Penicillium oxalicum engineering bacteria, construction method thereof and application of the bacteria in production of extracellular hydrolase

Abstract

The application discloses a penicillium oxalicum engineering bacterium, a construction method thereof and application of the engineering bacterium in production of extracellular hydrolase, and belongs to the technical field of microbial engineering. vcmR The application knocks out a gene with a nucleotide sequence shown in SEQ ID NO. 1 in a penicillium oxalicum original strain, and constructs an engineering bacterium with high yield of extracellular hydrolase. The engineering bacterium has been preserved in the China General Microbiological Culture Collection Center, and the preservation number is CGMCC No. 42649. The application further provides application of the engineering bacterium in production of extracellular hydrolase. Compared with the original strain, the growth state and the synthesis ability of extracellular hydrolase of the engineering bacterium are significantly improved, and the engineering bacterium can utilize cheap carbon sources such as corn cobs and sugarcane residues. With the increase of glucose content, the activity of the engineering bacterium and the synthesis ability of extracellular hydrolase are significantly improved. The application provides an engineering bacterium with high efficiency, glucose tolerance and cheap carbon source applicability for production of extracellular hydrolase.

Description

Technical Field

[0001] This invention relates to the field of microbial engineering technology, and in particular to an engineered Penicillium oxalate strain, its construction method, and its application in the production of extracellular hydrolases. Background Technology

[0002] Lignocellulose is a complex carbohydrate ubiquitous in plants. Filamentous fungi, represented by genera such as Trichoderma, Penicillium, and Aspergillus, are important decomposers and transformers of lignocellulose in nature. Cellulase and hemicellulase belong to the glycoside hydrolase family. Cellulase is a complex enzyme system, mainly composed of endo-β-1,4-glucanase (EG, EC 3.2.1.4), also known as endoplasminase or exoplasminase (1,4-β-cellobiohydrolase, CBH, EC 3.2.1.91), and β-D-glucosidase (BG, EC 3.2.1.21) (Trivedi N, et al. Marine Microbes as a Potential Source of Cellulolytic Enzymes. Adv Food Nutr Res. 2016;79:27-41.). Hemicellulases are complex enzyme systems, mainly including xylanases, β-mannanases, α-L-arabinofuranosidases, α-D-glucuronidases, β-xylosidases, and feruloylesterases, which work together to hydrolyze hemicellulose (Shallom D, et al. Microbialhemicellulases. Curr Opin Microbiol. 2003 Jun; 6(3):219-28.).

[0003] *Penicillium oxalate* is a filamentous ascomycete fungus that produces cellulase, which has been used in the bioethanol and feed industries (Liu G, et al. Long-term strain improvements accumulate mutations in regulatory elements responsible for hyper-production of cellulolytic enzymes. Sci Rep. 2013, 3:1569.). Further increasing the yield of cellulase synthesized by *Penicillium oxalate* is an important step in reducing the cost of cellulase production. However, in the presence of preferentially utilized sugars (usually glucose), the expression of cellulase genes is typically suppressed; this common phenomenon is called carbon catabolite repression (CCR) (Antoniêto AC, et al. Defining the genome-wide role of CRE1 during carbon catabolite repression in...). Trichoderma reesei Using RNA-Seq analysis. Fungal Genet Biol. 2014, 73:93-103.). In major cellulose-degrading fungi, such as *Trichoderma*, *Aspergillus*, *Neurospora*, and *Penicillium*, the transcription factor CreA / CRE1 (catabolite responsive element) is presumed to mediate CCR. creA / cre1 The deletion of [certain gene] can, to some extent, relieve CCR and increase the expression level of cellulase gene in glucose in the deleted strain, but the gene [is affected]. creA / cre1 The absence of [a specific ingredient] severely impairs the growth of the strain (Hu Y, et al. Carbon catabolite repression involves physical interaction of the transcription factor CRE1 / CreA and the Tup1-Cyc8 complex in [a specific location]). Penicillium oxalicum and Trichoderma reesei . Biotechnol Biofuels. 2021, 14(1):244.). Therefore, how to increase the yield of cellulase synthesized by Penicillium oxalate, relieve the carbon metabolism repression effect, and maintain the normal growth of the strain has become a technical problem that urgently needs to be solved by those skilled in the art.

[0004] In recent years, genetic modification of Penicillium oxalate strains to enhance their cellulase synthesis has been steadily progressing, leading to the discovery of several key transcription factors regulating cellulase synthesis. Enhancing the expression of positive regulatory factors or deleting the coding genes of negative regulatory factors can, to some extent, promote the transcription of cellulase-encoding genes, thereby increasing cellulase synthesis (Li Z, et al. Synergistic and Dose-Controlled Regulation of Cellulase Gene Expression in Penicillium oxalicum . PLoS Genet. 2015, 11(9):e1005509.). Although some studies have attempted to remove global carbon metabolism repressors. creA / cre1 Homologous genes can be used to relieve the inhibition of cellulase synthesis by glucose, but this method often leads to severe damage to the growth of the strain, affecting the industrial adaptability of the strain and making it difficult to apply in actual production.

[0005] Therefore, finding a method that can utilize inexpensive carbon sources such as glucose without damaging or even promoting the growth of the strain, while avoiding the expensive inducing carbon source of microcrystalline cellulose, and further increasing the yield of cellulase synthesized by Penicillium oxalate remains a technical problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0006] The purpose of this invention is to provide an engineered Penicillium oxalate strain, its construction method, and its application in the production of extracellular hydrolases, thereby solving the problems existing in the prior art. This invention achieves this by knocking out the nucleotide sequence shown in SEQ ID NO.1 in the original Penicillium oxalate strain. vcmR Genes were used to construct engineered bacteria that produce high levels of extracellular hydrolases, providing efficient, glucose-tolerant microbial resources with suitable and inexpensive carbon sources for the production of extracellular hydrolases.

