Application of circKLC1 as diagnostic marker and therapeutic target for metabolic dysfunction-associated fatty liver disease

Abstract

The application discloses application of circKLC1 as a diagnostic marker and therapeutic target of metabolic dysfunction associated steatohepatitis (MASLD). The application discloses, for the first time, abnormal high expression of circKLC1 in MASLD and a key role of the circKLC1 in regulation of lipid metabolism, and proves that the circKLC1 can aggravate lipid deposition and liver function damage by promoting expression of lipid generation related genes; meanwhile, inhibition of expression of the circKLC1 can significantly improve abnormal accumulation of lipids and liver damage phenotypes in a cell and an animal model. The circKLC1 not only has application value as a biological marker for early diagnosis of MASLD, but also has development prospect as a potential therapeutic target, and thus provides a new theoretical basis and application direction for mechanism research, clinical diagnosis and targeted intervention of MASLD.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to the application of circKLC1 as a diagnostic biomarker and therapeutic target for metabolic dysfunction-related fatty liver disease. Background Technology

[0002] Metabolic dysfunction-associated steatotic liver disease (MASLD), formerly known as nonalcoholic fatty liver disease (NAFLD), is a metabolic disease characterized by abnormal lipid deposition in the liver. It has become a major cause of chronic liver disease and liver failure, and in severe cases can progress to liver fibrosis, cirrhosis, and even liver cancer, with its incidence increasing year by year. Currently, the diagnosis of MASLD mainly relies on imaging examinations and liver biopsies, but existing detection methods have drawbacks such as insufficient sensitivity, high invasiveness, and difficulty in dynamic monitoring. At the same time, its treatment options are also relatively limited, and effective drug interventions are still lacking. Therefore, there is an urgent need to develop new highly sensitive diagnostic biomarkers and therapeutic targets to achieve early diagnosis and precise treatment of MASLD.

[0003] circRNAs are a class of non-coding RNAs characterized by high stability and tissue specificity, playing a crucial regulatory role in the development and progression of metabolic diseases. Current technologies have not clarified the correlation between circKLC1 and MASLD, and there is a lack of technical solutions for using circKLC1 in the diagnosis and treatment of MASLD. Therefore, screening and identifying circRNA molecules closely related to MASLD, elucidating their mechanisms of action in disease progression, and developing novel diagnostic and therapeutic strategies based on these molecules are of significant scientific and clinical value. Summary of the Invention

[0004] The purpose of this invention is to address the aforementioned technical problems by providing the application of circKLC1 as a diagnostic biomarker and therapeutic target for MASLD, which can be used for the early diagnosis and targeted therapy of MASLD. This invention, through a systematic study of the structure and expression characteristics of circKLC1, has for the first time confirmed that circKLC1 is a stable circular RNA molecule, significantly highly expressed in the liver tissue and peripheral blood of MASLD patients, and closely correlated with the degree of hepatic lipid deposition, suggesting that it can serve as an important molecular biomarker for the diagnosis of MASLD. This invention further validates the key role of circKLC1 in lipid metabolism regulation through cell and animal experiments, finding that it can positively regulate the expression of lipid production-related genes and proteins, promote lipid deposition, and aggravate hepatocyte damage. Knockdown of circKLC1 significantly reduces TG and TC levels and lipid droplet accumulation, improving liver function. Furthermore, in a HFHC diet-induced MASLD mouse model, liver-specific inhibition of circKLC1 significantly alleviates hepatic lipid deposition and pathological damage, further validating its effectiveness as a therapeutic target. Therefore, this invention not only provides new biomarkers for the early diagnosis of MASLD, but also provides new theoretical basis and potential application directions for its molecular mechanism research and targeted therapy, and has good clinical translational value.

[0005] The technical solution adopted by this invention to solve its technical problem is as follows:

[0006] In a first aspect, the present invention provides a circular RNA molecular marker for the diagnosis of MASLD, wherein the circular RNA molecular marker is circKLC1, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO. 1.

