A snp molecular marker related to long white pig eye muscle area and application thereof

Abstract

The application discloses a SNP molecular marker related to eye muscle area of a long white pig and application thereof, and relates to the technical field of biotechnology and molecular marker technology. The application adopts a SNP molecular marker as a detection target to determine or predict the size of eye muscle area of a long white pig. The sequence of a nucleic acid containing the SNP molecular marker is shown in SEQ ID No. 1. The SNP molecular marker is located at the 300th site from the 5' end in the nucleic acid sequence shown in SEQ ID No. 1, corresponds to the 10185432th site of the 6th chromosome of an international pig genome 11.1 version reference sequence, and the allele is C or T. The application provides an EMA related SNP molecular marker with clear location and clear effect direction, which is used for molecular determination and breeding application of the long white pig. Meanwhile, a corresponding selection and matching detection scheme is provided to improve the genetic level of a population EMA and accelerate the breeding process.

Description

Technical Field

[0001] This application relates to the fields of biotechnology and molecular marker technology, and in particular to a SNP molecular marker related to the area of ​​the eye muscle of Landrace pigs and its application. Background Technology

[0002] Eye muscle area (EMA) is a key economic trait for assessing carcass yield and meat quality in pigs, and its size directly impacts the economic benefits of pig farms. Therefore, increasing the eye muscle area of ​​a herd is one of the core objectives of pig genetic breeding. EMA is a typical quantitative trait, its phenotypic expression is jointly regulated by multiple minor genes, and it is easily influenced by non-genetic factors such as feeding management, nutritional levels, environment, and measurement techniques. This complexity means that relying solely on traditional phenotype-based selection methods results in relatively slow genetic progress, and the accuracy of measurement is limited by the cost and operational errors of in vivo measurement techniques (such as ultrasound).

[0003] With the popularization of gene technology, molecular techniques, represented by genome-wide association analysis (GWAS), have become core tools for identifying key genetic loci controlling quantitative traits. These technologies have laid the theoretical foundation for implementing marker-assisted selection (MAS) and genome-wide selection (GS), aiming to improve the accuracy of selection and generational genetic progress.

[0004] Although GWAS has identified a large number of potential EMA-related loci, EMA-associated single nucleotide polymorphism (SNP) molecular markers that can be directly and stably applied with clearly defined effects remain relatively scarce in actual breeding production. Many reported loci may be difficult to stably reproduce in different breeding systems due to population heterogeneity, small effect sizes, or statistical false positives. This directly restricts the efficiency of converting molecular markers into efficient breeding programs and also affects the speed of genetic improvement of EMA traits.

[0005] Therefore, there is an urgent need for a molecular tool with clear coordinates, convenient detection, and intuitive judgment rules to fill the technological gap from scientific research discovery to breeding application, and to provide a directly applicable technical solution for the precision breeding and population improvement of Landrace pigs. Summary of the Invention

[0006] In view of this, this application provides a SNP molecular marker related to the eye muscle area of ​​Landrace pigs and its application, and provides an EMA-associated SNP molecular marker with well-defined location and clear effect direction for molecular identification and breeding applications in Landrace pigs. At the same time, it proposes corresponding selection and supporting detection schemes to improve the genetic level of EMA in the population and accelerate the breeding process.

[0007] In a first aspect of this application, an application of an SNP molecular marker related to the area of ​​the eye muscles of Landrace pigs is provided, wherein the SNP molecular marker is used as a detection target in determining or predicting the size of the eye muscles of Landrace pigs, wherein the sequence of the nucleic acid containing the SNP molecular marker is shown in SEQ ID No. 1; the SNP molecular marker is located at the 300th position from the 5′ end in the nucleic acid sequence shown in SEQ ID No. 1, corresponding to the 10185432nd position on chromosome 6 of the International Pig Genome Version 11.1 reference sequence, and the allele is C or T.

[0008] In a second aspect of this application, a method is provided for determining the grade of eye muscle area using SNP molecular markers related to the eye muscle area of ​​Landrace pigs. The method includes: collecting a biological sample of a Landrace pig to be tested and extracting genomic DNA; detecting the genotype of the aforementioned SNP molecular markers; and determining the relative grade of eye muscle area from large to small according to the genotype-phenotype order of CC > CT > TT.