[0007] VcmR protein belongs to the zinc binuclear cluster cysteine ​​type 6 transcription factor. A search revealed only one report on the function of VcmR homologs in filamentous fungi, which describes its homolog SxlR in *Trichoderma reesei* as a specific transcriptional repressor of the GH11 xylanase gene (Liu R, et al. A novel transcription factor specifically regulates GH11 xylanase genes in...). Trichoderma reesei Biotechnol Biofuels. 2017, 10:194.). The VcmR protein of *Penicillium oxalate* is similar to that of *Aspergillus* species (such as *Aspergillus nidus*). Aspergillus nidulansThe homologous protein ANIA_08177 of this protein shows high similarity (Per. Ident 45.17%). No literature reports currently available. vcmR Deleting the gene can relieve carbon metabolism repression and promote the synthesis of cellulase and hemicellulase.

[0008] To achieve the above objectives, the present invention provides the following solution: This invention provides a Penicillium oxalate ( Penicillium oxalicum The method for constructing engineered bacteria includes the step of losing or reducing the activity of the VcmR protein in the original Penicillium oxalate strain to obtain the engineered Penicillium oxalate strain. The amino acid sequence of the VcmR protein is shown in SEQ ID NO.2; The original strain of Penicillium oxalate was Penicillium oxalate CGMCC No. 5302.

[0009] Furthermore, the loss of VcmR protein activity in the original Penicillium oxalate strain is achieved by knocking out the gene encoding the VcmR protein; The encoding gene has a nucleotide sequence as shown in SEQ ID NO.1. vcmR Gene; The knockout is achieved through protoplast transformation, vcmR The gene knockout cassette was transferred into the original Penicillium oxalate strain.

[0010] Furthermore, the aforementioned vcmR Gene knockout kit includes the aforementioned vcmR Homologous arms of the gene and hygromycin phosphotransferase gene.

[0011] The present invention also provides an engineered Penicillium oxalate strain obtained according to the above-described construction method.

[0012] This invention also provides a strain of Penicillium oxalate Δ vcmR strain, the Penicillium oxalate Δ vcmR The strain was deposited on May 12, 2026 at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 42649, located at No. 3, Courtyard 1, Beichen Road, Chaoyang District, Beijing.

[0013] The present invention also provides the above-mentioned engineered Penicillium oxalate strain or the above-mentioned Penicillium oxalate Δ strain. vcmR Application of strains in the production of extracellular hydrolases.

[0014] Furthermore, the extracellular hydrolases include cellulase and hemicellulase.

[0015] The present invention also provides a method for producing extracellular hydrolases, comprising using the above-described engineered Penicillium oxalate strain or the above-described Penicillium oxalate Δ strain. vcmR The steps involve liquid fermentation of the strain, collection of the fermentation broth, and obtaining the extracellular hydrolytic enzyme.

[0016] Furthermore, the extracellular hydrolases include cellulase and hemicellulase.

[0017] Furthermore, the carbon source for the liquid fermentation includes bran and supplementary carbon sources; The supplementary carbon source is at least one selected from microcrystalline cellulose, glucose, bagasse, and corn cob.

[0018] The present invention discloses the following technical effects: This invention involves knocking out the gene encoding the VcmR protein (GenBank: EPS34484.1) in the original Penicillium oxalate strain (CGMCC No. 5302) using homologous recombination (as shown in SEQ ID NO. 1). Following this, a hygromycin resistance gene is selected using PEG-mediated protoplast transformation. hph As a selection marker for transformation, the final result was the elimination of *Penicillium oxalicum* in the genome. vcmR Mutant strain Δ vcmR After experimental measurement, Δ vcmR The growth status of the strain is better than that of the original strain, Δ vcmR The filter paper enzyme activity of the strain reached 0.57 IU / mL, which was 2.04 times that of the original strain; the highest carboxymethyl cellulase activity reached 7.08 IU / mL, which was 2.24 times that of the original strain; the highest p-nitrophenyl-β-D-glucopyranosidase activity reached 1.24 IU / mL, which was 1.68 times that of the original strain; and the highest xylanase activity reached 58.54 IU / mL, which was 2.26 times that of the original strain. The increase in these enzyme activities indicates a Δ... vcmR The strain's ability to synthesize extracellular cellulase and hemicellulase was significantly enhanced. Δ vcmR The strain produced a distinct cellulose hydrolysis zone on a cellulose phenotypic plate containing glucose, while no cellulose hydrolysis zone was observed around the original strain. Furthermore, Δ vcmR The extracellular enzyme activity of the strain showed a trend of increasing with increasing glucose content, indicating that in the presence of glucose, Δ vcmR The strain still retains the ability to secrete extracellular hydrolases. Δ vcmR The xylanase activity of the strain was higher under conditions where corn cob was used as the inexpensive carbon source than under conditions where microcrystalline cellulose was induced as the carbon source, Δ vcmR The carboxymethyl cellulase activity of the strains under both corn cob and microcrystalline cellulose carbon source conditions showed no significant difference, indicating that Δ vcmR The strain can utilize inexpensive carbon sources for the production of extracellular hydrolases. Therefore, this invention achieves this by deleting... vcmRThe genetically engineered Penicillium oxalate strain can significantly increase the activity of cellulase and hemicellulase in the presence of glucose or inexpensive carbon sources, thus effectively solving the problems of carbon metabolism repression, strain growth impairment, and dependence on microcrystalline cellulose induction in existing technologies. Attached Figure Description

