OsSULTR1;3 protein and its encoding gene in regulating rice alkali tolerance

Abstract

The application belongs to the technical field of rice genetic engineering, and specifically discloses application of OsSULTR1;3 protein and its coding gene in regulating rice alkali resistance. OsSULTR1;3 The application obtains corresponding transgenic rice strains by knocking out and overexpressing the genes respectively, and carries out alkali stress treatment and phenotype identification at the seedling stage. The test results show that: OsSULTR1;3 After the gene is knocked out, the alkali resistance of the rice is significantly improved; and the overexpression strain of the gene shows that the sensitivity to alkali stress is significantly enhanced. The above results clearly confirm that the gene negatively regulates the alkali resistance of rice, and has important breeding application value. OsSULTR1;3 Therefore, the OsSULTR1;3 protein and its coding gene provided by the application can effectively regulate the alkali resistance of rice, provide key gene resources and molecular targets for breeding alkali-resistant or alkali-sensitive transgenic rice, and have important theoretical significance and application prospect.

Description

Technical Field

[0001] This invention belongs to the field of rice genetic engineering technology, specifically involving the application of OsSULTR1;3 protein and its encoding gene in regulating rice alkali tolerance. Background Technology

[0002] Globally, salinized land covers a vast area, with soda-type alkaline soils (mainly composed of Na₂CO₃ and NaHCO₃) posing a serious threat to crop growth due to their high pH value and strong destructive properties. Rice is a crop particularly sensitive to alkaline stress, which severely inhibits seed germination, root development, and photosynthesis, leading to a significant drop in yield. Therefore, identifying key alkaline-tolerant genes and breeding alkaline-tolerant rice varieties are important approaches to effectively develop and utilize alkaline land.

[0003] Unlike simple salt stress, the toxic mechanisms of alkali stress on plants are more complex. Alkali stress not only causes Na⁺ ion toxicity and osmotic stress, but its core harm lies in the fact that high pH levels (typically pH > 8.5) directly disrupt the acid-base balance (pH homeostasis) within plant cells, leading to cytoplasmic alkalization and inhibiting the activity of various enzymes. Simultaneously, a high pH environment causes essential mineral nutrients such as iron, zinc, calcium, and phosphorus in the soil to precipitate, resulting in severe nutrient deficiencies in plants. Furthermore, alkali stress induces the accumulation of large amounts of reactive oxygen species (ROS), causing severe oxidative damage and cell membrane lipid peroxidation. Therefore, plants rely on a complex physiological and metabolic network to resist alkali stress, including maintaining intracellular pH homeostasis, enhancing antioxidant defense systems, and regulating the synthesis of osmotic protective substances.

[0004] Sulfur (S) is an essential macronutrient element for plant growth and development, mainly in the form of sulfate (SO4). 2-Sulfate is absorbed in the form of cysteine, methionine, and glutathione (GSH). Within plants, sulfate is assimilated into important sulfur-containing compounds such as cysteine, methionine, and GSH. Glutathione is not only an important osmotic protectant in plants but also a core antioxidant that scavenges reactive oxygen species (ROS) and maintains cellular redox homeostasis, playing a crucial role in protecting plants from abiotic stresses such as high pH and ion toxicity. The sulfate transporter (SULTR) family is responsible for sulfate absorption, long-distance transport, and intracellular distribution within plants, directly determining the level of sulfur nutrition and the ability to synthesize stress-resistance metabolites. Based on sequence similarity and function, the plant SULTR family is divided into four subfamilies (SULTR1–4). Members of the SULTR3 subfamily are primarily involved in the long-distance transport of sulfate from roots to aboveground parts and the distribution of sulfate in organelles such as chloroplasts. Rice OsSULTR1;3 protein belongs to the SULTR1 subfamily, and studies have shown that it plays a fundamental role in sulfate transport and sulfur homeostasis maintenance. However, how plants maintain intracellular homeostasis and antioxidant capacity by regulating sulfur transport under complex alkaline stress conditions has not been fully elucidated. In particular, whether rice OsSULTR1;3 directly participates in the alkaline stress response, and its specific biological function in regulating rice alkali tolerance, remains unclear. Summary of the Invention

[0005] The technical problem to be solved by the present invention is how to regulate the alkali resistance of rice (including increasing or decreasing the alkali resistance of rice).

