A gender identification molecular marker based on specific sequence of Y chromosome of largemouth bass, primer pair, gender identification method and application

CN122686804APending Publication Date: 2026-09-04GUANGZHOU HUAXUAN AQUATIC PRODUCTS CO LTD +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202611110832.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-07-24
Publication Date
2026-09-04

AI Technical Summary

Technical Problem

[0005]第一,现有GWAS研究鉴定的性别关联标记多基于SNP位点设计,分型方法复杂

Benefits of technology

[0029]1) This invention uses conventional PCR combined with agarose gel electrophoresis detection. The judgment criteria are simple and clear. Only one 197bp band is needed to determine whether the sex is male or female. No complicated genotyping analysis is required. Sex determination is more intuitive and easy to operate. It is better suited for large-scale sex identification in grassroots breeding farms and large-scale seedling production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122686804A_ABST
    Figure CN122686804A_ABST
Patent Text Reader

Abstract

The application discloses a gender identification molecular marker based on a specific sequence of a Y chromosome of a large-mouth bass, a primer pair, a gender identification method and application, and relates to the technical field of gender identification of the large-mouth bass. Based on second-generation sequencing and third-generation sequencing technology, the application compares and analyzes sequencing results of male and female individuals by using a whole genome association analysis method, identifies a sex chromosome and a male-female difference region, screens and determines a molecular marker sequence, such as SEQ ID NO:1, and then designs primers according to the screened molecular marker sequence, such as SEQ ID NO:2 and SEQ ID NO:3. The gender of the large-mouth bass can be identified by using PCR amplification and agarose gel electrophoresis. The scheme has the advantages of fast screening of markers, strong specificity, simple primer composition, strong universality and more intuitive identification of the gender of the large-mouth bass.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a molecular marker, primer pair, and method and application for sex identification based on a Y chromosome-specific sequence of largemouth bass. Background Technology

[0002] Largemouth bass (Micropterus salmoides) belongs to the family Strophariaceae in the order Perciformes and is an important freshwater aquaculture fish in my country. This species exhibits significant sexual dimorphism, with males growing faster than females. Furthermore, females are weakened after spawning and more susceptible to pathogens, leading to increased mortality. Therefore, accurately identifying the genetic sex of the largemouth bass is crucial for sex-controlled breeding and fry production.

[0003] The sex determination mechanism of largemouth bass belongs to the XX / XY system. With the development of high-throughput sequencing technology, genome-wide association analysis (GWAS) has become a powerful tool for locating sex-determining regions and developing sex identification markers. In recent years, several research teams have located sex-linked regions and developed corresponding molecular markers based on resequencing data. For example, He et al. (2022) located a sex-linked region of about 260kb on chromosome 10 and obtained a large number of sex-dimorphic SNPs and InDels. Jimei University and the Pearl River Fisheries Research Institute, among other institutions, have also published sex identification markers based on Y chromosome-specific sequences or SNP sites. Recently, the Zhejiang Freshwater Fisheries Research Institute constructed telomere-to-telomere (T2T) gapless genomes of male and female largemouth bass (871.07 Mb for females and 873.86 Mb for males, with 99.3% BUSCO integrity), filling thousands of sequence gaps on the 23 chromosomes of the existing reference genome. Based on comparative analysis of the male and female T2T genomes, a 90 kb Y chromosome-specific structural variation enrichment region (SVER-Y region) was identified. This region has a significantly enriched transposon element content, providing an important sequence basis for the development of sex identification markers.

[0004] However, existing technologies still have the following shortcomings:

[0005] First, existing GWAS studies have identified sex-associated markers based on SNP loci, which involve complex genotyping methods. While SNP-based markers can distinguish between XX and XY individuals, SNP genotyping often requires complex methods such as sequencing or TaqMan probes, which demand sophisticated equipment, are cumbersome to operate, and are costly, making them difficult to promote and apply in grassroots breeding farms and large-scale seedling production.