[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0020] Figure 1 The Penicillium oxalate gene deletion mutant Δ in Example 1 vcmR PCR verification and reinjection of strain Re vcmR The diagrams show the PCR validation and sequencing validation results; where A represents the PCR validation design strategy, with the primers used as indicated by the arrows, and the numbers representing the sequence IDs of those primers in the sequence listing; B represents the gene deletion mutant Δ. vcmR PCR validation results of the strain, lane 1: DNA marker; lane 2: primer pair Δ vcmR -UF / hph-YZR PCR amplification of the original strain for verification upstream; Lane 3: primer pair Δ vcmR -MYZF / Δ vcmR -MYZR PCR amplification of the original strain for verification; Lane 4: Primer pair hph-YZF / Δ vcmR -DR PCR amplification of the original strain for downstream verification; Lane 5: primer pair Δ vcmR -UF / hph-YZR PCR amplification Δ vcmR Strains were validated upstream; lane 6: primer pair Δ vcmR -MYZF / Δ vcmR -MYZR PCR amplification Δ vcmR Strains were validated midway; Lane 7: Primer pair hph-YZF / Δ vcmR -DR PCR amplification Δ vcmR Strains were validated downstream; Lane 8: Primer pair vcmR -NBF / vcmR -NBR PCR amplification of the original strain for verification vcmR Inside the gene; Lane 9: Primer pair hph-YZF / Δ vcmR -DR PCR amplification Δ vcmR strain verification vcmR Internal gene; C represents the complement strain Re vcmRPCR validation results; Lane 1: DNA marker; Lane 2: Primer pair Δ vcmR -UF / ptrA-YZR PCR amplification of the original strain for verification; Lane 3: primer pair Δ vcmR -UF / ptrA-YZR PCR amplification Re vcmR Strain verification; D is primer pair Δ vcmR -UF / ptrA-YZR PCR amplification of Re vcmR The sequencing results of the strain are shown in the figure.

[0021] Figure 2 The original strain of Penicillium oxalate and Penicillium oxalate Δ in Example 1 vcmR The results of the determination of filter paper enzyme activity (indicating total cellulase activity) of the strain; Figure 3 The original strain of Penicillium oxalate and Penicillium oxalate Δ in Example 1 vcmR The results of the carboxymethyl cellulase activity (indicative endonuclease activity) assay of the strain are shown in the figure. Figure 4 The original strain of Penicillium oxalate and Penicillium oxalate Δ in Example 1 vcmR The results of the determination of p-nitrophenyl-β-D-glucopyranosidase activity (indicative β-glucopyranosidase activity) of the strain; Figure 5 The original strain of Penicillium oxalate and Penicillium oxalate Δ in Example 1 vcmR The results of the xylanase activity (indicative hemicellulase activity) assay of the strain are shown in the figure. Figure 6 The original strain of Penicillium oxalate in Example 1, and Penicillium oxalate Δ vcmR The results of the strain and the Penicillium oxalate supplemented strain producing cellulose hydrolysis zones on ball-milled cellulose plates containing different concentrations of glucose are shown in the figure. Among them, A is 0.5% ball-milled cellulose with 0% glucose; B is 0.5% ball-milled cellulose with 0.5% glucose; C is 0.5% ball-milled cellulose with 1% glucose; and D is 0.5% ball-milled cellulose with 2% glucose. Figure 7 The original strain of Penicillium oxalate and Penicillium oxalate Δ in Example 1 vcmR The results of the determination of filter paper enzyme activity (indicating total cellulase activity) of the strain under the addition of different concentrations of glucose are shown in the figure. Figure 8 The original strain of Penicillium oxalate and Penicillium oxalate Δ in Example 1 vcmR The results of measuring the carboxymethyl cellulase activity (indicative endonuclease activity) of the strain under different concentrations of glucose were shown in the figure. Figure 9 The original strain of Penicillium oxalate and Penicillium oxalate Δ in Example 1 vcmR The results of measuring the p-nitrophenyl-β-D-glucopyranosidase activity (indicative β-glucopyranosidase activity) of the strain under different concentrations of glucose addition; Figure 10 The original strain of Penicillium oxalate and Penicillium oxalate Δ in Example 1 vcmR The results of xylanase activity (indicative hemicellulase activity) determination of the strain under different concentrations of glucose addition; Figure 11 The oxalic acid penicillin Δ in Example 1 vcmR Observation of colony morphology of the strain on potato dextrose agar medium; Figure 12 The original strain of Penicillium oxalate and Penicillium oxalate Δ in Example 2 vcmR The results of the determination of filter paper enzyme activity (indicating total cellulase activity) of the strain under different carbon sources are shown in the figure. Figure 13 The original strain of Penicillium oxalate and Penicillium oxalate Δ in Example 2 vcmR Figure showing the results of carboxymethyl cellulase activity (indicative endonuclease activity) determination of strains under different carbon sources; Figure 14 The original strain of Penicillium oxalate and Penicillium oxalate Δ in Example 2 vcmR The results of xylanase activity (indicating hemicellulase activity) determination of the strain under different carbon sources are shown in the figure. Detailed Implementation

[0022] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0023] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0024] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0025] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0026] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0027] In this invention, the knocked-out vcmR The nucleotide sequence of the gene is shown in SEQ ID NO.1. The gene is 2998 bp in length and contains three introns located at nucleotides 32-93, 920-1012, and 1896-1963, respectively. vcmR The full-length coding region of the gene is 2775 bp, encoding a protein with the amino acid sequence shown in SEQ ID NO.2 (UniProt: S7ZVN6; GenBank: EPS34484.1), which is 924 amino acids long.

