MNP marker combination based on hainan yellow rosewood and its application in variety identification

Abstract

The application discloses a MNP marker combination based on Hainan yellow rosewood and application thereof in variety identification, and belongs to the technical field of molecular markers and germplasm resource identification.The application obtains 28 MNP candidate markers based on whole genome resequencing data of 303 Hainan yellow rosewood family groups, and designs specific amplification primers. Verification is conducted by using 40 independent samples, the detection rate of the 28 MNP sites reaches 100%, the average PIC value is 0.3651, and the average DP value is 0.4262. Based on the three markers MNP_003, MNP_039 and MNP_041 with the highest PIC value, a DNA molecular identity card of the 40 samples is constructed, and the individual identification rate reaches 100%. The application provides an efficient and accurate technical tool for Hainan yellow rosewood variety identification, germplasm resource protection and molecular breeding, has a wide application prospect in the field of germplasm resource research and plant breeding, and can provide a technical means for Hainan yellow rosewood germplasm resource evaluation and genetic improvement.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker and germplasm resource identification technology, specifically relating to an MNP marker combination based on Hainan rosewood and its application in variety identification. Background Technology

[0002] Hainan rosewood (Dalbergia odorifera), scientifically known as Dalbergia odorifera, is a commercially known Hainan fragrant rosewood. Its other names include rosewood, fragrant redwood, flower palm, fragrant wood, and Hainan rosewood. It is an evergreen and semi-deciduous tree belonging to the Dalbergia genus of the Fabaceae family. It is a species endemic to Hainan Island, listed as a national second-class key protected rare and endangered plant, and has important economic value.

[0003] Currently, research on Hainan rosewood mainly focuses on its growth characteristics, propagation techniques, and cultivation management, while research on genetic diversity analysis and precise identification of germplasm resources is relatively weak. In molecular identification, some studies have attempted to use markers such as RAPD, ISSR, and SRAP for genetic diversity analysis. However, these markers have shortcomings in terms of stability, information content, and detection efficiency. Specifically, SSR markers are prone to producing "stutter bands" due to PCR amplification slippage, affecting the accuracy of genotype identification (Hosseinzadeh-Colagar et al., 2016); SNP markers, due to their diallelic nature, have limited information content per locus, resulting in low detection efficiency. To overcome the shortcomings of these traditional molecular markers, multiple nucleotide polymorphism (MNP) markers refer to polymorphic markers composed of two or more linked SNP loci within the same amplification region, using combined haplotypes as alleles in genetic parameter calculations. Compared to traditional markers such as SSR and SNP, MNP markers have the characteristics of high information content, strong discriminative ability, and high detection throughput, effectively improving the accuracy and efficiency of variety identification.

[0004] Currently, MNP markers have been applied in crops such as cotton, rice, corn, and soybeans, but there are no reports on their application in the identification of Hainan rosewood varieties and the construction of fingerprint profiles. Summary of the Invention

[0005] To overcome the shortcomings of existing molecular marker technologies in identifying Hainan rosewood, the first objective of this invention is to provide a primer set based on MNP marker combinations of Hainan rosewood; the second objective is to provide a kit for detecting MNP marker combinations; the third objective is to provide a method for constructing a DNA molecular identity card for Hainan rosewood; the fourth objective is to provide a method for analyzing genetic variation in Hainan rosewood; the fifth objective is to provide a method for identifying Hainan rosewood varieties; and the sixth objective is to provide an application of the primer set based on MNP marker combinations in the identification of Hainan rosewood varieties, germplasm resource protection, or seed purity detection. This invention solves the problems of low efficiency and insufficient molecular markers in the identification of precious tree species in existing technologies. By clarifying the screening criteria for MNP marker sites, developing species-specific MNP marker sites, and constructing a digital DNA fingerprint, rapid, accurate, and efficient identification of Hainan rosewood is achieved, providing technical support for germplasm resource protection, genetic diversity analysis, improved variety breeding, and variety rights protection.

[0006] In this invention, DNA fingerprinting refers to an electrophoretic pattern or digital code obtained by screening for species-specific and highly polymorphic molecular markers on the genome, and then analyzing the sample DNA to reflect its genetic characteristics. DNA fingerprinting has high individual specificity and environmental stability, and can be used to distinguish different varieties or individuals.

[0007] In this invention, the DNA molecular ID card refers to a unique identifier generated by digitally encoding the genetic information of a variety or individual based on DNA fingerprint data. The DNA molecular ID card can be used for the digital management of germplasm resources, variety ownership confirmation, and traceability.

[0008] The first objective of this invention is achieved by the MNP tag combination comprising at least one of the following 28 MNP tags: MNP_001_chr01A_2571044_2571172, MNP_003_chr01A_32383041_32383197, MNP_004_chr01A_76737812_76737921, MNP_005_chr01A_80816867_80816896, MNP_006_chr02A_15622135_15622246, MNP_007_chr02A_15629269_15629424, M... NP_009_chr02A_16800134_16800254, MNP_010_chr02A_24986574_24986675, MNP_012_chr02A_74699419_74699476, MNP_013_chr03A_2575375 7_25753786, MNP_015_chr03A_26981200_26981268, MNP_016_chr03A_39739461_39739563, MNP_017_chr03A_51877321_51877440, MNP_018_chr 03A_57086260_57086310, MNP_019_chr03A_57092145_57092207, MNP_020_chr03A_57463859_57464039, MNP_023_chr04A_35800205_35800250 , MNP_024_chr04A_42152519_42152689, MNP_025_chr04A_42153349_42153482, MNP_027_chr04A_52867248_52867363, MNP_029_chr04A_541638 85_54163980, MNP_031_chr05A_42055031_42055112, MNP_032_chr05A_43634633_43634795, MNP_034_chr05A_56599346_56599436, MNP_035_c hr06A_7886056_7886092, MNP_039_chr06A_24105775_24105811, MNP_040_chr07A_20651237_20651311, MNP_041_chr07A_41342891_41343033;

[0009] The primer set for amplifying the MNP marker combination includes 28 primer pairs, and the nucleotide sequences of the 28 primer pairs are shown in SEQ ID NO.1-SEQ ID NO.56.