[0006] Second, there is still room for improvement in the localization accuracy and sequence integrity of existing sex-determining regions. Significant differences exist in the sex-linked regions located across different studies, and sequence gaps and assembly errors exist in the assembly of non-T2T genomes, potentially affecting the specificity and stability of marker design. Although the latest T2T genome has identified the SVER-Y region, this region contains numerous repetitive sequences and transposon elements, meaning there are multiple possible differentially identified sites. Developing more sex identification markers targeting different differentially identified sites will provide more options for various application scenarios and can further improve the accuracy and reliability of identification through multi-marker combinations.

[0007] Third, existing markers are mostly developed based on data from a single sequencing platform, lacking cross-validation with data from multiple platforms. The development of some markers relies solely on second-generation sequencing resequencing data, which has limited ability to resolve complex genomic regions such as structural variations, making it difficult to effectively capture large Y chromosome-specific sequences. While third-generation sequencing can traverse complex repetitive regions, sex identification markers for largemouth bass developed based on third-generation sequencing data are still relatively scarce.

[0008] Fourth, while existing methods based on conventional PCR combined with agarose gel electrophoresis are simple to operate, there is still room for improvement in primer design specificity and amplification efficiency. The applicability and stability of some markers in different geographical populations require further validation.

[0009] Therefore, it is of great importance to provide a novel molecular marker for sex identification based on the chromosome-specific DNA sequence of the largemouth bass and its amplification primers, so as to enrich existing marker resources and improve identification accuracy through multi-marker joint determination. Summary of the Invention

[0010] To address the aforementioned problems, this invention provides a molecular marker, primer pair, and method for sex identification based on a Y chromosome-specific sequence of largemouth bass, along with its applications. This invention utilizes second-generation sequencing and third-generation sequencing technologies, employing genome-wide association analysis (GWAS) to compare and analyze the sequencing results of male and female individuals. It identifies sex chromosomes and sex-difference regions, screens for differentially expressed sequences between male and female samples, and designs amplification primers based on the specific DNA sequence. The molecular marker of this invention is an X chromosome-specific DNA sequence. Primer pairs designed based on this sequence can amplify specific bands in female largemouth bass individuals, while producing no amplification product in male individuals. This allows for a simple, rapid, and accurate identification of the genetic sex of largemouth bass, providing more technical options for sex-controlled breeding and seedling production.

[0011] The technical solution of this invention mainly includes the following:

[0012] I. This invention provides a specific molecular marker for identifying the sex of largemouth bass. The nucleotide sequence of the molecular marker is shown in SEQ ID NO:1, which is a Y chromosome-specific sequence of male largemouth bass.

[0013] II. The present invention provides a primer pair for identifying the sex of largemouth bass. The primer pair is designed for gene fragments targeting the above-mentioned specific molecular markers and includes a forward primer and a reverse primer. The nucleotide sequence of the forward primer is shown in SEQ ID NO:2, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO:3.

[0014] The aforementioned primer pair for identifying the sex of largemouth bass, wherein the nucleotide sequence of the gene fragment amplified by the primer pair is shown in SEQ ID NO:4.

[0015] III. This invention provides a method for preparing a specific molecular marker for identifying the sex of largemouth bass, specifically: extracting DNA from several largemouth bass muscle tissue samples of known sex, performing second-generation sequencing and / or third-generation sequencing on the extracted largemouth bass DNA, and then performing genome-wide association analysis to screen out the differential regions of the male and female genomes, and confirming the specific nucleotide sequence of the differential region in the results of third-generation sequencing; the sequence shown in SEQ ID NO:1 is the specific molecular marker for identifying the sex of largemouth bass.

[0016] The aforementioned method for preparing specific molecular markers for identifying the sex of largemouth bass involves a combination of second-generation sequencing and third-generation sequencing analysis, and specifically includes the following steps:

[0017] S1: DNA extraction: Extract DNA from several largemouth bass muscle tissues of known sex and divide the extracted DNA samples into two parts, with the male-to-female ratio in each part being 1:1.