[0007] The sequence of SEQ ID NO. 1 is:

[0008] AATGTATGACAACATGTCCACAATGGTGTACATAAAGGAAGACAAGTTGGAGAAGCTTACACAGGATGAAATTATTTCTAAGACAAAGCAAGTAATTCAGGGGCTGGAAGCTTTGAAGAATGAGCACAATTCCATTTTACAAAGTTTGCTGGAGACACTGAAGTGTTTGAAGAAAGATGATGAAAGTAATTTGGTGGAGGAGAAATCAAACATGATCCGGAAGTCACTGGAGATGTTGGAGCTCGGCC TGAGTGAGGCACAGGTTATGATGGCTTTGTCAAATCACCTGAATGCTGTGGAGTCCGAGAAGCAGAAACTGCGTGCGCAGGTTCGTCGTCTGTGCCAGGAGAATCAGTGGCTACGGGATGAACT GGCCAACACGCAGCAGAAACTGCAGAAGAGTGAGCAGTCTGTGGCTCAACTGGAGGAGGAGAAGAAGCATCTGGAGTTTATGAATCAGCTAAAAAAATATGATGACGACATTTCCCCATCC (SEQ ID NO.1).

[0009] The results of this study indicate that circKLC1 is significantly highly expressed in the liver tissue and peripheral blood of patients with MASLD. ROC analysis showed that the area under the curve (AUC) for circKLC1 in plasma in diagnosing MASLD was 0.817, indicating its good diagnostic value and potential for early screening and diagnosis of MASLD.

[0010] In a second aspect, the present invention provides applications of reagents for detecting circKLC1 expression levels, said applications including one or more of the following:

[0011] (A1) Use in the preparation of products for the diagnosis or auxiliary diagnosis of fatty liver disease related to metabolic dysfunction;

[0012] (A2) Application in the preparation of products for screening or assisting in the screening of fatty liver disease related to metabolic dysfunction.

[0013] In a specific implementation, the reagent for detecting circKLC1 expression level includes specific primers for detecting circKLC1 expression.

[0014] Furthermore, the primers include a forward primer and a reverse primer. The nucleotide sequence of the forward primer is shown in SEQ ID NO.2: TTTCCCCATCCAATGTATGACA; the nucleotide sequence of the reverse primer is shown in SEQ ID NO.3: CTCCAGTGACTTCCGGATCA.

[0015] Furthermore, the primer set also includes forward and reverse primers for the internal reference GAPDH: GAPDH Primer F: GTCGTACCACAGGCATTGTGATGG (as shown in SEQ ID NO.7); GAPDH Primer R: GCATGCCTGGGTACATGGTGG (as shown in SEQ ID NO.8). This primer set can be used to detect the expression level of circKLC1, thereby providing a basis for the diagnosis or auxiliary diagnosis of MASLD.

[0016] Thirdly, the present invention protects a product for detecting fatty liver disease associated with metabolic dysfunction, said product comprising a reagent for detecting the expression level of circKLC1 in a subject.

[0017] Furthermore, the primers include a forward primer and a reverse primer. The nucleotide sequence of the forward primer is shown in SEQ ID NO.2: TTTCCCCATCCAATGTATGACA; the nucleotide sequence of the reverse primer is shown in SEQ ID NO.3: CTCCAGTGACTTCCGGATCA.

[0018] Furthermore, the primer set also includes a forward primer and a reverse primer for the internal reference GAPDH: GAPDH Primer F: GTCGTACCACAGGCATTGTGATGG (as shown in SEQ ID NO.7); GAPDH Primer R: GCATGCCTGGGTACATGGTGG (as shown in SEQ ID NO.8).

[0019] Furthermore, the product is a reagent kit, drug, gene chip, or test strip, preferably a reagent kit.

[0020] Fourthly, this invention protects the use of circKLC1 expression inhibitors in products for the treatment or adjuvant treatment of fatty liver disease associated with metabolic dysfunction.

[0021] Furthermore, the circKLC1 expression inhibitor includes at least one of the following: small interfering RNA, sgRNA, a gene editing vector containing said sgRNA, shRNA, and a recombinant vector containing said shRNA.

[0022] Furthermore, the circKLC1 expression inhibitor is selected from any of the following:

[0023] (B1) shRNA that inhibits circKLC1 expression, the target sequence of which is shown in SEQ ID NO.4;

[0024] (B2) A recombinant viral vector containing the shRNA in (B1).

[0025] Furthermore, the recombinant viral vector is AAV8 or GV248.

[0026] Fifthly, the present invention protects a product for treating or adjuvant treatment of fatty liver disease associated with metabolic dysfunction, said product containing a circKLC1 expression inhibitor.

