mm culture dishes were placed on ice to stop the reaction. The cells were washed twice with pre-cooled PBS and then lysed with RIPA buffer containing 1% protease inhibitor and phosphatase inhibitor. Lysed cells were scraped off using a cell scraper and collected in 1.5 mL centrifuge tubes. The cell lysis buffer was centrifuged at 4°C (10000 rcf, 10 min), and the supernatant was retained. The supernatant was then mixed with loading buffer and denatured at 95°C for 5 min to prepare the loading sample. Using GAPDH as an internal control, Western blotting was performed to detect p-Met levels and evaluate Met receptor activation.

[0140] The results are as follows Figure 20 As shown.

[0141] DU145 cells are a cell line that highly expresses Met. Treatment of DU145 cells with 1 nM circulating MS significantly enhanced p-Met expression levels. This indicates that the circulating MS also achieves an ultrasensitive circulating reaction at the chimeric receptor on the DU145 cell membrane, demonstrating the universality of the system in Example 1.

[0142] In summary, the chimeric receptor formed by cell surface receptors binding to M1S and M1A can respond well to the circulating chain MS and carry out the chain substitution reaction, so that even a low concentration of circulating chain MS can form dimers on the cell membrane to activate the Met receptor. This, in turn, increases the expression levels of p-Akt and p-Erk through a series of signal cascade reactions, and enhances the cell's proliferation and migration capabilities.

[0143] The embodiments of the present invention have been described in detail above with reference to the examples. However, the present invention is not limited to the above embodiments. Within the scope of knowledge possessed by those skilled in the art, various changes can be made without departing from the spirit of the present invention.

Claims

1. A system, characterized in that, include: Probe M1, from 5' to 3', includes sequences A, B, C, D, and E in sequence. Sequence B includes a nucleic acid aptamer that specifically targets the first receptor. Sequence A and sequence C hybridize and pair complementaryly to form an inverted stem-loop structure. Probe M1-C, wherein the E sequence of probe M1-C is inversely complementary to that of probe M1; Probe M2, from 5' to 3', includes F sequence, G sequence, H sequence, I sequence and J sequence in sequence. The I sequence includes a nucleic acid aptamer that specifically targets the second receptor. The H sequence and the J sequence hybridize and pair complementaryly to form an inverted stem-loop structure. The nucleic acid sequence composed of the D and E sequences of probe M1 is complementary to the nucleic acid sequence composed of the F and G sequences of probe M2. Probe M2-C, wherein the G sequence of probe M2-C is inversely complementary to that of probe M2; The probe MS is complementary to a portion of the D and E sequences of the probe M1; The dimerization of the first receptor and the second receptor activates downstream signaling pathways.

2. The system according to claim 1, characterized in that, The length of the region where probe M1-C is complementary to probe M1 is less than the length of the region where probe MS is complementary to probe M1, and the sum of the lengths of probe M1-C and probe M2-C is not less than the total length of the D sequence and the E sequence.

3. The system according to claim 1, characterized in that, The nucleic acid sequence of sequence A is shown in positions 1 to 8 of SEQ ID NO: 1; and / or, the nucleic acid sequence of sequence B is shown in positions 9 to 42 of SEQ ID NO: 1; and / or, the nucleic acid sequence of sequence C is shown in positions 43 to 50 of SEQ ID NO: 1; and / or, the nucleic acid sequence of sequence D is shown in positions 51 to 63 of SEQ ID NO: 1; and / or, the nucleic acid sequence of sequence E is shown in positions 43 to 76 of SEQ ID NO:

1.

4. The system according to claim 1, characterized in that, The length of the F sequence is 12 nt-14 nt; and / or, the length of the G sequence is 12 nt-14 nt; and / or, the length of the H sequence is 7 nt-9 nt; and / or, the length of the I sequence is 33 nt-35 nt; and / or, the length of the J sequence is 7 nt-9 nt.

5. The system according to claim 1, characterized in that, The first receptor and / or the second receptor include at least one of Met, HER, and EGFR.

6. A method for constructing the system according to any one of claims 1 to 5, characterized in that, The process includes the following steps: mixing probe M1 and probe M1-C in an equimolar ratio and then annealing and hybridizing to obtain hybrid chain M1S; mixing probe M2 and probe M2-C in an equimolar ratio and then annealing and hybridizing to obtain hybrid chain M1A.

7. The construction method according to claim 6, characterized in that, The conditions for the annealing hybridization include: Treatment at 93℃-97℃ for 3-7 min, at 63℃-67℃ for 25-35 min, at 48℃-52℃ for 25-35 min, at 35℃-39℃ for 25-35 min, at 20℃-24℃ for 25-35 min, and at 2℃-6℃ for 25-35 min.

8. The construction method according to claim 6, characterized in that, The construction method further includes: mixing and incubating the hybrid chain M1S, hybrid chain M1A, and probe MS to obtain hybrid chain MD.

9. A method for regulating cell receptor signal activation for non-disease diagnosis and treatment purposes, characterized in that, This includes the step of using the system control described in any one of claims 1 to 5.

10. Use of the system according to any one of claims 1 to 5 in the preparation of products that promote cell proliferation and / or cell migration.

Images