[0018] S2: Next-generation sequencing: Perform next-generation sequencing on a portion of the largemouth bass DNA sample from step S1.

[0019] S3: Genome-wide association analysis: Genome-wide association analysis is performed on the second-generation sequencing results in step S2 to screen out regions of difference between male and female genomes;

[0020] S4: Third-generation sequencing: Based on the differential regions screened in step S3, the other part of the largemouth bass DNA sample in step S1 is subjected to third-generation sequencing.

[0021] S5: Screening for molecular markers: Based on the results of the third-generation sequencing in step S4, screen for nucleotide sequences of specific molecular markers, as shown in SEQ ID NO:1.

[0022] As a preferred technical solution, the second-generation sequencing uses the DBQSEQ-T7 sequencing platform, with an average sequencing data of 18Gb per sample, an average sequencing depth of 20.57×, and a sequencing strategy of Pair-End 150bp; the third-generation sequencing uses the PacBio sequencing platform, with an average sequencing data of 15Gb and an average sequencing depth of 17.15×.

[0023] As a preferred technical solution, the method further includes a verification step, as follows:

[0024] S6: Verify the molecular marker: Design primers based on the flanking sequences of the molecular markers screened in step S5, as shown in SEQ ID NO:2 and SEQ ID NO:3; Perform PCR amplification using DNA from several largemouth bass tissues with known sex as templates, analyze the amplification products by agarose gel electrophoresis, and verify the accuracy of the screened specific molecular markers by matching the sex determined based on the band characteristics with the known sex.

[0025] As a preferred technical solution, the PCR amplification conditions are: 94℃ for 5 min; 94℃ for 30 s, 58℃ for 30 s, 72℃ for 50 s, 35 cycles; extension at 72℃ for 7 min. The total PCR amplification reaction system of 20 μL consists of: 10 μL of 2×Premix Taq, 0.8 μL each of 10 mM primers, 6.4 μL of ddH2O, and 1 μL of genomic DNA.

[0026] IV. This invention provides a method for sex determination of largemouth bass, specifically comprising: extracting genomic DNA from the largemouth bass to be tested; amplifying gene fragments containing specific molecular markers using the aforementioned primer pairs; analyzing the amplification products by agarose gel electrophoresis; the PCR amplification conditions being consistent with the verification conditions; and determining the sex based on band characteristics; wherein, male largemouth bass contain a band of the sequence size shown in SEQ ID NO:4, while female largemouth bass do not contain a band of the sequence size shown in SEQ ID NO:4.

[0027] V. The present invention provides a kit for identifying the sex of largemouth bass, the kit being equipped with the aforementioned primer pairs (as shown in SEQ ID NO:2 and SEQ ID NO:3); the kit is suitable for sex identification of juvenile and adult largemouth bass.

[0028] The beneficial effects of this invention are:

[0029] 1) This invention uses conventional PCR combined with agarose gel electrophoresis detection. The judgment criteria are simple and clear. Only one 197bp band is needed to determine whether the sex is male or female. No complicated genotyping analysis is required. Sex determination is more intuitive and easy to operate. It is better suited for large-scale sex identification in grassroots breeding farms and large-scale seedling production.

[0030] 2) This invention designs upstream and downstream primers for the sex-specific DNA sequences obtained through screening. The two primers bind precisely to both ends of the target DNA sequence. The dual-primer design ensures amplification specificity and avoids false positives, ensuring that the PCR amplification is only of the target fragment. Compared with some existing methods based on single primers or SNP detection, the dual-primer system effectively avoids non-specific amplification and improves the accuracy and reliability of the identification results.

[0031] 3) This invention innovatively combines second-generation sequencing (high-throughput, high-precision) and third-generation sequencing (long reads, spanning repetitive regions) data for joint analysis, overcoming the technical bottleneck of insufficient resolution capability of single second-generation sequencing data in complex genomic regions (such as Y chromosome-specific regions rich in transposon elements). This enables faster and more accurate identification of differentially expressed regions between homologous chromosomes and the screening of reliable sex-specific DNA sequences. This technical approach significantly improves the efficiency of marker development and the accuracy of target sequences.