[0006] To solve the above-mentioned technical problems, the present invention provides the following technical solution: The first aspect of this invention provides the application of knocking out the gene encoding the OsSULTR1;3 protein in improving the alkali resistance of rice. The amino acid sequence of the OsSULTR1;3 protein is shown in SEQ ID NO.1.

[0007] A second aspect of the present invention provides the application of biomaterials associated with the OsSULTR1;3 protein in improving the alkali resistance of rice; The biomaterial is any one of the following E1) to E3): E1) sgRNA expression cassette targeting the OsSULTR1;3 gene; E2) CRISPR / Cas9 recombinant vectors containing this sgRNA expression cassette; E3) contains Agrobacterium tumefaciens with the recombinant vector.

[0008] The amino acid sequence of the OsSULTR1;3 protein is shown in SEQ ID NO.1, and the nucleotide sequence of the nucleic acid molecule encoding the OsSULTR1;3 protein is shown in SEQ ID NO.2.

[0009] A third aspect of the present invention provides a method for cultivating plants with enhanced alkali tolerance, the method comprising knocking out the gene for the OsSULTR1;3 protein in a plant to obtain a plant with enhanced alkali tolerance, wherein the plant is rice, and the amino acid sequence of the OsSULTR1;3 protein is shown in SEQ ID NO.1.

[0010] In the above method, knocking out the gene encoding the OsSULTR1;3 protein in rice is achieved by using gene knockout technology to reduce the expression level or eliminate the function of the gene encoding the OsSULTR1;3 protein in rice.

[0011] In the above method, the expression level of the gene encoding the OsSULTR1;3 protein in rice is reduced by using gene knockout technology. This is achieved by introducing a plant expression vector containing an sgRNA expression cassette targeting the OsSULTR1;3 gene into the target rice.

[0012] In the above method, the plant expression vector is a recombinant vector constructed based on the dual target sites of the nucleic acid molecule shown in SEQ ID NO.2, target site 1: CCATTGCAAGTCTCTGCATTCCC and target site 2: AAAGGATATTGCAATCGGTCCGG.

[0013] The fourth aspect of this invention provides the application of overexpressing a gene encoding the OsSULTR1;3 protein in reducing alkali tolerance in rice, wherein the amino acid sequence of the OsSULTR1;3 protein is shown in SEQ ID NO.1.

[0014] The fifth aspect of this invention provides the application of biomaterials related to the OsSULTR1;3 protein, the application being the use in reducing alkali tolerance in rice; The biomaterial is any one of the following F1) to F3): F1) Expression cassettes containing nucleic acid molecules encoding the OsSULTR1;3 protein; F2) Recombinant vectors containing nucleic acid molecules encoding the OsSULTR1;3 protein; F3) A recombinant microorganism containing the expression cassette described in F1) or the recombinant vector described in F2), wherein the microorganism is Agrobacterium; The nucleotide sequence of the nucleic acid molecule encoding the OsSULTR1;3 protein is shown in SEQ ID NO.2.

[0015] The sixth aspect of the present invention provides a method for breeding rice sensitive to alkali stress, the method comprising overexpressing the encoding gene of OsSULTR1;3 protein in rice to obtain rice sensitive to alkali stress, wherein the amino acid sequence of the OsSULTR1;3 protein is shown in SEQ ID NO.1.

[0016] In the above method, the gene encoding OsSULTR1;3 protein in plants is overexpressed by introducing the gene encoding OsSULTR1;3 protein into rice using a plant expression vector, thereby increasing the expression level of the gene encoding OsSULTR1;3 protein.

[0017] In the above method, the plant expression vector is a recombinant vector containing the nucleic acid molecule shown in SEQ ID NO.2.

[0018] The present invention has the following beneficial effects: This invention, for the first time, proposes that the OsSULTR1;3 protein and its encoding gene can regulate the alkali tolerance of rice. On the one hand, by reducing the content and / or activity of the OsSULTR1;3 protein in the target plant (e.g., by inhibiting, silencing, or interfering with the expression of the OsSULTR1;3 gene), the alkali tolerance of rice can be significantly improved. On the other hand, by overexpressing the gene for the OsSULTR1;3 protein in the target plant, thereby increasing the content and / or activity of the OsSULTR1;3 protein, the alkali tolerance of rice can be significantly reduced. Therefore, the rice alkali tolerance-related protein OsSULTR1;3 and its encoding gene have important theoretical significance and practical value in regulating rice alkali tolerance. They can be applied to the breeding of transgenic rice with improved alkali tolerance as well as transgenic rice with reduced alkali tolerance. This invention is of great significance for the genetic improvement of rice alkali tolerance. Attached Figure Description

[0019] Figure 1 for OsSULTR1;3 Gene mutant (KO- OsSULTR1;3 -1 and KO- OsSULTR1;3 -2) OsSULTR1;3 Mutation sites of genes and their flanking sequences.