[0027] Furthermore, the circKLC1 expression inhibitor includes at least one of the following: small interfering RNA, sgRNA, a gene editing vector containing said sgRNA, shRNA, and a recombinant vector containing said shRNA.

[0028] Furthermore, the circKLC1 expression inhibitor is selected from any of the following:

[0029] (B1) shRNA that inhibits circKLC1 expression, the target sequence of which is shown in SEQ ID NO.4;

[0030] (B2) A recombinant viral vector containing the shRNA in (B1).

[0031] Furthermore, the recombinant viral vector is AAV8 or GV248.

[0032] The results showed that knocking down circKLC1 could significantly reduce lipid deposition in MASLD cells and animal models, reduce the expression of lipid production-related genes and proteins, and improve liver function damage, indicating that circKLC1 can serve as an important therapeutic target for MASLD.

[0033] Sixthly, the present invention protects the use of circKLC1 as a therapeutic target in screening or assisting in the screening of products for the treatment or adjuvant treatment of fatty liver disease associated with metabolic dysfunction.

[0034] In a seventh aspect, the present invention provides a diagnostic method for MASLD, the method comprising the following steps: detecting the expression level of circKLC1 in a subject sample, and determining whether the subject has MASLD based on the expression level of circKLC1.

[0035] Preferably, the subject sample is selected from plasma and liver tissue samples.

[0036] Preferably, the expression level of circKLC1 is detected using real-time quantitative PCR (qRT-PCR). Preferably, the forward primer shown in SEQ ID NO.2 and the reverse primer shown in SEQ ID NO.3 are used for amplification and detection.

[0037] Compared with the prior art, the beneficial effects of this application are as follows:

[0038] Through a systematic study of the structure and expression characteristics of circKLC1, this invention is the first to confirm that circKLC1 is a stable circular RNA molecule, significantly highly expressed in the liver tissue and peripheral blood of MASLD patients, and closely related to the degree of hepatic lipid deposition, thus serving as an important molecular marker for MASLD. When the expression level of circKLC1 is significantly increased, it can be clearly identified that the subject is a MASLD patient or a high-risk group for MASLD, effectively preventing the development and deterioration of the disease and the irreversible health damage to patients.

[0039] By detecting the expression level of circKLC1 in patients with MASLD, the degree of hepatic steatosis can be reasonably predicted, thereby providing personalized treatment plans. The efficient and specific PCR reaction can reduce the cost of diagnostic testing, making it easier to widely apply in clinical practice and providing support for the prevention and treatment of MASLD in clinical practice.

[0040] This invention first discovers that inhibiting circKLC1 expression can effectively suppress hepatic lipid deposition in MASLD. This can serve as a novel therapeutic target for MASLD, providing a new direction for MASLD treatment strategies and greatly contributing to subsequent drug development and clinical treatment, thus possessing significant scientific value. Attached Figure Description

[0041] Figure 1 This is a schematic diagram of the identification results of the circKLC1 circular structure. The figure shows that circKLC1 is a circular RNA structure formed by the backsplicing of exon 2 and exon 3 of the KLC1 gene, and its backsplicing site was verified by Sanger sequencing.

[0042] Figure 2 This is a schematic diagram illustrating the verification results of the circKLC1 circular structure. PCR amplification was performed on cDNA and genomic DNA (gDNA) using convergent and divergent primers, respectively. The results showed that the divergent primers could only amplify specific bands in cDNA, proving that circKLC1 is a circular RNA.

[0043] Figure 3 This is a schematic diagram showing the stability test results of circKLC1. Among them, Figure 3A shows the changes in circKLC1 and linear KLC1 mRNA expression after RNase R treatment; Figure 3 B represents the electrophoresis results of the circKLC1 amplification products after RNase R treatment; Figure 3 C represents the comparison of the stability of circKLC1 and linear KLC1 mRNA after Actinomycin D treatment.

[0044] Figure 4 This is a schematic diagram illustrating the subcellular localization analysis results of circKLC1. Among them, Figure 4 A shows the results of FISH detection of circKLC1 localization in AML12 cells; Figure 4 B represents the results of nucleoplasmic separation combined with qRT-PCR detection of the distribution of circKLC1 in the cell nucleus and cytoplasm.

[0045] Figure 5 This is a schematic diagram showing the results of qRT-PCR detection of circKLC1 expression levels in liver tissues of MASLD patients and healthy controls.