[0032] 4) This invention develops molecular markers based on the precise sequence information of male and female T2T gapless genomes. The target sequences are well-defined, the primers are highly targeted, and the markers have good applicability and stability in different geographical populations. The markers have good stability and wide applicability, providing a reliable technical tool for sex control breeding and seedling production of largemouth bass. Attached Figure Description

[0033] Figure 1 The results of the genome-wide association analysis (GWAS) of the second-generation sequencing of largemouth bass in this invention;

[0034] Figure 2 This is the result of sex-specific locus information screened by third-generation sequencing of largemouth bass in this invention;

[0035] Figure 3 Gel electrophoresis images used to verify the sex of largemouth bass in this invention. Detailed Implementation

[0036] This invention addresses the problems of existing sex identification markers for largemouth bass, which are mostly developed based on SNP loci or single sequencing platforms. These problems include complex genotyping methods, insufficient localization accuracy, lack of cross-validation across multiple platforms, and poor primer specificity, making it difficult to achieve simple, accurate, and stable genetic sex identification. This invention proposes a molecular marker, primer pairs, and sex identification method and application based on specific sequences of the largemouth bass's Y chromosome. Using second-generation and third-generation sequencing technologies, genome-wide association analysis (GWAS) is employed to compare and analyze the sequencing results of male and female individuals, identify sex chromosomes and sex-difference regions, screen for differentially expressed sequences between male and female samples, and design amplification primers based on specific DNA sequences to achieve simple, rapid, and accurate identification of the genetic sex of largemouth bass. The specific content of this invention is as follows:

[0037] I. This invention provides a specific molecular marker for identifying the sex of largemouth bass, the nucleotide sequence of which is:

[0038] AGATTTGAACAGTTTCTCTGAAGCGGATGATATTGCCTACATGACATTACATGATACAATGCAACCATAGTAAATTAATACAATTTACTTATGACTAAAGATAAAAACAGTTTATAAAACTCAAAAAATATCCATGACATTATAAAACAATGTAGGTGAGAATAAGGTGCATCTCAGAAAATCAGAATATCGTGGAAATTTGGAAATTAAT (SEQ ID NO: 1).

[0039] This sequence is a Y chromosome-specific sequence for male largemouth bass.

[0040] II. This invention provides a primer pair for identifying the sex of largemouth bass. The primer pair is designed for gene fragments targeting the aforementioned specific molecular markers and includes a forward primer and a reverse primer; the specific nucleotide sequences are as follows:

[0041] Forward primer F: 5'-TGAAGCGGATGATATTGCC-3' (SEQ ID NO:2).

[0042] Reverse primer R: 5'- TTCCACGATATTCTGATTTTCTG-3' (SEQ ID NO:3).

[0043] The nucleotide sequence of the gene fragment amplified by the primer pair is as follows:

[0044] AGATTTGAACAGTTTCTCTGAAGCGGATGATATTGCCTACATGACATTACATGATACAATGCAACCATAGTAAATTAATACAATTTACTTATGACTAAAGATAAAAACAGTTTATAAAACTCAAAAAATATCCATGACATTATAAAACAATGTAGGTGAGAATAAGGTGCATCTCAGAAAATCAGAATATCGTGGAA (SEQ ID NO: 4).

[0045] III. This invention provides a method for preparing specific molecular markers for identifying the sex of largemouth bass. First, DNA is extracted from several largemouth bass muscle tissue samples of known sex. The DNA samples are divided into two parts. One part is subjected to next-generation sequencing (NGS), and genome-wide association analysis (GWAS) is used to screen for differentially expressed regions in the male and female genomes. Then, based on the screened differentially expressed regions, the other part of the DNA sample is subjected to third-generation sequencing (NGS), and the specific nucleotide sequences of the differentially expressed regions are confirmed in the NGS results. The method specifically includes the following steps:

[0046] S1: DNA extraction: Extract DNA from several largemouth bass muscle tissues of known sex and divide the extracted DNA samples into two parts, with a male-to-female ratio of 1:1 in each part.