[0020] Figure 2 Wild-type medium-flowered 11 (WT) and OsSULTR1;3 Gene mutant (KO- OsSULTR1;3-1 and KO- OsSULTR1;3-2 Phenotypic and survival rate of seedlings under alkaline stress. A: After normal growth to the three-leaf stage, seedlings were treated with Yoshida nutrient solution containing 10 mmol / L total alkali (NaHCO3 to Na2CO3 molar ratio 5:5) for 12 days and then rehydrated for 7 days. Wild-type (WT) and knockout mutant KO- OsSULTR1;3-1 and KO-OsSULTR1;3-2 A: Phenotypic photos of seedling growth; B: Statistical results of seedling survival rate (mean ± standard deviation) of the above lines after alkaline stress treatment. The results show that, compared with WT, the two mutant lines have vigorous growth, good green leaf retention, and significantly higher survival rates than WT, indicating that knockout OsSULTR1;3 Genes can effectively enhance the alkali resistance of rice.

[0021] Figure 3 for OsSULTR1;3 Analysis of relative expression levels in gene overexpression lines.

[0022] Figure 4 Wild-type medium-flowered 11 (WT) and OsSULTR1;3 Gene overexpression materials (OE- OsSULTR1;3 -1 and OE- OsSULTR1;3 -3) Phenotypic photos and survival rates of seedlings under alkaline stress. A: After normal growth to the three-leaf stage, seedlings were treated with Yoshida nutrient solution containing 10 mmol / L total alkali (NaHCO3 to Na2CO3 molar ratio 5:5) for 12 days and then rehydrated for 7 days. Wild-type (WT) and overexpression line OE- OsSULTR1;3-1 and OE- OsSULTR1;3-3 A: Phenotypic photos of seedling growth; B: Statistical results of seedling survival rate (mean ± standard deviation) of the above lines after alkaline stress treatment. The results showed that compared with WT, the leaves of the two overexpression lines were more severely yellowed and wilted, and the survival rate was significantly lower than that of WT, indicating that overexpression... OsSULTR1;3 The gene significantly reduced the alkali tolerance of rice. Detailed Implementation

[0023] The following embodiments are used to illustrate the present invention and specifically describe the construction of the present invention. OsSULTR1;3 CRISPR mutant materials of the gene were obtained, their genotypes were identified to obtain homozygous mutants, and their seedling alkali stress phenotypes were identified. Furthermore, a model was constructed. OsSULTR1;3 Gene overexpression materials were used, and their seedling alkali stress phenotypes were identified. Based on all or part of the implementation steps described below, those skilled in the art can determine the basic characteristics of this invention. Various changes and modifications can be made to this invention without departing from its spirit and scope to adapt it to different application scenarios and conditions. Unless otherwise specified, the technical solutions described in this invention are conventional technical solutions in the relevant field; the reagents or materials described, unless otherwise specified, are all commercially available.

[0024] Description of sequences SEQ ID NO.1 and SEQ ID NO.2: SEQ ID NO.1 ( OsSULTR1;3 (Gene amino acid sequence) MVHQHDESTANEVSTTTQLPSYGSSEEPRVYKVRCPPQKNFAREFRDTLRETFFHDNPLRQYKDQSGSAKFMMALQFLFPIFEWGRCYNLRKFKGDLIAGLTIASLCIPQDIGYSKLANLDAQYGLYSSFVPPLIYAAMGSSKDIAIGPVAVVSLLIGSLLQNEVDPVKNKEEYLRLAFTATFFAGITQAALGFLRLGFLIEFLSHAAIVGFMGGAAITIALQQLKYVLGIKSFTKKTDIISVMRSVWTSAHHGWNWQTIVIGITFLAFLLLAKYIGKKNRKFFWVPAIAPITSVILATLFVFITRADKQGVQIVNHIKKGINPSSVHKIYFTGPFVAKGFKIGVISAMIGLTEAVAIGRTFAALKDYQLDGNKEMVALGTMNIAGSMTSCYIATGSFSRSAVNFMAGCQTPVSNIIMSAVVLLTLLVITPLFKYTPNAILGSIIISAVIGLVDYEAVILIWKVDKMDFISCMGAFFGVVFASVEIGLLIAVSISFAKILLQVTRPRTVLLGNLPGTTIYRNTDQYPEARHIPGVVIVRVDSAIYFSNSNYVRERTLRWLTEEEEKAKAEGQSKINFLIIEMSPVIDIDTSGIHALEDLYKNLKKRDIQLILANPGSIVMEKLLSSKLNEHIGSNNIFLTVADAVRFCTRKSMQEP SEQ ID NO.2 ( OsSULTR1;3 gene CDS sequence): This invention uses the standard rice nutrient solution established by Yoshida et al. (1976) of the International Rice Research Institute (IRRI) for hydroponics (Yoshida S, Forno DA, Cock JH, et al. Laboratory manual for physiological studies of rice [M]. 3rd ed. Manila: International Rice Research Institute (IRRI), 1976: 61-66.).