[0009] Furthermore, the detection method is selected from any one or a combination of SNP chip typing, sequencing typing, and other genotyping methods.

[0010] In a third aspect of this application, a method for SNP molecular marker-assisted selection of a Landrace pig population is provided. The method includes: detecting the genotype of the above-mentioned SNP molecular markers in Landrace breeding pigs; prioritizing the selection of Landrace pigs with CC or CT genotypes as breeding stock during mating, and culling Landrace pigs with TT genotypes.

[0011] In a fourth aspect of this application, a method for SNP molecular marker-assisted selection of a Landrace pig population is provided. The method includes: detecting the genotype of the above-mentioned SNP molecular marker in Landrace breeding pigs; prioritizing the selection of Landrace pigs with the CC genotype as breeding stock during mating, and culling Landrace pigs with the CT or TT genotypes.

[0012] Furthermore, the breeding index that complements the molecular marker-assisted selection method combines the genotypic information of SNP molecular markers with economic traits, and conducts comprehensive selection through linear selection index or optimal contribution selection; among them, economic traits include one or a combination of several of the following: body measurement / ultrasound EMA, daily weight gain, and backfat thickness.

[0013] By adopting the above technical solutions, the present invention has at least the following beneficial effects: The site coordinates and sequence anchorage are clearly defined (chr6:10185432, the 300th position from the 5' end of SEQ ID No.1), which facilitates standardized detection and mutual recognition of results; The genotype-phenotype relationship shows a stable additive trend (CC gene > CT gene > TT gene), and the determination rules are intuitive. It is compatible with common typing platforms, making it easy to apply on a large scale in breeding enterprises; It can be incorporated into the GS selection index as a functional neighbor marker of EMA, improving genetic progress and reducing assay costs.

[0014] It should be understood that the description in the Summary Section is not intended to limit the key or essential features of the embodiments of this application, nor is it intended to restrict the scope of this application. Other features of this application will become readily apparent from the following description. Attached Figure Description

[0015] The above and other features, advantages, and aspects of the embodiments of this application will become more apparent from the accompanying drawings and the following detailed description. In the drawings, the same or similar reference numerals denote the same or similar elements, wherein: Figure 1 The figure shows the phenotypic distribution and statistical characteristics of the eye muscle area of ​​Landrace pigs. The horizontal axis represents the eye muscle area corrected for 100 kg, in cm², and the vertical axis represents the density. Figure 2 This is a GWAS Manhattan plot of the ocular muscle area of ​​Landrace pigs, where the horizontal axis represents the location of the molecular marker site on the chromosome, and the vertical axis represents the −log of the molecular marker site. 10 (P); Figure 3 The graph shows the distribution of 100 kg ocular muscle area for the three genotypes of the SNP molecular marker, where the horizontal axis represents the genotype of the molecular marker and the vertical axis represents the phenotypic value of the ocular muscle area. Detailed Implementation

[0016] To make the objectives, technical solutions, and advantages of the embodiments of this disclosure clearer, the technical solutions of the embodiments of this disclosure will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of this disclosure, and not all embodiments. Based on the embodiments of this disclosure, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this disclosure.

[0017] Furthermore, the term "and / or" in this article is merely a description of the relationship between related objects, indicating that three relationships can exist. For example, A and / or B can represent: A existing alone, A and B existing simultaneously, or B existing alone. Additionally, the character " / " in this article generally indicates that the preceding and following related objects have an "or" relationship.

[0018] This invention discloses a single nucleotide polymorphism (SNP) molecular marker significantly associated with eye muscle area (EMA) in Landrace pigs and its application. The core technology lies in the fact that the C / T variation at chr6:10185432 (rs321140955) of the reference genome in International Pig Genome Version 11.1 is significantly associated with Landrace EMA, with CC > CT > TT. Based on this, molecular EMA classification and marker-assisted selection (MAS) rules can be constructed, and these rules can be combined with genome-wide selection (GS) to form a widely applicable technical system.