[0028] SEQ ID NO.1:

[0029] SEQ ID NO.2: MSGYHAGPFGHSGDNPYQLPPPRTPANLQYGPDPFLRQRDSERSDLVREAVPADAASVRQPNEPLPSVRSLLTPTTGPGSPPAFRQPRYGIQTPAESHRDMGYPFRPQETVFPPLQMGTLDRRRSESLPHSQPTSLPPLSHVAMGGSAEVDHHHHTTRSDPSTAKSSHAHLSPRNNSHSELMPSAEISSPESVTRANAPAVLPHVVDERYIDGELCFVYADGSHQPKIVDGKPVNPNWGVTKAGKPRKRLAQACLTCREKKIKCQPNRPKCDQCQKSGRECRFENALRGNRPRGSHSVGPSGNATSEIIGAVYDITRASDSGASLPGSGHSPISESVGLTPSGIEITHDPMLDAERAYRQRAYRIPRPFEEDSHIRHTTYPETNRLPEYQEILGEMRDTGPDDPLLASWNVDPFDHDPEMTLHYVDTFFTYVNDGLYHIFPHARFILWLKSCNTKSQEDKMVLYSMMALGSIFSDRPDKVSALRRYSRIARFAIQRSQHNLCLQLVQSHLLMGLLYYAAGSLVAAWDAVGSAGRAVSGLRFNIESGGVIVGQNQPCEYGLHPQALIECRRRTFWVAFILDRISSLFSVPSTTIPSESALIRLPCREDIYEAQQYATAPYFQNILNQASRFSEDDRHSLSPMAFVIQILSIWGDVSFQTLRLSHAPTECWLQLAEDFHTEIIQRTDDWINQLPEHLTFSVANMERASQAKKVDAFVGIHMFYHATLMKLYRHARYQSLRPEALARHIHRARYHAVEILRIALAVVQYAHDVQASRSTSDSSSAHGTLLGPFLAHVVVSAVDVLSAGGMVTELPDCISFTNGAYGMVQLLGHHWESSICLANLIKKRLDAMIDCANDRSRNQEKICFAVDGPSLETRIPTGTPSPPQGTLDEDLFYGALPRDVLLKAMRGDDTLSADKNIAWFNDQ。

[0030] Last time I saw a bunch of people in the country: Δ vcmR -UF:CTCGTCCTCTGGTCTTCTCAA,SEQ ID NO. Δ vcmR -CATCH:CTTCAATATCAGTTAACGTCGGGTCGGCGGTGTAAAGGAAATC,SEQ ID NO. Δ vcmR -DF:CGTCACCAGCCCCTGGGTTGTGCCCCTTTGCCCCCCCTCCTC,SEQ ID NO. Δ vcmR -DR:TCCTCCACGGTCATTCCTC,SEQ ID NO.6. hph-F:CGACGTTAACTGATATTGAAGG,SEQ ID NO. hph-R:CAACCCAGGGGCTGGTGACG,SEQ ID NO. hph-YZF:CCTGCCAACCCTAGTACGCCC,SEQ ID NO. hph-YZR:GTTATCGTGCACCAAGCAGCAG,SEQ ID NO. Δ vcmR -CSF:CATTACCGTTGTCAATCTCCA,SEQ ID NO. Δ vcmR -CSR:GTCTCCTGCTGTTCATCTTGC,SEQ ID NO.12; Δ vcmR -MYZF:AATCTCCCCCTTCCTCCAC,SEQ ID NO. Δ vcmR -MYZR:AAATGAAGACCTGCTCGCTC,SEQ ID NO vcmR -NBF:TCCGAGTCTCTACCGCACTC,SEQ ID NO.15; vcmR -NBR:GATGCTCCACTGTCCGATGC,SEQ ID NO.16; ReVcmR_UR: GGGATCCCGTAATCAATTGCCCCCCATCTATTCATCGCAAGGCC, SEQ ID NO.17; ptrA-F: GGGCAATTGATTACGGGATCCC, SEQ ID NO.18; ptrA-R:ATGGGGTGACGATGAGCCGC, SEQ ID NO.19; ReVcmR-DF: GCGGCTCATCGTCACCCATATGACGGGGGCTTGTACATTTG, SEQ ID NO. 20; ptrA-YZR: AGAGGGCTAATCGAGGAGTG, SEQ ID NO. 21.

[0031] Example 1 1. Experimental Materials 1.1 Original strain The original strain of Penicillium oxalate used in this invention was deposited at the China General Microbiological Culture Collection Center (CGMCC) on September 28, 2011, with accession number CGMCC No. 5302, and has been published in the paper "Yang Tiantian. Optimization and application of cellulase system for the preparation of nanocellulose [D]. Shandong University, 2020."

[0032] 1.2 Reagents, Culture Media and Experimental Solutions Reagents: Phanta Max Super-Fidelity DNA Polymerase and 2×TaqMaster Mix from Nanjing Novizan Biotechnology Co., Ltd.; Lyticase from Arthrobacter luteus from SIGMA Biotechnology Co., Ltd.; Plasmid Extraction and Agarose Gel Recovery Kit from OMEGA Biotechnology Co., Ltd.; Goldview™ Nucleic Acid Dye from Dingguo Changsheng Biotechnology Co., Ltd.