[0025] Example 1: Rice OsSULTR1;3 Cloning of gene coding region (CDS) sequences Using cDNA from the aboveground part of rice cultivar Zhonghua 11 seedlings as a template, a primer pair consisting of Primer1 and Primer2 was used to generate the gene. OsSULTR1;3 The CDS fragment was amplified by PCR.

[0026] Primer1:5'-ATGGTTCATCAGCATGATGA-3' (SEQ ID NO.3); Primer2:5'-TCATGGTTCTTGCATCGACT-3' (SEQ ID NO. 4).

[0027] The PCR reaction system (50 μL) consisted of: 1 μL template cDNA (200 ng / μL), 1.5 μL Primer 1 (10 μM), 1.5 μL Primer 2 (10 μM), 5 μL 10×PCR Buffer for KOD-Plus-Neo, 5 μL 2 mM dNTP, 3 μL 25 mM MgSO4, 1 μL KOD-Plus-Neo (1 U / μL), and 32 μL ddH2O. The PCR amplification reaction was performed in a PCR instrument. The PCR reaction program was: 94℃ pre-denaturation for 2 min; 98℃ denaturation for 10 s, 60℃ annealing for 30 s, 68℃ extension for 2 min, for 35 cycles; 68℃ extension for 5 min; and storage at 4℃.

[0028] The PCR products were recovered and purified using a DNA purification kit (Nanjing Novizan Biotechnology Co., Ltd.), ligated into the pEASY-Blunt cloning vector (Beijing TransGen Biotech Co., Ltd.), and the ligation product was transformed into Escherichia coli DH5α competent cells (Baori Biotechnology (Beijing) Co., Ltd.). Positive clones were selected for sequencing (Sangon Biotech (Shanghai) Co., Ltd.).

[0029] Sequencing results showed that the PCR amplification obtained OsSULTR1;3 The CDS fragment of the gene has the nucleotide sequence shown in SEQ ID NO.2, encoding a protein consisting of 656 amino acid residues as shown in SEQ ID NO.1.

[0030] Example 2: Rice OsSULTR1;3 Construction of gene knockout mutant transgenic plants one, OsSULTR1;3 Construction of gene knockout vector according to OsSULTR1;3 The genome sequence was obtained, and CRISPR-Cas9 sgRNA targets were designed using the CRISPR-P V2.0 website (http: / / crispr.hzau.edu.cn / CRISPR2 / ). The targets selected were... OsSULTR1;3 The dual target sequences for constructing the gene editing vector are: CCATTGCAAGTCTCTGCATTCCC (SEQ ID NO.5) and AAAGGATATTGCAATCGGTCCGG (SEQ ID NO.6).

[0031] Based on the target sequence, Primer3 and Primer4, and Primer5 and Primer6 were synthesized. The two primer pairs were annealed to obtain two double-stranded DNA molecules with sticky ends. These two double-stranded DNA molecules were ligated into a BsaI-digested pOs-sgRNA linearized vector (the vector construction method is described in the literature "Targeted mutagenesis in rice using CRISPR-Cas system") using T4 DNA ligase. The ligation product was transformed into DH5α *E. coli*. Positive clones were identified using colony PCR, and plasmids were extracted and sequenced. Sequencing results showed that a vector containing the sequences shown in SEQ ID NO. 5 and SEQ ID NO. 6 was obtained and named pOs-sgRNA- OsSULTR1;3 .