[0019] In a first aspect of this application, a SNP molecular marker related to the eye muscle area of ​​Landrace pigs is provided, wherein the sequence of the nucleic acid containing the SNP molecular marker is shown in SEQ ID No. 1; the SNP molecular marker is located at the 300th position from the 5′ end in the nucleic acid sequence shown in SEQ ID No. 1, corresponding to the 10185432nd position on chromosome 6 of the International Pig Genome Version 11.1 reference sequence, and the allele is C or T.

[0020] The sequence shown in SEQ ID No. 1 is: GCACTGGGAGGAGACTGGCATGTTACCCAGGAGTACCGCATGAGGGTTGGGTTTGCATGTGCCAGAGTCAGATGGGAGTGGGTACAAATCCTGCCTCAGATCTTGGCAAAAGGTTTACACGGGCTAAACAAATAATGGGACCCCCTCATACGGCT GTTTTCACACCTGTTGAGATGATATAAGCAAAATAGGATAGTCAGTGCTCGGCACACAATAATGGCTTCACAAATGGCAGTGTCACACCGTGGTTTATGCGATCTTACGAAGCTGATGGTTGCTCATTTGTATACCTTATGATGM(C / T)TTATG GAGATTCAAGTGTACCCTATCTCAGCCGCATGCGGAGGTGTCCATCAATTTCTAGTTCTCTTTTTCTTCCTGGACATACGGGAGACGACTCTTCCTAGCTTCTCTTGCAGCTAGGCGGAGTCACGAGACTCATTCTGGCCAAGGAAACGTGAGCA GAGGTGAAGTGCATCCCTTCCAGCTGCAAGAGTGAAAAACCTTCAGCTACATCTAGAGATGTAGTGTCTACCCTGGACCAGGATTCTGGAGCCACAGGCTGTAGTAGCTGTGTCCCAAGATGGCAGAACTGCAGCCCGGG, where M in the sequence list is C or T.

[0021] In a second aspect of this application, an application of SNP molecular markers related to the area of ​​the eye muscles of Landrace pigs is provided, wherein the above-mentioned SNP molecular markers are used as detection targets in determining or predicting the size of the eye muscles of Landrace pigs.

[0022] In a third aspect of this application, a method is provided for determining the grade of eye muscle area using SNP molecular markers related to the eye muscle area of ​​Landrace pigs. The method includes: collecting biological samples of Landrace pigs to be tested and extracting genomic DNA; detecting the genotype of the above-mentioned SNP molecular markers; and determining the relative grade of eye muscle area from large to small according to the genotype-phenotype order of CC > CT > TT.

[0023] In the above embodiments, the detection method is selected from any one or a combination of SNP chip typing, sequencing typing, and other genotype determination methods.

[0024] In a fourth aspect of this application, a molecular marker-assisted selection method for a Landrace pig population is provided. The molecular marker-assisted selection method includes: detecting the genotype of the above-mentioned SNP molecular marker in Landrace breeding pigs; prioritizing the selection of Landrace pigs with CC or CT genotypes as breeding stock during mating, culling Landrace pigs with TT genotypes, and gradually increasing the frequency of the C allele at this locus in consecutive generations to improve the heritability of the population's eye muscle area.

[0025] In a fifth aspect of this application, a molecular marker-assisted selection method for a Landrace pig population is provided. The molecular marker-assisted selection method includes: detecting the genotype of the above-mentioned SNP molecular marker in Landrace breeding pigs; prioritizing the selection of Landrace pigs with the CC genotype as breeding stock during mating, and culling Landrace pigs with the CT or TT genotypes; and gradually increasing the frequency of the C allele at this locus in consecutive generations to improve the heritability of the eye muscle area of ​​the population.

[0026] In the above embodiments, the breeding index that complements the molecular marker-assisted selection method combines the genotype information of SNP molecular markers with economic traits and performs comprehensive selection through linear selection index or optimal contribution selection; wherein, economic traits include one or a combination of several of the following: body measurement / ultrasound EMA, daily weight gain, and backfat thickness.