[0046] Figure 6 This is a schematic diagram showing the results of qRT-PCR detection of circKLC1 expression levels in peripheral blood of MASLD patients and healthy controls.

[0047] Figure 7 This is a schematic diagram showing the pathological findings of liver tissue and the results of circKLC1 expression detection in patients with MASLD. Figure 7 A represents the results of immunohistochemical (IHC) detection of circKLC1 expression; Figure 7 B represents the results of HE staining for detecting steatosis and lipid droplet deposition in liver tissue.

[0048] Figure 8 This is a schematic diagram of the ROC curve analysis results of circKLC1 for MASLD diagnosis.

[0049] Figure 9 This is a schematic diagram illustrating the effects of circKLC1 knockdown on lipid deposition and hepatocyte damage in MASLD cells. Figure 9 A represents the results of detecting changes in intracellular triglyceride (TG) and total cholesterol (TC) levels; Figure 9 B represents the results of Oil Red O staining and BODIPY fluorescence staining to detect changes in cellular lipid droplet deposition; Figure 9 C represents the results of Western Blot analysis of changes in the expression of lipidogenesis-related proteins FASN, SREBP-1, SCD1, and ACC1. Figure 9 D represents the results of qRT-PCR detection of changes in FASN, SREBP-1, SCD1, and ACC1 mRNA expression; Figure 9 E represents the results of detecting changes in AST and ALT levels in cell culture supernatant.

[0050] Figure 10 This is a schematic diagram illustrating the effects of circKLC1 overexpression on lipid deposition and hepatocyte damage in MASLD cells. Figure 10 A represents the results of detecting changes in intracellular TG and TC levels; Figure 10 B represents the results of Oil Red O staining and BODIPY fluorescence staining to detect changes in cellular lipid droplet deposition; Figure 10 C represents the results of Western Blot analysis of changes in the expression of lipidogenesis-related proteins FASN, SREBP-1, SCD1, and ACC1. Figure 10 D represents the results of qRT-PCR detection of changes in FASN, SREBP-1, SCD1, and ACC1 mRNA expression; Figure 10 E represents the results of detecting changes in AST and ALT levels in cell culture supernatant.

[0051] Figure 11 A mouse liver-specific knockdown model of circKLC1 was constructed by delivering circKLC1 shRNA via AAV-TBG under HFHC dietary conditions. Figure 11 A is a schematic diagram of the construction of the HFHC+AAV-TBG-circKLC1 shRNA mouse model. Figure 11 B is a schematic diagram of the molecule constructed from AAV-TBG-circKLC1-shRNA. Figure 11 C represents the validation of circKLC1 expression in the liver of HFHC+AAV-TBG-circKLC1-shRNA mice.

[0052] Figure 12 This is a schematic diagram illustrating the effect of liver-specific knockdown of circKLC1 on improving liver lipid deposition and pathological damage in MASLD model mice. Figure 12 A represents the results of detecting changes in serum TG levels in the two groups of mice; Figure 12 B represents the results of detecting changes in serum TC levels in the two groups of mice; Figure 12 C represents the results of qRT-PCR detection of changes in the expression of FASN, SREBP-1, SCD1, and ACC1 in the liver tissues of the two groups of mice; Figure 12 D represents the results of Western Blot analysis of the expression changes of FASN, SREBP-1, SCD1, and ACC1 proteins in the liver tissues of the two groups of mice. Figure 12 E represents the gross morphological observation results of the livers of the two groups of mice; Figure 12 F represents the results of HE staining and OilRed O staining to detect lipid deposition and pathological changes in the liver tissue of the two groups of mice. Detailed Implementation

[0053] The present invention will be further described below with reference to specific embodiments. It should be noted that, without conflict, the various embodiments or technical features described below can be arbitrarily combined to form new embodiments.

[0054] The technology involved in this invention is a conventional technique for molecular cloning. Unless otherwise specified, the enzymes, primers, reagents, and reaction conditions involved can be reasonably selected based on the experience of those skilled in the art. The reagents and consumables involved are commercially available common products, and the detection methods and instruments involved are well-known and skillfully used by those skilled in the art. Unless otherwise stated, the experimental methods in the examples adopt existing experimental procedures and are strictly performed according to the reagent kit manufacturer's instructions.