[0032] Primer3: 5'-ggcaGGGAATGCAGAGACTTGCAA-3' (SEQ ID NO.7); Primer4: 5'-aaacTTGCAAGTCTCTGCATTCCCc-3' (SEQ ID NO.8); Primer5: 5'-ggcaAAAGGATATTGCAATCGGTC-3' (SEQ ID NO.9); Primer6: 5'-aaacGACCGATTGCAATATCCTTTc-3' (SEQ ID NO. 10).

[0033] pOs-sgRNA- OsSULTR1;3 The plasmid and CRISPR-Cas9 vector plasmid were ligated according to the corresponding system; the ligation reaction system (10 μL) was: 6 μL H2O, 2 μL CRISPR-Cas9 vector plasmid, pOs-sgRNA- OsSULTR1;3 1 μL of plasmid and 1 μL of enzyme mix were added, and then all components were mixed on ice. After mixing, the mixture was incubated at room temperature (20°C) for 1 hour. Transformation into *E. coli*: 5 μL of the reaction solution was added to at least 50 μL of competent cells, mixed, and incubated on ice for 30 minutes; the cells were gently removed, heat-shocked at 42°C for 60 seconds, and immediately placed on ice for 2 minutes; 500 μL of SOB / LB was added, and the cells were incubated at 37°C and 200 rpm for 1 hour; an appropriate amount of bacterial culture was spread on LB agar plates containing kanamycin and incubated overnight at 37°C upside down; positive clones were identified by colony PCR, and the plasmid was extracted and sequenced to obtain the plasmid pH-Ubi-cas9- containing the sequences shown in SEQ ID NO. 5 and SEQ ID NO. 6. OsSULTR1;3 .

[0034] II. Obtaining Recombinant Agrobacterium pH-Ubi-cas9- OsSULTR1;3 Mix with Agrobacterium EHA105 competent cells, incubate on ice for 5 min, and then electroporate (1500V, 5ms) pH-Ubi-Cas9- OsSULTR1;3 The recombinant strain was obtained by transformation into Agrobacterium EHA105 competent cells. Colony PCR was used to identify the correct recombinant strain, which was named EH-pH-Ubi-cas9. -OsSULTR1;3 .

[0035] Obtaining transgenic plants The above-mentioned recombinant Agrobacterium strain was transformed into the rice variety Zhonghua 11. The specific method was as follows: Seed induction: Wash in the following order: 30 seconds with alcohol, 15 minutes with 30% sodium hypochlorite solution, and 5 times with sterile water. Finally, remove excess water and place in induction medium for culture.

[0036] Callus subculture: Use sterile forceps to separate the buds and seeds, retain the mature callus tissue, and place it on a culture medium for further culture.

[0037] Agrobacterium activation: Dip a 200 μL pipette tip into the Agrobacterium culture and streak it on a YEP plate. Incubate in the dark at 28 degrees Celsius for 2 days.

[0038] Agrobacterium infection: The carrier on the plate was rinsed into a suspension with the infection solution. The callus was soaked in the suspension for 15 minutes. Then the callus was transferred to sterile filter paper to absorb the excess liquid and placed in the dark at 25 degrees Celsius for 3 days.

[0039] Selection culture: The callus after dark culture was washed with water containing carbenicillin, dried with air in a clean bench, and then placed on selection culture medium for selection culture.

[0040] Differentiation and regeneration: Positive particles that grow on the selection medium are transferred to the differentiation medium for regeneration.

[0041] Seedling rooting: Seedlings growing on differentiation medium are rooted into rooting tubes for root strengthening culture.

[0042] The differentiated rice seedlings were hardened off and then transferred to the field for growth, resulting in T0 generation transgenic plants.

[0043] Example 3: Rice OsSULTR1;3 Molecular identification of gene knockout mutant transgenic plants The obtained from Example 2 OsSULTR1;3 The aboveground parts of seedlings of the T0 generation transgenic plants were sampled, and genomic DNA was extracted as a template. Primers composed of Primer7 and Primer8 were used to amplify the DNA fragments on and flanking the editing target sites shown in SEQ ID NO.5 and SEQ ID NO.6.

[0044] Primer7: 5'-ACGCCAGTACAAGGACCAAT-3' (SEQ ID NO. 11); Primer8: 5'-TGCAGCATGTGACAAGAACTC-3' (SEQ ID NO. 12).