[0027] In a sixth aspect of this application, a detection kit for implementing the above method is provided. The detection kit includes primers and / or probes for amplifying or detecting the above-mentioned SNP molecular markers, a PCR reaction system, and instructions. The instructions specify the rules for determining the genotypes of the SNP molecular markers and the eye muscle area from largest to smallest as CC genotype, CT genotype, and TT genotype.

[0028] Based on the above technical solution, the present invention achieves the following practical and applicable technical effects: 1. It provides a stable and accurate molecular identification tool: The site (chr6:10185432) and its sequence (SEQ ID No.1) are precisely defined, ensuring the reproducibility and interoperability of the marker across different laboratories and detection platforms; the genotype-phenotype relationship (CC>CT>TT) shows a highly consistent additive trend in association analysis and validation, with a clear and stable effect direction, providing a simple and reliable rule for molecular identification and avoiding application confusion caused by unclear effect direction or dominant patterns.

[0029] 2. An efficient and operable breeding selection method has been established: Marker-Assisted Selection (MAS) rules are clear and can be directly applied to breeding practices. That is, individuals with CC or CT genotypes are given priority for breeding, while the use of individuals with TT genotypes is eliminated or reduced. This allows for the prediction and screening of the EMA genetic potential of breeding pigs in the core breeding population without waiting for slaughter testing. By directional selection of the C allele, genetic progress is accelerated, and its frequency in the population can be increased generation by generation, thereby systematically improving the genetic level of eye muscle area in the entire population and achieving rapid genetic improvement of the target trait.

[0030] 3. It achieves compatibility and integration with modern breeding systems: The SNP marker has a clear location and effect direction, and can be used in conjunction with SNP chip typing results, population genotype data and breeding records, which facilitates large-scale and low-cost application and promotion in breeding enterprises; at the same time, it can serve as an effective supplement to genome-wide selection (GS). The marker effect is clear and can be integrated into the genome-wide selection index as a functional neighbor marker or a known effect site to improve the prediction efficiency of EMA traits, or optimize the construction of the comprehensive selection index without increasing the measurement cost, thereby further improving the overall benefits of breeding.

[0031] 4. A closed-loop technology system from discovery to application has been formed: It not only provides a specific molecular marker, but also a set of standardized operating procedures that can be directly used to improve the quality and meat yield of Landrace pork through genetic improvement.

[0032] In summary, the technical advantage of this invention lies in successfully transforming a basic research discovery into a practical molecular breeding tool that is precisely positioned, has stable effects, is convenient to detect, has clear rules, and is easy to integrate, providing reliable technical support for the efficient genetic improvement of the key economic trait of eye muscle area in Landrace pigs.

[0033] [Example 1]: Experimental pig herd and determination of ocular muscle area phenotype 1. Experimental pig herd A total of 1,268 healthy Landrace pigs were selected from the experimental herd, originally sourced from Zhangpu County Zhao Mulan Livestock Breeding Co., Ltd. Ear tissue samples and basic genotypic and phenotypic information were provided by Fujian Aonong Biotechnology Group Co., Ltd. Ear tissue samples were collected from each individual, and basic information such as sex, date of birth, farm, litter number, and rearing environment were recorded. The pigs were raised and fattened under uniform feeding and management conditions to minimize the influence of environmental differences on the results of the ocular muscle area phenotypic measurement.

[0034] 2. Measurement of ocular muscle area phenotype During the fattening stage, experimental individuals were weighed and ultrasonically scanned according to the company's standardized testing procedures to obtain raw measurements of the extraocular muscle area (AMI). The AMI corrected at 100 kg was used as the phenotype for subsequent association analysis. The raw records were checked for missing values, outliers, and logical consistency. Samples with missing phenotypes, abnormal records, or that did not meet quality control requirements were removed, and valid phenotypic data corresponding to the genotype results were retained.

[0035] 3. Evaluation of phenotypic distribution A descriptive statistical analysis and distribution evaluation of the corrected extraocular muscle area at a weight of 100 kg were performed, and the results are as follows: Figure 1 As shown, the corrected ocular muscle area phenotype of 100kg Landrace pigs approximates a normal distribution, consistent with the phenotypic characteristics of quantitative traits, and can be used for subsequent genome-wide association analysis and candidate locus effect verification.