[0055] This invention relates to the application of circKLC1 as a diagnostic biomarker and therapeutic target for metabolic dysfunction-associated steatotic liver disease (MASLD). Through high-throughput screening, molecular biological validation, and functional experiments, the applicant discovered that circKLC1 is significantly elevated in the liver tissue and peripheral blood of MASLD patients and participates in the regulation of lipid deposition, making it suitable for the auxiliary diagnosis and therapeutic intervention of MASLD.

[0056] Example 1: Screening, ring structure identification, stability and subcellular localization analysis of circKLC1

[0057] To systematically screen for differentially expressed circRNAs related to MASLD, we analyzed the GSE94841 dataset in the GEO database and selected the top 10 most significantly upregulated circRNAs for qRT-PCR validation in MASLD liver tissue. The results showed that circKLC1 was upregulated most significantly, suggesting that circKLC1 may be an important driver of lipid deposition in MASLD.

[0058] To verify whether circKLC1 possesses a stable closed circular structure, primers were designed based on its sequence (the nucleotide sequence of the forward primer is shown in SEQ ID NO. 2: TTTCCCCATCCAATGTATGACA; the nucleotide sequence of the reverse primer is shown in SEQ ID NO. 3: CTCCAGTGACTTCCGGATCA). Sanger sequencing was used to detect primer specificity and the circKLC1 circularization site. Figure 1The results showed that circKLC1 has a clearly defined reverse splicing site, and the specific primers could only amplify the target band in cDNA, but not in gDNA, indicating that circKLC1 is a circular RNA. Figure 2 Furthermore, RNA samples were treated with RNase R and actinomycin D. The results showed that linear KLC1 mRNA was significantly degraded after RNase R treatment, while circKLC1 was largely retained. Figure 3 A); After treatment with radiobinin, circKLC1 has a longer half-life than linear RNA, indicating that circKLC1 has higher stability. Figure 3 B). Subcellular localization analysis of circKLC1 was performed using FISH and qPCR experiments. The results showed that circKLC1 is mainly distributed in the cytoplasm. Figure 4 A, B).

[0059] Example 2: Analysis of circKLC1 expression and diagnostic value in MASLD patients

[0060] Liver tissue samples were collected from 10 clinically diagnosed MASLD patients and 10 control liver tissue samples. Peripheral blood samples were also collected from 44 MASLD patients and 40 healthy controls. Total RNA was extracted from liver tissue and plasma, and the expression level of circKLC1 was detected using quantitative real-time PCR (qRT-PCR). Its application value as a blood diagnostic biomarker for MASLD was evaluated.

[0061] The results showed that, compared with the healthy control group, the expression level of circKLC1 in the liver tissue and blood of MASLD patients was significantly increased, and the difference was statistically significant. Figure 5 , Figure 6 Furthermore, immunohistochemical and HE staining were performed on the liver tissue. The results showed that the liver tissue of MASLD patients exhibited significant fatty degeneration and lipid droplet deposition, along with enhanced circKLC1-related expression signals. Figure 7 A, B). ROC curves were constructed based on the expression levels of circKLC1 in blood samples. The results showed that the area under the curve (AUC) for circKLC1 in diagnosing MASLD was 0.817, indicating good diagnostic efficacy and the ability to effectively distinguish MASLD patients from healthy individuals. This suggests that circKLC1 could serve as a potential molecular diagnostic biomarker for MASLD. Figure 8 ).

[0062] Example 3: Knockdown of circKLC1 inhibits lipid deposition in MASLD cells

[0063] A MASLD cell model was established by inducing hepatocytes with palmitic acid (PA). The expression of circKLC1 in the cells was downregulated by transfection with circKLC1 shRNA, while the control group was transfected with negative control shRNA. The circKLC1 shRNA was designed and synthesized by GenePharma (Shanghai, China) and targets the circKLC1 backsplicing site region. Multiple candidate interference sequences were screened, with shRNA-2, which exhibited the highest knockdown efficiency, being used for subsequent functional experiments. Its target sequence is 5′-CCCCTCGGATGTATGACAAC-3′ (as shown in SEQ ID NO. 4). The shRNA sequence was constructed in a recombinant viral interference vector containing a human U6 promoter-driven shRNA expression framework, along with a CMV promoter-driven green fluorescent protein (GFP) reporter gene and a puromycin resistance selection marker. After transfection, the transfection efficiency was observed using GFP fluorescence signals, and stable expression cell lines were obtained through puromycin selection. The negative control group used a scrambled shRNA sequence that did not target any known mammalian genes, but its vector backbone, promoter, fluorescent reporter gene, and selection marker were consistent with the experimental group. Real-time quantitative PCR (qRT-PCR) was used to detect circKLC1 expression levels. The results showed that shRNA-2 significantly reduced circKLC1 expression; therefore, this interfering sequence was selected for subsequent functional studies.