[0047] S2: Next-generation sequencing: The DBQSEQ-T7 sequencing platform was used to perform next-generation sequencing on a portion of the largemouth bass DNA samples from step S1; the average sequencing data per sample was 18Gb, the average sequencing depth was 20.57×, and the sequencing strategy was Pair-End 150bp.

[0048] S3: Genome-wide association analysis: Genome-wide association analysis is performed on the second-generation sequencing results in step S2 to screen out regions of difference between male and female genomes;

[0049] S4: Third-generation sequencing: Based on the differential regions screened in step S3, the PacBio sequencing platform was used to perform third-generation sequencing on another part of the largemouth bass DNA samples in step S1; the average sequencing data per sample was 15Gb, and the average sequencing depth was 17.15×.

[0050] S5: Screening for molecular markers: Based on the results of the third-generation sequencing in step S4, screen for nucleotide sequences of specific molecular markers, as shown in SEQ ID NO:1.

[0051] The method of the present invention also includes a verification step, namely, designing primers (as shown in SEQ ID NO:2 and SEQ ID NO:3) based on the flanking sequences of the molecular markers screened in step S5; performing PCR amplification using DNA from several largemouth bass tissues of known sex as templates; analyzing the amplification products by agarose gel electrophoresis; and verifying the accuracy of the screened specific molecular markers by matching the sex determined based on the band characteristics with the known sex.

[0052] The PCR amplification conditions were as follows: 94℃ for 5 min; 94℃ for 30 s, 58℃ for 30 s, 72℃ for 50 s, 35 cycles; extension at 72℃ for 7 min. The total PCR amplification reaction volume of 20 μL consisted of: 10 μL of 2×Premix Taq, 0.8 μL each of 10 mM primers, 6.4 μL of ddH2O, and 1 μL of genomic DNA.

[0053] IV. This invention provides a method for sex determination of largemouth bass, specifically comprising: extracting genomic DNA from the largemouth bass to be tested; amplifying gene fragments containing specific molecular markers using the aforementioned primer pairs; analyzing the amplification products by agarose gel electrophoresis; the PCR amplification conditions being consistent with the verification conditions; and determining the sex based on band characteristics; wherein, male largemouth bass contain a band of the sequence size shown in SEQ ID NO:1, while female largemouth bass do not contain a band of the sequence size shown in SEQ ID NO:1.

[0054] V. The present invention provides a kit for identifying the sex of largemouth bass, the kit being equipped with the aforementioned primer pairs (as shown in SEQ ID NO:2 and SEQ ID NO:3); the kit is suitable for sex identification of juvenile and adult largemouth bass.

[0055] The following detailed description of specific embodiments of the present invention is provided in conjunction with examples. Reagents not cited in the following examples are commercially available reagents, and methods not described in detail are conventional and well-known experimental methods. Specific embodiments are as follows:

[0056] Example 1: Screening of sex-specific molecules

[0057] We purchased 300 largemouth bass from the same pedigree family from the fish farm and dissected all the fish to determine their physiological sex, including 150 female samples and 150 male samples.

[0058] DNA was extracted from 93 female and 93 male samples randomly selected. The DNA extraction kit used was the QIAGEN 69504 DNeasy Blood & Tissue Kit from Qiagen, Germany.

[0059] The genomes of 90 female and 90 male DNA samples were resequencing using the MGI next-generation sequencing platform (Made by BGI Genomics, China).

[0060] Then, following the DBQSEQ-T7 library construction protocol, a paired-end genomic DNA library with an insert size of 350 bp was constructed. The genome was then sequenced using the DBQSEQ-T7 sequencing platform, with a sequencing depth of 18 Gb per sample and a pair-end 150 bp sequencing strategy. Next-generation sequencing data were obtained.