[0036] [Example 2]: Genotyping, quality control, and screening of SNP sites related to eye muscle area 1. DNA sample processing and microarray typing Ear tissue samples were processed using a standard animal genomic DNA extraction kit. Purity and concentration were determined using a spectrophotometer. A quality standard was met when the A260 / A280 ratio was between 1.8 and 2.0. DNA integrity was verified by agarose gel electrophoresis. All samples were genotyped using a Boredi 50K SNP chip (approximately 52,000 marker sites).

[0037] 2. Genotyping and Quality Control To improve marker coverage and data integrity, reference panels constructed based on multiple varieties / populations were used to populate the microarray data using MiniMac4 software. After population, PLINK was used for quality control: loci with a detection rate <95% (--geno0.05), minor allele frequency (MAF) <0.01, and HWE test p <1×10⁻⁶ were removed. -6 Loci were identified; samples with low detection rates were removed at the individual level. A total of 2,630,497 high-quality SNPs were obtained for analysis.

[0038] 3. Genome-wide association study (GWAS) The FarmCPU method from rMVP (R package) was used to detect the association between EMA (100kg) and SNP. The analysis employed a linear model for statistical inference, and its mathematical expression is constructed as follows: EMA=μ+ Genotype + Xγ + ε , Where μ represents the mean baseline level of the EMA trait for all individuals in the entire experiment. Genotype It is a three-level factor (CC, CT, TT).X Use fixed covariates (such as sex, birth factory / season, final weight, litter number, and principal component analysis to control for population structure). γ This is the regression coefficient vector corresponding to the fixed covariates, representing the weight of each fixed covariate's influence on the EMA trait. ε The values ​​represent residuals. Significance thresholds were corrected using Bonferroni; results were visualized using CMplot to generate Manhattan and QQ plots.

[0039] 4. Candidate sites and annotations Significant loci were annotated using bedtools according to the international pig genome version 11.1. Results showed seven loci significantly associated with EMA on autosomes, with four significant signals detected on chr6, annotated in the LOC110260910 region. The p-value of the most significant locus was 6.1655 × 10⁻⁶. -9 ,like Figure 2 As shown, its corresponding nucleotide position in SEQ ID No. 1, 300 from the 5′ end, is located on chromosome 6 (chr6:10185432) of the International Pig Genome Version 11.1 reference genome, with alleles of C or T. This site is therefore confirmed as a candidate marker related to the eye muscle area of ​​Landrace pigs as described in this invention.

[0040] 5. Association analysis between different genotypes and phenotypes Genotypic information of different individuals at this locus was extracted using PLINK software in a standard manner, including 554 individuals with the CC genotype, 572 with the CT genotype, and 142 with the TT genotype. Further, the genotypic information of these individuals was correlated with phenotypic traits, and analysis of variance (ANOVA) was performed, followed by post-hoc multiple comparisons. The results are visualized as box plots, see details below. Figure 3 As shown.

[0041] like Figure 3 The statistical results show that there are highly significant differences in EMA among the three genotypes, and the difference is additive: CC>CT>TT. Therefore, the eye muscle area from largest to smallest is CC, CT, and TT. All pairwise comparisons reached significant / highly significant levels.

[0042] Based on the above results, marker-assisted selection (MAS) can be implemented in the core population: CC / CT individuals are preferentially retained, and the proportion of TT individuals retained for breeding is reduced; the C allele frequency and population mean EMA are monitored in the annual rolling assessment, and combined with genome-wide selection (GS) or optimal contribution selection (OCS) to improve the genetic level of eye muscle area while maintaining genetic diversity.

[0043] [Example 3]: Application of rs321140955 SNP molecular marker The SNP molecular marker rs321140955, obtained through screening and verification in Examples 1 and 2, is located at position chr6:10185432 on chromosome 6 of the international pig genome version 11.1 and is a C / T mutation. Combined with genome-wide association analysis results, this locus can be genotyped using sequencing and other methods. Marker-assisted selection (MAS) can be implemented in the core population: prioritizing the retention of CC / CT individuals and reducing the proportion of TT individuals for breeding; monitoring changes in C allele frequency and population mean EMA in annual rolling assessments, and using this in conjunction with genome-wide selection (GS) or optimal contribution selection (OCS) to improve the heritability of ocular muscle area while maintaining genetic diversity.