[0033] Culture medium: Wheat bran culture medium (1000 mL): 100.0 g of wheat bran, boiled in water for 30 min, filtered through eight layers of gauze to collect the filtrate, brought to a final volume of 1000 mL, dispensed, added 2 wt% agar powder, and autoclaved at 121℃ for 30 min.

[0034] Transformation medium (1000 mL): 20.0 mL of 50× Vogel's salt, 20.0 g of glucose, 182.0 g of sorbitol, bring to a final volume of 1000 mL, dispense, add 1 wt% agarose, and autoclave at 115℃ for 30 min.

[0035] Transformation medium (1000 mL): 182.0 g of sorbitol, brought to a final volume of 1000 mL, dispensed, 1.5 wt% agarose added, and autoclaved at 115°C for 30 min.

[0036] Single-spore culture medium (1000 mL): 20.0 mL of 50× Vogel's salt and 20.0 g of glucose, bring the volume to 1000 mL, dispense, add 0.5 wt‰ Triton X-100 and 1.5 wt% agar powder, and autoclave at 115℃ for 30 min.

[0037] Fermentation medium: 1× Mandel's salt, 1 wt% wheat bran and 1 wt% microcrystalline cellulose or 1 wt% glucose or 1 wt% bagasse or 1 wt% corn cob as carbon source, autoclaved at 115℃ for 30 min.

[0038] VMMG medium: 2 wt% 50×Vogel's salt, 2 wt% glucose, autoclaved at 115℃ for 30 min, then add 1 wt% agarose to make VMMG solid medium.

[0039] Experimental solution: Trace element stock solution: 5.0 g citric acid, 5.0 g ZnSO4·7H2O, 1.0 g Fe(NH4)2(SO4)2·6H2O, 0.25 g CuSO4·5H2O, 0.05 g MnSO4·H2O, 0.05 g H3BO3, 0.05 g Na2MoO4·2H2O, diluted to 100 mL with deionized water, stored at 4℃.

[0040] 50× Vogel's salt: Na3Citrate·2H2O (sodium citrate dihydrate) 125.0 g, KH2PO4 250.0 g, NH4NO3 100.0 g, MgSO4·7H2O 10.0 g, CaCl2·2H2O 5.0 g, biotin 0.25 mg, trace element stock solution 5 mL, dilute to 1000 mL with deionized water, store at 4℃.

[0041] 10× Mandel's salt: KH2PO4 30.0 g, NaNO3 26.0 g, MgSO4·7H2O 5.0 g, anhydrous CaCl2 5.0 g, peptone 10.0 g, urea 5.0 g, FeSO4·7H2O 75.0 mg, MnSO4·H2O 25.0 mg, ZnSO4·7H2O 36.0 mg, CoCl2·6H2O 37.0 mg, bring to a final volume of 1000 mL with deionized water, store at 4℃.

[0042] Tris-HCl (1 M, pH=7.5): 121.0 g Tris, bring the volume to 1000 mL with deionized water, adjust the pH to 7.5 with hydrochloric acid, autoclave at 121°C for 30 min, and store at 4°C.

[0043] Conversion solution S1: KH2PO4 2.72 g, sorbitol 43.72 g, deionized water to a final volume of 200 mL, pH adjusted to 5.6 with NaOH, autoclaved at 121℃ for 30 min, and stored at room temperature.

[0044] Conversion solution S2: 9.11 g sorbitol, 0.368 g anhydrous CaCl2, 0.5 mL Tris-HCl (1M, pH=7.5), and deionized water to a final volume of 50 mL. Autoclave at 121℃ for 30 min and store at room temperature.

[0045] Conversion solution T1: PEG6000 25.0 g, anhydrous CaCl2 0.555 g, Tris-HCl (1M, pH=7.5) 1 mL, deionized water to a final volume of 100 mL, autoclave at 121℃ for 30 min, and store at room temperature.

[0046] Spore dilution: 0.9% NaCl, 0.05% Tween 80, autoclaved at 121℃ for 30 min, stored at room temperature.

[0047] Genomic extraction buffer: 0.2 M Tris-HCl (pH=8.5), 0.25 M NaCl, 0.025 M Na2EDTA·2H2O, 2% SDS, and deionized water to a final volume of 1000 mL.

[0048] 7.5 M ammonium acetate: 578.12 g ammonium acetate, diluted to 1000 mL with deionized water.

[0049] Preparation of DNS reagent: Weigh 10 g of 3,5-dinitrosalicylic acid and dissolve it in 300 mL of deionized water. Gradually add 10 g of sodium hydroxide and dissolve in a 50°C water bath to obtain solution A. Weigh 200 g of potassium sodium tartrate and dissolve it in 400 mL of deionized water. Add 2 g of redistilled phenol and 5 g of anhydrous sodium sulfite. After complete dissolution, mix with solution A and bring the volume to 1000 mL. Store in a brown bottle and let stand for 7 days before use.

[0050] 1.3 Experimental Apparatus PCR instrument (BIO-GENER); high-speed refrigerated centrifuge (Eppendorf); agarose gel UV imaging system (MajorScience); stacked shaking incubator (Minquan); ultra-micro spectrophotometer (Quawell); heated magnetic stirrer (EMS-9A); electric thermostatic water bath (DK-8D); pH meter (Sartorius); electrophoresis apparatus (DYY-11B); microplate spectrophotometer (BioTeK); autoclave (Deqiang Instruments); circulating water multi-purpose vacuum pump (Tuohe Electromechanical Technology), etc.