[0064] To determine cellular triglyceride (TG) and total cholesterol (TC) levels, treated cells were seeded in 6-well plates. After cell confluence reached 70%–80%, PA was added for induction culture. After culture, cells were collected, and intracellular TG and TC levels were measured using TG and TC detection kits. The results showed that, compared to the control group, knockdown of circKLC1 significantly reduced TG and TC levels in PA-induced MASLD cells, suggesting that circKLC1 knockdown can inhibit lipid accumulation. Figure 9A). For the Oil Red O staining experiment, the treated cells were fixed with 4% paraformaldehyde for 15 min, then gently washed three times with PBS, and then stained with Oil Red O working solution in the dark for 15 min. After washing away excess staining solution with PBS, the cells were observed and photographed under a microscope. The results showed that, compared with the control group, knockdown of circKLC1 significantly reduced intracellular red lipid droplets, indicating a significant reduction in lipid deposition. Further BODIPY fluorescence staining was used to detect intracellular lipid droplet deposition. The fixed cells were incubated in BODIPY staining solution in the dark and observed and photographed using a fluorescence microscope. The results showed that, compared with the control group, knockdown of circKLC1 significantly weakened the intracellular fluorescence signal, indicating a significant reduction in lipid droplet accumulation, which was consistent with the results of Oil Red O staining. Figure 9 B). To further investigate the role of circKLC1 in lipid metabolism, Western blotting was used to detect the expression levels of lipid synthesis-related proteins. Total protein was extracted from cells in each group, separated by SDS-PAGE electrophoresis, transferred to membranes, incubated with corresponding primary antibodies, and protein expression was detected by ECL chemiluminescence. The results showed that, compared with the control group, knockdown of circKLC1 significantly reduced the protein expression levels of fatty acid synthase (FASN), sterol regulatory element-binding protein-1 (SREBP-1), stearoyl-CoA desaturase 1 (SCD1), and acetyl-CoA carboxylase 1 (ACC1). Figure 9 C). Simultaneously, qRT-PCR was used to detect the mRNA expression levels of lipid production-related genes. Total RNA was extracted from cells and reverse transcribed into cDNA, which was then detected by real-time quantitative PCR using the SYBR Green assay. The results showed that, compared with the control group, knockdown of circKLC1 significantly reduced the mRNA expression of lipid production-related genes (C). Figure 9 D). In addition, cell culture supernatant was collected, and the levels of aspartate aminotransferase (AST) and alanine aminotransferase (ALT) were detected using a biochemical kit. The results showed that, compared with normal hepatocytes, the levels of AST and ALT in MASLD cells treated with PA were significantly increased, while knockdown of circKLC1 significantly decreased the levels of AST and ALT, suggesting that it can alleviate hepatocyte damage. Figure 9 E).

[0065] Example 4: Overexpression of circKLC1 promotes lipid deposition in MASLD cells

[0066] To further verify the functional role of circKLC1 in MASLD, a circKLC1 overexpression cell model was constructed, and its effects on lipid deposition and liver injury-related indicators were examined. The circKLC1 overexpression vector was synthesized by GenePharma (Shanghai, China). Amplification primers were designed based on the mature circKLC1 sequence, and the full-length circKLC1 sequence was cloned into a circRNA overexpression vector. The circKLC1 overexpression vector was pcDNA3.1(+)-ciR-circKLC1, with the empty vector pcDNA3.1(+)-ciR serving as a negative control. The circKLC1 sequence was inserted into the multiple cloning site of the vector, between the EcoRI and BamHI restriction sites. The vector contained a CMV promoter, inverse complementary circular elements, a GFP fluorescent reporter gene, and a puromycin resistance selection marker, used for high-efficiency expression of circKLC1, observation of transfection efficiency, and screening of positive cells. This overexpression vector did not contain a protein tag sequence. The amplification primers used to construct the circKLC1 overexpression vector are as follows: circKLC1-OE-F: 5′-AATGTATGACAACATGTCCACA-3′ (as shown in SEQ ID NO. 5); circKLC1-OE-R: 5′-GGATGGGGAAATGTCGTCATC-3′ (as shown in SEQ ID NO. 6).