[0044] [Example 4]: Methods and procedures for rs321140955 SNP molecular markers To achieve genotyping detection of this SNP molecular marker, this invention designed two pairs of specific primers: the first pair consists of upstream primer HC-1F (5′-TACCCAGGAGTACCGCATGA (SEQ ID No. 4)-3′) and downstream primer HC-1R (5′-GCTGCAGTTCTGCCATCTTG (SEQ ID No. 5)-3′), which amplifies a 572bp target fragment (SEQ ID No. 2) using Landrace pig genomic DNA as a template; the second pair consists of upstream primer HC-2F (5′-GGCAAAAGGTTTACACGGGC (SEQ ID No. 6)-3′) and downstream primer HC-2R (5′-GCTACTACAGCCTGTGGCTC (SEQ ID No. 7)-3′), which amplifies a 464bp target fragment (SEQ ID No. 3). The amplification products of both primer pairs completely cover the target SNP site at position 300 from the 5′ end of SEQ ID No. 1, and the primers themselves do not overlap with this site.

[0045] Using the genomic DNA of the Landrace pig as a template, PCR amplification was performed using the primers described above. The reaction volume was 20 μL, including 10 μL of 2×PCR premix, 0.8 μL each of forward and reverse primers (10 μM), and 1 μL of genomic DNA template, with sterile deionized water added to a final volume of 20 μL. The PCR amplification program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles; and a final extension at 72℃ for 5 min. The amplified products were detected by 1.5% agarose gel electrophoresis. After confirming the presence of a single target band of the expected size (572 bp for the first primer pair HC-1F / HC-1R and 464 bp for the second primer pair HC-2F / HC-2R), the amplified products were purified and used in subsequent sequencing reactions.

[0046] PCR amplification was performed on the genomic DNA of the Landrace pig to be tested using any of the above primer pairs. After the amplification products were sequenced by Sanger, the sequencing peak diagram was compared with the reference sequence shown in SEQ ID No.1. Based on whether the site has a C peak, a T peak, or a C / T double peak, the individual genotype can be determined as CC, CT, or TT.

[0047] The sequence shown in SEQ ID No. 2 is: TACCCAGGAGTACCGCATGAGGGTTGGGTTTGCATGTGCCAGAGTCAGATGGGAGTGGGTACAAATCCTGCCTCAGATCTTGGCAAAAGGTTTACACGGGCTAAACAAATAATGGGACCCCCTCATACGGCTGTTTTCACACCTGTTGAGATGA TATAAGCAAAATAGGATAGTCAGTGCTCGGCACACAATAATGGCTTCACAAATGGCAGTGTCACACCGTGGTTTATGCGATCTTACGAAGCTGATGGTTGCTCATTTGTATACCTTATGATGM(C / T)TTATGG AGATTCAAGTGTACCCTATCTCAGCCGCATGCGGAGGTGTCCATCAATTTCTAGTTCTCTTTTTCTTCCTGGACATACGGGAGACGACTCTTCCTAGCTTCTCTTGCAGCTAGGCGGAGTCACGAGACTCATTC TGGCCAAGGAAACGTGAGCAGAGGTGAAGTGCATCCCTTCCAGCTGCAAGAGTGAAAAACCTTCAGCTACATCTAGAGATGTAGTGTCTACCCTGGACCAGGATTCTGGAGCCACAGGCTGTAGTAGCTGTGTCC CAAGATGGCAGAACTGCAGC Note: M in the sequence indicates the mutation site (the mutated base in parentheses indicates an allele mutation), and the underlined part indicates the primer binding position.