[0051] 2. Experimental Methods 2.1 vcmR Construction of gene knockout cassettes and complementation expression cassettes 2.1.1 Using fusion PCR, a method was constructed based on the original Penicillium oxalate strain. vcmR Gene knockout box Using primer pair Δ vcmR -UF / Δ vcmR -UR amplification vcmR Upstream homologous arm of the gene; using primer pair Δ vcmR -DF / Δ vcmR -DR amplification vcmR Downstream homologous arms of the gene; amplification of the hygromycin resistance gene from the template of plasmid pSilent1 using primer pair hph-F / hph-R. hph As a marker gene.

[0052] Upstream homologous arm, hph The gene and downstream homologous arm were fused via overlap PCR, followed by the use of nested primer pairs Δ. vcmR -CSF / Δ vcmR -CSR is amplified to obtain vcmR Gene knockout box.

[0053] 2.1.2 Using fusion PCR, a method was constructed based on the original Penicillium oxalate strain. vcmR Gene complementation expression cassette Using primer pair Δ vcmR -UF / Re vcmR-UR amplifies the upstream homologous arm; uses primer pair Re vcmR -DF / Δ vcmR -DR amplification of downstream homologous arms; amplification of the pyridine thiamine resistance gene from the template of plasmid pM2892 using primer pair ptrA-F / ptrA-R. ptrA As a marker gene.

[0054] Upstream homologous arm, ptrA The gene and downstream homologous arm were fused via overlap PCR, followed by the use of nested primer pairs Δ. vcmR -CSF / Δ vcmR -CSR is amplified to obtain vcmR Gene complementation expression cassette.

[0055] 2.2 Preparation and transformation of protoplasts vcmR Gene knockout mutants and vcmR Isolation and purification of gene-complement strains 2.2.1 Protoplast Preparation Pour the bran culture medium into an appropriate amount of agar plates. After it solidifies, cover it with cellophane. Add 100 µL (1×10⁻⁶) of the medium. 7 (pcs / mL) Penicillium oxalate original strain or vcmR Fresh spore suspensions of the gene knockout strain were evenly spread on cellophane and incubated in a 30°C incubator for 10 h.

[0056] The lyase was dissolved in conversion solution S1 to a final concentration of 25 U to prepare protoplast lysis buffer.

[0057] Place cellophane sheets sequentially into new plates. Add 3 mL of protoplast lysis buffer to each cellophane sheet and incubate at 30°C for 30 min for lysis.

[0058] Gently scrape off the mycelia from the cellophane with tweezers, then rinse the culture in another plate containing S1, and finally mix it by gently pipetting with the tip of a pipette. Filter the mixed culture through a funnel lined with four layers of lens paper. Centrifuge at 2500 rpm for 10 min at 4°C, discard the supernatant, add 5 mL of conversion buffer S2, and mix by pipetting.

[0059] Repeat the centrifugation once, discard some of the supernatant, and retain 200 µL for resuspending the protoplasts. Then, observe the protoplast concentration and mass under a microscope.

[0060] 2.2.2 Protoplast Transformation Transformation system: 200 µL of protoplasts were added to 12 µL of a solution with a concentration of 100 ng / µL. vcmR Add 60 µL of transformation buffer T1 to the gene knockout cassette or complementation expression cassette, mix well by pipetting, and incubate on ice for 20 min.

[0061] Add 2 mL of conversion buffer T1, mix well by pipetting, let stand at room temperature for 5 min, and then add 4 mL of conversion buffer S2 to terminate the conversion.

[0062] Pour the lower layer of the conversion medium into a plate and let it cool and solidify in advance.

[0063] Add the transformation system to 30 mL of the melted upper transformation layer, mix well, and add 150 µg / mL hygromycin or 0.5 µg / mL pyrithioneamine. Mix well and pour onto the plate containing the solidified lower transformation layer culture medium from the previous step. After solidification, incubate at 30°C until transformants grow.

[0064] 2.2.3 Isolation and purification of knockout mutants or replacement strains Circle the transformant colonies with a pen, count them, and then take the same number of 1.5 mL centrifuge tubes, adding 200 µL of physiological saline to each tube.

[0065] Dip the inoculation loop into the spore dilution solution to form a water film, gently apply it to the colony spores, and then put it back into the centrifuge tube and shake to mix.

[0066] Use an inoculation loop to pick up the mixed spore suspension, streak it on a single spore culture medium containing hygromycin or pyrithionein antibiotic for isolation and purification, and then place it in a 30°C incubator for static culture.

[0067] 50 µL of spore suspension was transferred to 600 µL of VMMG and cultured on a shaker at 30°C and 200 rpm for 12 h. After mycelial growth, the genome was extracted for verification. vcmR Whether the gene has been completely deleted and whether the reintroduced strain has been correctly reintroduced.

[0068] The genome extraction method is as follows: Inoculate 50 µL of spore suspension into a 1.5 mL centrifuge tube containing 600 μL of VMMG, and incubate at 30°C and 200 rpm for 12 h until spore germination and mycelium is visible to the naked eye.

[0069] Centrifuge, remove the supernatant culture medium, add 500 μL of extraction buffer and a small amount of quartz sand, homogenize vigorously at speed 7 for 1 min, and then place in a 65℃ water bath for 10 min.

[0070] Then add 200 μL of 7.5 M ammonium acetate, mix by inversion, and incubate on ice for 10 min.

[0071] After a white precipitate forms, centrifuge at 12,000 rpm for 10 min at 4°C. Transfer the supernatant to a new centrifuge tube, add 350 μL of isopropanol, invert to mix, and place in a -20°C freezer for 10 min.