[0061] The obtained next-generation sequencing data were analyzed using the GWAS method to identify sex chromosomes (chromosome 10) and to screen for sex-determining regions, i.e., regions of male-female difference, such as... Figure 1 As shown.

[0062] Based on the sex-difference regions identified by GWAS screening, another 3 female and 3 male DNA samples were used for third-generation high-throughput sequencing (Pacific Biosciences Sequencing Company, USA) using the PacBio sequencing platform with single-end sequencing. The average sequencing data was 15Gb. Third-generation sequencing data were obtained.

[0063] Based on third-generation sequencing results and HiFi read alignment depth, sex indel markers were screened in the sex-determining region of chromosome 10, and differentially expressed sequences between female and male samples were identified. Ultimately, a 211 bp insertion fragment was found in the male fish genome, as shown below. Figure 2 As shown, this is a sex-specific molecular marker, and the nucleotide sequence of this Indel marker is shown in SEQ ID NO.1.

[0064] AGATTTGAACAGTTTCTCTGAAGCGGATGATATTGCCTACATGACATTACATGATACAATGCAACCATAGTAAATTAATACAATTTACTTATGACTAAAGATAAAAACAGTTTATAAAACTCAAAAAATATCCATGACATTATAAAACAATGTAGGTGAGAATAAGGTGCATCTCAGAAAATCAGAATATCGTGGAAATTTGGAAATTAAT (SEQ ID NO: 1).

[0065] Example 2: Validation of sex-specific molecules

[0066] Primers were designed using Primer V6 software based on a 211 bp insert gene sequence found in the male fish genome in Example 1. The primer nucleotide sequences are as follows:

[0067] Forward primer F: 5'-TGAAGCGGATGATATTGCC-3' (SEQ ID NO:2).

[0068] Reverse primer R: 5'- TTCCACGATATTCTGATTTTCTG-3' (SEQ ID NO:3).

[0069] From the largemouth bass cultured population DNA extracted in Example 1, 24 male and 24 female fish DNA samples were randomly selected as test samples for PCR amplification band verification. PCR amplification conditions were: 94℃, 5 min; 94℃, 30 s, 58℃, 30 s, 72℃, 50 s, 35 cycles; extension at 72℃ for 7 min. The total PCR amplification reaction system of 20 μL consisted of: 10 μL of 2×Premix Taq, 0.8 μL each of 10 mM primers, 6.4 μL of ddH2O, and 1 μL of genomic DNA.

[0070] The amplified PCR products were detected by agarose gel electrophoresis, such as... Figure 3 As shown in the electrophoresis results, 48 ​​male fish amplified two bands, 629bp and 229bp, while 48 female fish only amplified a single band of 229bp.

[0071] The PCR products were purified and then sequenced. The results showed that 24 male fish amplified a 179bp band, while 24 female fish did not amplify a band, achieving a 100% accuracy rate in identification.

[0072] AGATTTGAACAGTTTCTCTGAAGCGGATGATATTGCCTACATGACATTACATGATACAATGCAACCATAGTAAATTAATACAATTTACTTATGACTAAAGATAAAAACAGTTTATAAAACTCAAAAAATATCCATGACATTATAAAACAATGTAGGTGAGAATAAGGTGCATCTCAGAAAATCAGAATATCGTGGAA (SEQ ID NO: 4).

[0073] This verifies the accuracy of the sex-specific molecules screened in Example 1 and the designed pair of specific primers for identifying the sex of largemouth bass. The designed amplification primers can be prepared into a kit for direct use in large-scale sex identification in grassroots breeding farms and large-scale seedling production.

Claims

1. A specific molecular marker for identifying the sex of largemouth bass, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO:1, which is a Y chromosome-specific sequence for male largemouth bass.

2. A primer pair for identifying the sex of largemouth bass, characterized in that: The primer pair is designed for gene fragments targeting the specific molecular marker of claim 1, and includes a forward primer and a reverse primer; The nucleotide sequence of the forward primer is shown in SEQ ID NO:

2. The nucleotide sequence of the reverse primer is shown in SEQ ID NO:

3.