[0067] The circKLC1 overexpression vector was transfected into a MASLD cell model, with the empty vector group serving as the control group. Intracellular TG and TC levels were first measured. Results showed that, compared to the control group, circKLC1 overexpression significantly increased TG and TC levels in PA-induced MASLD cells. Figure 10 A). Further examination using Oil Red O staining revealed increased intracellular lipid droplet numbers and significantly enhanced lipid deposition after circKLC1 overexpression. Subsequent BODIPY fluorescence staining further analyzed lipid droplet accumulation, showing that circKLC1 overexpression significantly promoted intracellular lipid droplet accumulation, consistent with the results of Oil Red O staining. Figure 10 B). Further analysis using Western blotting revealed that overexpression of circKLC1 significantly upregulated the expression of lipidogenesis-related proteins. Figure 10 C). Simultaneously, qRT-PCR was used to detect the mRNA expression levels of lipidogenesis-related genes. The results showed that circKLC1 overexpression significantly promoted the expression of lipidogenesis-related genes (C). Figure 10D). Furthermore, the levels of AST and ALT in the cell culture supernatant were detected. The results showed that, compared with the control group, circKLC1 overexpression significantly increased AST and ALT release levels, suggesting that it exacerbated MASLD-related liver function damage. Figure 10 E).

[0068] Example 5: circKLC1 knockdown significantly improved lipid deposition in the liver of MASLD mice.

[0069] To verify the functional role of circKLC1 in MASLD, a MASLD animal model was established using 7-week-old male C57BL / 6J mice. Mice were randomly assigned to groups after one week of acclimatization and simultaneously started a high-fat, high-cholesterol diet (HFHC) and viral intervention. The HFHC diet contained 14% protein, 42% fat, and 44% carbohydrates, with a cholesterol content of 0.2%, and was fed continuously for 8 weeks. A recombinant adeno-associated virus (AAV8-TBG-circKLC1) shRNA with liver-specific knockdown of circKLC1 was constructed, and its expression in mouse liver was downregulated via tail vein injection. The control group was injected with a negative control virus, AAV8-TBG-control, using the same vector backbone. The construction procedure for the HFHC+AAV-TBG-circKLC1 shRNA mouse model is as follows: Figure 11 As shown in Figure A, the schematic diagram of AAV-TBG-circKLC1-shRNA construction is as follows: Figure 11As shown in Figure B. The recombinant adeno-associated virus (AAV) was designed, constructed, and packaged by Beijing Qingke Biotechnology Co., Ltd. The virus was expressed using an AAV8 vector system driven by a liver-specific thyroxine-binding globulin promoter (TBG). The circKLC1 interference sequence targets the circKLC1 backsplicing site region; its target sequence is SEQ ID NO.4, and its nucleotide sequence is as follows: 5′-CCCCTCGGATGTATGACAAC-3′. The negative control virus was constructed using a scramble sequence that does not target any known mouse genes, and its viral vector backbone, promoter, and packaging method were consistent with the experimental group. The purified viral titer was 1×10^12 vg / mL. Each mouse received 100 μL of viral suspension via tail vein injection, equivalent to receiving 1×10^11 vg of viral particles. Viral injection began simultaneously with HFHC modeling. After 8 weeks of continuous feeding, mice were sacrificed, and liver tissue and serum samples were collected for subsequent pathological, biochemical, and molecular biological analysis. The expression level of circKLC1 in mouse liver tissue was detected by qRT-PCR. The results showed that, compared with the HFHC+AAV-TBG-control group, the expression of circKLC1 in the liver of mice in the HFHC+AAV-TBG-circKLC1 shRNA group was significantly decreased, indicating that the constructed AAV8-TBG-shcircKLC1 could effectively inhibit the expression of circKLC1 in mouse liver. Figure 11 C).