[0072] Centrifuge at 12,000 rpm for 10 min at 4℃, discard the supernatant, wash the precipitate once with 1 mL of 75% ethanol, centrifuge at 10,000 rpm for 3 min and discard the supernatant, air dry and add 20 μL of purified water to dissolve the genome.

[0073] The PCR verification method is as follows: PCR validation design strategies such as Figure 1 As shown in Figure A, the 2×Rapid Taq MasterMix DNA polymerase kit from Novizan Pharmaceuticals (Nanjing) was selected. Figure 1 The primer pairs labeled are for the original strain of Penicillium oxalate, vcmR Gene knockout mutants and vcmR Transformants from the gene-complemented strain were validated by PCR, and the complementation was verified by sequencing. vcmR The gene sequence is correct and there are no mutations.

[0074] 2.3 Extracellular cellulase activity assay: The original strain of Penicillium oxalate and Δ vcmR The extracellular cellulase activity was measured by inoculating 1 mL (1×10⁻⁶) of the solution. 7 A fresh spore suspension (number of spores / mL) was added to 100 mL of VMMG liquid medium and incubated at 30°C and 200 rpm for 24 h. Mycelia were then vacuum filtered, and 0.3 g of the filtered mycelia were transferred to 50 mL of fermentation medium and fermented at 30°C and 200 rpm. Fermentation broth was collected at different time points. After centrifugation at 8000 rpm for 3 min, the supernatant was used as the enzyme solution, and the activities of various enzymes in the enzyme solution were measured.

[0075] The filter paper activity (FPA) assay method is as follows: Add 50 mg of Whatman No. 1 filter paper to an enzyme-labeled tube. Add 1.5 mL of acetate-sodium acetate buffer (pH 4.8), then add 500 μL of diluted enzyme solution and react at 50°C for 1 h. Measure enzyme activity using the DNS method. After the reaction, add 3 mL of DNS, followed by an equal volume of enzyme solution to the control. Boil in a water bath for 10 min, then cool in ice water. Add 20 mL of distilled water to bring the volume to 25 mL. Mix well and take 200 μL to an enzyme-labeled tube to measure OD. 540 reading.

[0076] The method for determining endonuclease activity was as follows: 1.5 mL of 1 wt% sodium carboxymethyl cellulose (CMC-Na) was added to an enzyme-labeled tube as a substrate, and 500 μL of diluted enzyme solution was added to the experimental group. The reaction was carried out at 50℃ for 30 min. Enzyme activity was determined by the DNS method.

[0077] The method for measuring β-glucosidase activity is as follows: Add 1 mg / mL of p-nitrophenyl-β-D-glucopyranoside to a 1.5 mL centrifuge tube. p 50 μL of NPG was used as the substrate. In the experimental group, 100 μL of enzyme solution diluted 200-fold was added, and the reaction was carried out at 50℃ for 30 min. 150 μL of 10 wt% Na₂CO₃ was added to terminate the reaction. After mixing, 200 μL was transferred to a microplate tube to measure the OD. 420 .

[0078] One enzyme activity unit is defined as the amount of enzyme that can convert 1 μmol of substrate within 1 minute under the test conditions.

[0079] 2.4 Extracellular hemicellulase activity assay: Xylanase activity assay: Using 1.5 mL of 1% xylan solution as substrate, 500 μL of diluted enzyme solution was added to the experimental group simultaneously. After thorough mixing, the mixture was reacted in a constant temperature water bath at 50℃ for 30 min. Enzyme activity was determined by DNS method.

[0080] One enzyme activity unit is defined as the amount of enzyme that can convert 1 μmol of substrate within 1 minute under the test conditions.

[0081] 2.5 Anti-glucose repression plate test: Prepare ball-milled cellulose phenotypic upper layer culture media containing 0%, 0.5%, 1%, and 2% glucose, respectively. First, pour a certain amount of phenotypic lower layer culture medium into a plate and let it solidify. Then, add 5 mL of phenotypic upper layer culture medium on top and let it solidify again. Add 1×10⁻⁶ g of phloroglucinol to each layer. 7 Penicillium oxalate Δ per mL vcmR Fresh spore suspensions of the strain, the replenished strain, and the original strain were spotted onto the phenotypic supernatant culture medium and incubated at 30°C for 4 days.

[0082] 3. Results 3.1 Gene deletion mutant strain Δ vcmR PCR verification and reinjection of strain Re vcmR PCR and sequencing verification like Figure 1 As shown in Figure B, PCR was used to target Δ vcmR The results of strain validation showed that vcmR Genes in strain Δ vcmR Complete deletion was achieved; such as Figure 1 Figures C and D show the use of PCR and sequencing to target Re. vcmR The results of strain validation showed that vcmR Genes in strain Δ vcmR The correct replenishment was obtained.

[0083] 3.2 Results of extracellular cellulose and xylanase activity assays like Figure 2 As shown, Penicillium oxalate Δ vcmR The filter paper enzyme (FPase) activity (indicating total cellulase activity) of the strain reached 0.57 IU / mL, which is 2.04 times that of the original strain (0.28 IU / mL); like Figure 3 As shown, Penicillium oxalate Δ vcmR The highest carboxymethyl cellulase (CMCase) activity (indicative endonuclease activity) of the strain reached 7.08 IU / mL, which is 2.24 times that of the original strain (3.16 IU / mL); like Figure 4 As shown, Penicillium oxalate Δ vcmR The highest p-nitrophenyl-β-D-glucopyranosidase in the strain ( p The NPGase activity (indicating β-glucosidase activity) reached 1.24 IU / mL, which is 1.68 times that of the original strain (0.74 IU / mL); like Figure 5 As shown, Penicillium oxalate Δ vcmR The highest xylanase activity (indicating hemicellulase activity) of the strain reached 58.54 IU / mL, which is 2.26 times that of the original strain (25.91 IU / mL).