[0048] The sequence shown in SEQ ID No. 3 is: GGCAAAAGGTTTACACGGGCTAAACAAATAATGGGACCCCCTCATACGGCTGTTTTCACACCTGTTGAGATGATATAAGCAAAATAGGATAGTCAGTGCTCGGCACACAATAATGGCTTCACAAATGGCAGTGTCACACCGTGGTTTATGCGATCTTACGAAGCTGATGGTTGCTCATTTGTATACCTTATGATGM(C / T)TTATGGAGATTCAAGTGTACCCTATCTCAGCCG CATGCGGAGGTGTCCATCAATTTCTAGTTCTCTTTTTCTTCCTGGACATACGGGAGACGACTCTTCCTAGCTTCTTGCAGCTAGGCGGAGTCACGAGACTCATTCTGGCCAAGGAAACGTGAGCAGAGGTGAAGTGCATCCCTTCCAGCTGCAAGAGTGAAAAACCTTCAGCTACATCTAGAGATGTAGTGTCTACCCTGGACCAGGATTCTG GA GCCACAGGCTGTAGTAGC Note: M in the sequence indicates the mutation site (the mutated base in parentheses indicates an allele mutation), and the underlined part indicates the primer binding position.

[0049] The above description is merely a preferred embodiment of this application and an explanation of the technical principles employed. Those skilled in the art should understand that the scope of this application is not limited to technical solutions formed by specific combinations of the above-described technical features, but should also cover other technical solutions formed by arbitrary combinations of the above-described technical features or their equivalents without departing from the foregoing application concept. For example, technical solutions formed by substituting the above features with (but not limited to) technical features with similar functions claimed in this application.

Claims

1. The application of a SNP molecular marker related to the area of ​​the eye muscles in Landrace pigs, characterized in that, The application of SNP molecular markers as detection targets in determining or predicting the size of the ocular muscles in Landrace pigs; among which... The sequence of the nucleic acid containing the SNP molecular marker is shown in SEQ ID No. 1; The SNP molecular marker is located at the 300th position from the 5′ end in the nucleic acid sequence shown in SEQ ID No. 1, corresponding to the 10185432nd position on chromosome 6 of the international pig genome version 11.1 reference sequence, and the allele is C or T.

2. A method for determining the grade of ocular muscle area using SNP molecular markers related to ocular muscle area in Landrace pigs, characterized in that, The method includes: Biological samples were collected from the Landrace pigs to be tested, and genomic DNA was extracted. Detecting the genotype of SNP molecular markers; The relative ranking of extraocular muscle area from largest to smallest was determined according to the genotype-phenotype order: CC > CT > TT. The sequence of the nucleic acid containing the SNP molecular marker is shown in SEQ ID No. 1; The SNP molecular marker is located at the 300th position from the 5′ end in the nucleic acid sequence shown in SEQ ID No. 1, corresponding to the 10185432nd position on chromosome 6 of the international pig genome version 11.1 reference sequence, and the allele is C or T.

3. The method according to claim 2, characterized in that, The detection method is selected from any one or a combination of SNP chip typing, sequencing typing, and other genotype determination methods.

4. A method for SNP molecular marker-assisted selection in a Landrace pig population, characterized in that, The method includes: Genotyping of SNP molecular markers in Landrace breeding pigs; During mating, Landrace pigs with the CC or CT genotypes are given priority for breeding, while Landrace pigs with the TT genotype are culled; among them, The sequence of the nucleic acid containing the SNP molecular marker is shown in SEQ ID No. 1; The SNP molecular marker is located at the 300th position from the 5′ end in the nucleic acid sequence shown in SEQ ID No. 1, corresponding to the 10185432nd position on chromosome 6 of the international pig genome version 11.1 reference sequence, and the allele is C or T.

5. A method for SNP molecular marker-assisted selection in a Landrace pig population, characterized in that, The method includes: Genotyping of SNP molecular markers in Landrace breeding pigs; During mating, Landrace pigs with the CC genotype are given priority for breeding, while Landrace pigs with the CT or TT genotypes are culled; among them, The sequence of the nucleic acid containing the SNP molecular marker is shown in SEQ ID No. 1; The SNP molecular marker is located at the 300th position from the 5′ end in the nucleic acid sequence shown in SEQ ID No. 1, corresponding to the 10185432nd position on chromosome 6 of the international pig genome version 11.1 reference sequence, and the allele is C or T.

Images