[0070] At week 8 of HFHC diet feeding, changes in lipid deposition in mice with circKLC1 knockdown were observed. Serum TG and TC levels were measured using biochemical reagent kits. Results showed that, compared with the HFHC+AAV8-TBG-control group, the serum TG level in the HFHC+AAV8-TBG-shcircKLC1 group was significantly decreased (…). Figure 12 A), while TC levels showed no significant change ( Figure 12 B). Further qRT-PCR was used to detect the expression levels of lipid production-related genes. The results showed that the expression of lipid production-related genes such as FASN, SREBP-1, SCD1, and ACC1 in the liver tissue of mice in the HFHC+AAV8-TBG-shcircKLC1 group was significantly reduced. Figure 12 C). Western blot results showed that the expression levels of the aforementioned lipidogenesis-related proteins also decreased significantly ( Figure 12 D). Gross observation of the liver revealed that the liver color and degree of steatosis in the HFHC+AAV8-TBG-shcircKLC1 group were significantly improved compared with the control group. Figure 12E. HE staining and Oil Red O staining results further confirmed that circKLC1 knockdown significantly reduced lipid droplet deposition in liver tissue and alleviated hepatocyte steatosis. Figure 12 F).

[0071] In summary, this invention is the first to discover an abnormally elevated level of circKLC1 in MASLD and confirms its important regulatory role in lipid deposition. circKLC1 can serve not only as a diagnostic biomarker for MASLD but also as a therapeutic intervention target, demonstrating significant clinical application value.

[0072] This invention reveals for the first time the abnormally high expression of circKLC1 in metabolic dysfunction-associated fatty liver disease (MASLD) and its crucial role in lipid metabolism regulation, demonstrating that it can exacerbate lipid deposition and liver function damage by promoting the expression of lipidogenesis-related genes. Simultaneously, inhibiting circKLC1 expression significantly improves abnormal lipid accumulation and liver injury phenotypes in cell and animal models. circKLC1 not only has application value as a biomarker for early diagnosis of MASLD but also shows promise as a potential therapeutic target, thus providing new theoretical basis and application directions for the mechanistic study, clinical diagnosis, and targeted intervention of MASLD.

[0073] The scope of protection of this invention is not limited to the above embodiments. Any variations and advantages that can be conceived by those skilled in the art without departing from the spirit and scope of the inventive concept are included in this invention and are protected by the appended claims.

Claims

1. The application of a reagent for detecting circKLC1 expression levels, characterized in that, Including one or more of the following applications: (A1) Use in the preparation of products for the diagnosis or auxiliary diagnosis of fatty liver disease related to metabolic dysfunction; (A2) Application in the preparation of products for screening or assisting in the screening of fatty liver disease related to metabolic dysfunction; The nucleotide sequence of circKLC1 is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The reagent for detecting circKLC1 expression level includes specific primers for detecting circKLC1 expression; preferably, the primers are shown in SEQ ID NO.2~3.

3. A product for detecting fatty liver disease related to metabolic dysfunction, characterized in that, This includes reagents for detecting the expression level of circKLC1 in subjects.

4. The product according to claim 3, characterized in that, The reagent includes specific primers for detecting circKLC1 expression; preferably, the primers are shown in SEQ ID NO.2~3.

5. The product according to claim 3, characterized in that, The product is a reagent kit, drug, gene chip, or test strip, preferably a reagent kit.

6. The use of circKLC1 expression inhibitors in products for the treatment or adjuvant treatment of metabolic dysfunction-related fatty liver disease; preferably, the circKLC1 expression inhibitors include at least one of the following: small interfering RNA, sgRNA, gene editing vectors containing said sgRNA, shRNA, and recombinant vectors containing said shRNA.

7. The application according to claim 6, characterized in that, The circKLC1 expression inhibitor is selected from any of the following: (B1) shRNA that inhibits circKLC1 expression, the target sequence of which is shown in SEQ ID NO.4; (B2) A recombinant viral vector containing the shRNA in (B1).

8. A product for treating or adjuvant treatment of fatty liver disease related to metabolic dysfunction, characterized in that, The product contains a circKLC1 expression inhibitor.

9. The product according to claim 8, characterized in that, The circKLC1 expression inhibitor is selected from any of the following: (B1) shRNA that inhibits circKLC1 expression, the target sequence of which is shown in SEQ ID NO.4; (B2) A recombinant viral vector containing the shRNA in (B1).

10. The application of circKLC1 as a therapeutic target in the screening or adjuvant screening of products for the treatment or adjuvant treatment of fatty liver disease associated with metabolic dysfunction.

Images