3. The primer pair for identifying the sex of largemouth bass according to claim 2, characterized in that: The nucleotide sequence of the gene fragment amplified by the primer pair is shown in SEQ ID NO:

4.

4. A method for preparing a specific molecular marker for identifying the sex of largemouth bass, characterized in that: DNA was extracted from several largemouth bass muscle tissue samples of known sex. The extracted largemouth bass DNA was subjected to second-generation sequencing and / or third-generation sequencing, followed by genome-wide association analysis to screen for differential regions in the male and female genomes. The specific nucleotide sequences of the differential regions were confirmed in the results of third-generation sequencing. The sequence shown in SEQ ID NO:1 is the specific molecular marker for identifying the sex of largemouth bass as described in claim 1.

5. The method for preparing specific molecular markers for identifying the sex of largemouth bass according to claim 4, characterized in that: This method combines second-generation sequencing and third-generation sequencing for analysis, and specifically includes the following steps: S1: DNA extraction: Extract DNA from several largemouth bass muscle tissues of known sex and divide the extracted DNA samples into two parts, with the male-to-female ratio in each part being 1:

1. S2: Next-generation sequencing: Perform next-generation sequencing on a portion of the largemouth bass DNA sample from step S1. S3: Genome-wide association analysis: Genome-wide association analysis is performed on the second-generation sequencing results in step S2 to screen out regions of difference between male and female genomes; S4: Third-generation sequencing: Based on the differential regions screened in step S3, the other part of the largemouth bass DNA sample in step S1 is subjected to third-generation sequencing. S5: Screening for molecular markers: Based on the results of the third-generation sequencing in step S4, screen for nucleotide sequences of specific molecular markers, as shown in SEQ ID NO:

1.

6. The method for preparing specific molecular markers for identifying the sex of largemouth bass according to claim 5, characterized in that: The second-generation sequencing was performed using the DBQSEQ-T7 sequencing platform, with an average sequencing data of 18Gb per sample, an average sequencing depth of 20.57×, and a sequencing strategy of Pair-End 150bp. The third-generation sequencing was performed using the PacBio sequencing platform, with an average sequencing data of 15Gb and an average sequencing depth of 17.15×.

7. The method for preparing specific molecular markers for identifying the sex of largemouth bass according to claim 5, characterized in that: The method also includes a verification step, as follows: S6: Verify the molecular marker: Design primers based on the flanking sequences of the molecular markers screened in step S5, as shown in SEQ ID NO:2 and SEQ ID NO:3; Perform PCR amplification using DNA from several largemouth bass tissues with known sex as templates, analyze the amplification products by agarose gel electrophoresis, and verify the accuracy of the screened specific molecular markers by matching the sex determined based on the band characteristics with the known sex.

8. The method for preparing specific molecular markers for identifying the sex of largemouth bass according to claim 6, characterized in that: The PCR amplification conditions were as follows: 94℃ for 5 min; 94℃ for 30 s, 58℃ for 30 s, 72℃ for 50 s, 35 cycles; extension at 72℃ for 7 min; the total PCR amplification reaction system of 20 μL consisted of: 10 μL of 2×Premix Taq, 0.8 μL of each of the 10 mM primers, 6.4 μL of ddH2O, and 1 μL of genomic DNA.

9. A method for sex determination of largemouth bass, characterized in that: Genomic DNA was extracted from the largemouth bass to be tested; Amplify gene fragments containing the specific molecular marker of claim 1 using the primer pair described in claim 2; The amplification products were analyzed by agarose gel electrophoresis; the PCR amplification conditions were consistent with those described in claim 7. Sex was determined based on band characteristics; male largemouth bass contained a band of the size shown in SEQ ID NO:4, while female largemouth bass did not contain a band of the size shown in SEQ ID NO:

4.

10. A kit for identifying the sex of largemouth bass, characterized in that: The kit contains the primer pair as described in claim 2; the kit is suitable for sex determination of juvenile and adult largemouth bass.