[0045] The obtained PCR products were detected by 1% agarose gel electrophoresis and then sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. Based on the sequencing results (based on the positive strand of the genome), two [genome sequences] were identified. OsSULTR1;3 The individual plants with specific gene mutations are: KO- OsSULTR1;3 -1 and KO- OsSULTR1;3 -2, the editing target site and the DNA sequences flanking it in these two individual plants are as follows Figure 1 As shown.

[0046] In KO- OsSULTR1;3 -1 single plant, OsSULTR1;3 The positive strand of the gene sequence has one nucleotide (T) inserted at the first target site and one nucleotide (T) inserted at the second target site. In KO-OsSULTR1;3 -2 single plants, OsSULTR1;3 No mutation occurred at the first target site in the positive strand of the gene sequence, but one nucleotide (C) was inserted at the second target site. In these two mutant monoplants OsSULTR1;3 Mutations in the CDS sequence of the gene all lead to frameshift mutations in the encoded protein and premature termination.

[0047] Example 4: OsSULTR1;3 Identification of alkali tolerance phenotype in seedlings of gene knockout mutants The two identified in Example 3 OsSULTR1;3 Two generations of self-crossing were performed on the T0 generation of transgenic mutant plants to obtain the homozygous mutant line KO- OsSULTR1;3 -1 and KO- OsSULTR1;3 -2. The two homozygous mutant lines were compared with the wild type of Zhonghua 11 to conduct seedling alkali tolerance identification experiments.

[0048] (1) Select plump rice seeds and soak them in tap water for 2 days in a 37℃ incubator, followed by germination for 1 day. Select seeds with uniform germination and sow them onto a 96-well PCR plate without tube bottoms. Place the plates in blue culture trays filled with tap water and cultivate the seedlings in an artificial climate chamber. The cultivation conditions are: 14h light (28℃) / 10h darkness (24℃), 100% light intensity, and 70% relative humidity. After culturing in tap water for another week, switch to Yoshida rice nutrient solution (three components) for further cultivation.

[0049] (2) When rice seedlings reach the three-leaf stage, the alkali treatment system (total alkali concentration 10 mmol / L) Alkali stress treatment was carried out using Yoshida rice nutrient solution (three components) with a NaHCO3 to Na2CO3 molar ratio of 5:5 and pH 9.55±0.05.

[0050] (3) After 12 days of alkali treatment, the rice seedlings were rehydrated using alkali-free Yoshida rice nutrient solution (three components). After 7 days, the survival rate of the rice seedlings was calculated. Survival rate = number of surviving seedlings / total number of seedlings treated × 100%.

[0051] (4) The results of the alkali tolerance test showed that, compared with the wild type (WT) of Zhonghua 11, both... OsSULTR1;3 Gene mutant strain (KO- OsSULTR1;3 -1 and KO- OsSULTR1;3 -2) After 12 days of alkali stress treatment and 7 days of rehydration, the leaf wilting, drying, and other alkali damage symptoms were significantly milder, and the seedling survival rate was significantly higher than that of the wild type (WT). Figure 2 (A and B in the text).

[0052] Example 5: RiceOsSULTR1;3 Construction of gene overexpression vectors and acquisition of plants Construction of overexpression vectors Using the pEASY-Blunt recombinant plasmid containing the complete CDS sequence of OsSULTR1;3 cloned in Example 1 as a template, PCR amplification was performed using Primer9 and Primer10 specific primers. By designing primers, recombinant arm sequences homologous to the ends of the linearized vector were added to both ends of the CDS sequence, and the terminator of the gene itself was deleted, resulting in an OsSULTR1;3 CDS amplified fragment with terminator removed and containing double restriction sites at both ends.

[0053] Primer9: 5'-ctctcgagctttcgcgagctcATGGTTCATCAGCATGATGA-3' (containing SacI recognition sequence and homologous arm, SEQ ID NO.13); Primer10: 5'-GCCCTTGCTCACCATggatccTGGTTCTTGCATCGACTTTC-3' (containing the BamHI recognition sequence and homologous arm, SEQ ID NO.14).

[0054] After purification, the PCR amplification product was digested with SacI and BamHI into the plant overexpression vector pCAMBIA1300s-GFP (containing the CaMV 35S strong promoter). The digested target fragment and the linearized vector were homologously ligated using a one-step cloning ligase. The resulting ligation was performed on *E. coli* DH5α, and after confirmation by colony PCR and sequencing, the overexpression recombinant vector was obtained and named pCAMBIA1300s-OsSULTR1;3-GFP.