[0084] The increased enzyme activity shown above indicates that Penicillium oxalate Δ vcmR The strain's ability to synthesize extracellular cellulase and hemicellulase was significantly enhanced.

[0085] 3.3 Anti-glucose inhibition effect like Figure 6 As shown, Penicillium oxalate Δ vcmR The strains produced distinct cellulose hydrolysis zones on cellulose phenotypic plates containing different amounts of glucose, while no cellulose hydrolysis zones were observed around the original strain and the replenished strain, indicating that Δ... vcmR The strain still retains the ability to secrete cellulase.

[0086] In addition, such as Figures 7-10 As shown, the filter paper enzyme (FPase), carboxymethyl cellulase (CMCase), and p-nitrophenyl-β-D-glucopyranosidase (P-FPase) activities of the original Penicillium oxalate strain were... p The activities of NPGase and xylanase both showed a decreasing trend with increasing glucose content, exhibiting typical glucose repression. Meanwhile, *Penicillium oxalate* Δ... vcmRThe enzyme production capacity of the strain in fermentation media containing different amounts of glucose was superior to that of the original strain. Overall, Δ vcmR The activities of the four enzymes in the strain showed a trend of increasing with increasing glucose content.

[0087] like Figure 11 As shown, when Penicillium oxalate Δ vcmR The strain was cultured on potato dextrose agar (PDA) medium at 30°C. Initially, the colonies were white. After 2 days of culture, green spores appeared on the surface of the mycelium. After another 2 days of culture, the colonies turned green.

[0088] The present invention of Penicillium oxalate ( Penicillium oxalicum ) Δ vcmR The strain was deposited on May 12, 2026 at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen Road, Chaoyang District, Beijing, with accession number CGMCC No. 42649.

[0089] Example 2 Replace the microcrystalline cellulose in the fermentation medium, which is the inducing carbon source, with an inexpensive carbon source such as glucose, sugarcane bagasse, or corn cob. This will influence the performance of the original Penicillium oxalate strain and Δ... vcmR The extracellular enzyme activity of the strain was measured (the measurement method is the same as in Example 1).

[0090] Figures 12-14 As shown, the original Penicillium oxalate strain only exhibited high extracellular enzyme activity under conditions induced by the carbon source microcrystalline cellulose, Δ vcmR The strain exhibited relatively high enzyme activity with sugarcane bagasse as the carbon source, and its xylanase activity was superior to that under microcrystalline cellulose conditions with corn cob as the carbon source. Figure 14 Furthermore, under corn cob conditions, Δ vcmR The carboxymethyl cellulase activity of the strain was not significantly different compared with that under microcrystalline cellulose conditions. Figure 13 ).

[0091] The results show that Δ vcmR The strain can use inexpensive carbon source corn cob to replace the induction carbon source microcrystalline cellulose.

[0092] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A type of Penicillium oxalate ( Penicillium oxalicum The method for constructing engineered bacteria is characterized by, The process includes the step of losing or reducing the activity of the VcmR protein in the original Penicillium oxalate strain to obtain the engineered Penicillium oxalate strain. The amino acid sequence of the VcmR protein is shown in SEQ ID NO.2; The original strain of Penicillium oxalate was Penicillium oxalate CGMCC No. 5302.

2. The construction method according to claim 1, characterized in that, The loss or reduction of VcmR protein activity in the original Penicillium oxalate strain is achieved by knocking out the gene encoding the VcmR protein. The encoding gene has a nucleotide sequence as shown in SEQ ID NO.

1. vcmR Gene; The knockout is achieved through protoplast transformation, vcmR The gene knockout cassette was transferred into the original Penicillium oxalate strain.

3. The construction method according to claim 2, characterized in that, The vcmR Gene knockout kit includes the aforementioned vcmR Homologous arms of the gene and hygromycin phosphotransferase gene.

4. An engineered Penicillium oxalate strain obtained by the construction method according to any one of claims 1-3.

5. A strain of Penicillium oxalate Δ vcmR The strain is characterized by, The oxalic acid penicillin Δ vcmR The strain was deposited on May 12, 2026 at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 42649, located at No. 3, Courtyard 1, Beichen Road, Chaoyang District, Beijing.

6. An engineered Penicillium oxalate strain according to claim 4 or the Penicillium oxalate Δ strain according to claim 5. vcmR Application of strains in the production of extracellular hydrolases.

7. The application according to claim 6, characterized in that, The extracellular hydrolases include cellulase and hemicellulase.

8. A method for producing extracellular hydrolases, characterized in that, Includes the use of the engineered Penicillium oxalate strain as described in claim 4 or the Penicillium oxalate Δ strain as described in claim 5. vcmR The steps involve liquid fermentation of the strain, collection of the fermentation broth, and obtaining the extracellular hydrolytic enzyme.

9. The method according to claim 8, characterized in that, The extracellular hydrolases include cellulase and hemicellulase.

10. The method according to claim 8, characterized in that, The carbon source for the liquid fermentation includes bran and supplementary carbon sources; The supplementary carbon source is at least one selected from microcrystalline cellulose, glucose, bagasse, and corn cob.

Images