[0055] Obtaining recombinant Agrobacterium The pCAMBIA1300s-OsSULTR1;3-GFP plasmid was transformed into Agrobacterium EHA105 competent cells by electroporation. Positive clones were screened on YEB plates containing kanamycin and rifampin. The recombinant strain that was correctly identified by colony PCR was named EH-pCAMBIA1300s-OsSULTR1;3-GFP.

[0056] Obtaining overexpression plants Using the same Agrobacterium-mediated transformation method as in Example 2, EH-pCAMBIA1300s-OsSULTR1;3-GFP was transformed into callus tissue of rice variety Zhonghua 11. After hygromycin resistance screening, differentiation, rooting, and hardening, T0 generation overexpressing transgenic plants were obtained.

[0057] Example 6: OsSULTR1;3 Molecular identification and alkali tolerance phenotype identification of transgenic plants with overexpressed genes Molecular identification of overexpressing plants Total RNA was extracted from leaves and reverse transcribed into cDNA. The expression level of the OsSULTR1;3 gene was detected by real-time quantitative PCR (qRT-PCR) (with OsActin1 as the internal reference gene). Positive lines with significantly higher expression levels than wild-type were selected, purified through self-pollination to the T2 generation, and stable overexpression materials were obtained, named OE- OsSULTR1;3 -1 and OE- OsSULTR1;3 -3, the identification results are as follows Figure 3 As shown.

[0058] Identification of alkali tolerance phenotype in overexpression seedlings Stable overexpression material OE- OsSULTR1;3 -1、OE- OsSULTR1;3 -3 and wild-type Zhonghua 11 (WT) were used to identify the alkali tolerance of seedlings, using the same method as in Example 4.

[0059] The results of the alkali resistance test are as follows Figure 4 As shown in A and B: After 12 days of alkali stress treatment and 7 days of rehydration, the survival rate of seedlings of the overexpression line was significantly lower than that of the wild type (WT).

[0060] The above experimental results show that OsSULTR1;3 Genes negatively regulate alkali tolerance in rice; overexpression OsSULTR1;3 The gene can significantly reduce the alkali tolerance of rice, while knocking out the gene increases the alkali tolerance of rice.

[0061] The present invention has been described in detail above. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0062] The term "protein" is used interchangeably herein to mean a polymer of amino acid residues. The term applies to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues are non-naturally encoded amino acids. As used herein, the term encompasses amino acid chains of any length, including full-length proteins, wherein the amino acid residues are linked via covalent peptide bonds.

[0063] The term "conversion" refers to the method of introducing a heterologous DNA sequence into a host cell or organism.

[0064] The term "expression" refers to the transcription and / or translation of endogenous genes or transgenes in plant cells.

[0065] For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments are given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. The application of gene knockout encoding OsSULTR1;3 protein in improving alkali tolerance in rice, characterized in that, The amino acid sequence of the OsSULTR1;3 protein is shown in SEQ ID NO.

1.

2. The application of biomaterials related to the OsSULTR1;3 protein described in claim 1 in improving the alkali tolerance of rice, characterized in that, The biomaterial is any one of the following E1) to E3): E1) Target OsSULTR1;3 sgRNA expression cassette of a gene; E2) A CRISPR / Cas9 recombinant vector containing the sgRNA expression cassette described in E1); E3) contains Agrobacterium tumefaciens with the recombinant vector described in E2); The OsSULTR1;3 The CDS sequence of the gene is shown in SEQ ID NO.

2.

3. A method for cultivating rice with improved alkali tolerance, characterized in that, The method involves knocking out the gene encoding the OsSULTR1;3 protein in rice to obtain rice with improved alkali tolerance, the amino acid sequence of which is shown in SEQ ID NO.

1.

4. The method according to claim 3, characterized in that, The knockout of the gene encoding the OsSULTR1;3 protein in rice is achieved using gene knockout technology by introducing a gene containing the target gene into the rice. OsSULTR1;3 The sgRNA expression cassette of the gene was expressed via a plant expression vector.

5. The method according to claim 4, characterized in that, The plant expression vector is a recombinant vector constructed based on two target sites of the nucleic acid molecule shown in SEQ ID NO.

2. The two target sites are target site 1: CCATTGCAAGTCTCTGCATTCCC and target site 2: AAAGGATATTGCAATCGGTCCGG.

Images