[0010] The second objective of the present invention is achieved by the kit comprising a set of primers for amplifying MNP marker combinations.

[0011] The third objective of this invention is achieved by providing a method for constructing a DNA molecular identity card from Hainan rosewood, comprising the following steps:

[0012] (1) Extract genomic DNA from the Hainan rosewood sample to be tested;

[0013] (2) Using the DNA extracted in step (1) as a template, multiplex PCR amplification was performed using primers with MNP markers;

[0014] (3) Perform high-throughput sequencing on the amplification products to obtain genotype data for each MNP locus;

[0015] (4) Based on the genotype data of the three core MNP markers MNP_003, MNP_039 and MNP_041, the DNA molecular identification code of the sample is formed by sequentially concatenating them; the format of the DNA molecular identification code formed by sequentially concatenating them is as follows: the 14 sub-site codes of MNP_003, the 10 sub-site codes of MNP_039 and the 3 sub-site codes of MNP_041 are separated by "|" and concatenated in sequence; each sub-site is coded as 0 when it is consistent with the reference genome sequence, and coded as 1 when it is inconsistent.

[0016] Preferably, the PIC values ​​of the three core MNP markers are 0.8717, 0.8403 and 0.5392, respectively.

[0017] The fourth objective of this invention is achieved as follows: a method for analyzing genetic variation in Hainan Huanghuali (Dalbergia odorifera), wherein the genetic variation refers to the nucleotide differences between different individuals of Hainan Huanghuali at 28 MNP marker loci relative to the sequence shown in the reference genome; the genetic variation information of each MNP marker locus is obtained by comparing the sequencing data of that locus with the reference genome sequence and is presented in the form of alleles, specifically including:

[0018] (a) Allelic information: The number of alleles detected at each MNP marker site ranged from 2 to 16, with a total of 98 alleles detected (corresponding to the Na values ​​in Table 5).

[0019] (b) Polymorphic Information Content (PIC): The range is 0.0476 to 0.8717, and the average value is 0.3651 (corresponding to the PIC values ​​in Table 5).

[0020] (c) Discrimination (DP): The range was 0.0488 to 0.8825, and the average value was 0.4262 (corresponding to the DP values ​​in Table 5).

[0021] (d) Heterozygosity information: The average observed heterozygosity (Ho) is 0.7857, and the average expected heterozygosity (He) is 0.4345. The heterozygosity frequency is concentrated between 40% and 65% (corresponding to the Ho and He values ​​in Table 5).

[0022] (e) Highly variable regions: MNP_003_chr01A_32383041_32383197 (Na=16, PIC=0.8717) and MNP_039_chr06A_24105775_24105811 (Na=10, PIC=0.8403) are highly variable regions in the genome of Hainan rosewood.

[0023] Preferably, the reference genome nucleotide sequence is shown in SEQ ID NO.57-SEQ ID NO.84. The sequences shown in SEQ ID NO.57-SEQ ID NO.84 simultaneously contain the core polymorphic region of 28 MNP marker sites and their upstream and downstream flanking sequences, serving as a reference benchmark for subsequent genotype identification and genetic variation analysis.

[0024] The fifth objective of this invention is achieved by providing a method for identifying Hainan rosewood varieties, comprising the following steps:

[0025] (1) Extract genomic DNA from the Hainan rosewood sample to be tested;

[0026] (2) Using the DNA extracted in step (1) as a template, multiplex PCR amplification was performed using primers with MNP markers;

[0027] (3) Perform high-throughput sequencing on the amplification products to obtain genotype data for each MNP locus;

[0028] (4) Compare the MNP locus genotype data of the sample to be tested with the control sample, and determine the variety based on the genotype difference to achieve the identification of Hainan rosewood varieties. Specifically, compare the MNP locus genotype data of the sample to be tested with the MNP locus genotype data of the control sample of known varieties. If the genotypes of the two are completely consistent at the 28 MNP loci, they are determined to be the same variety; otherwise, they are determined to be different varieties.

[0029] Preferably, the reaction system for multiplex PCR amplification in step (2) is as follows: 2 μL DNA template (10 ng / μL); 1 μL upstream primer pool (10 μM); 1 μL downstream primer pool (10 μM); 15 μL 2 × PCR Ready Mix, and double-distilled water to a total volume of 25 μL.

[0030] Preferably, the reaction program for multiplex PCR amplification in step (2) is as follows: 98°C pre-denaturation for 3 min; 8 cycles of 98°C denaturation for 30 sec, 50°C annealing for 30 sec, and 72°C extension for 30 sec; followed by 25 cycles of 98°C denaturation for 30 sec, 66°C annealing for 30 sec, and 72°C extension for 30 sec; and finally, 72°C extension for 5 min.

[0031] The sixth objective of this invention is achieved by the application of a primer set of MNP marker combinations in the identification of Hainan rosewood varieties, protection of germplasm resources, or detection of seed purity.

[0032] This invention also includes a method for developing MNP markers and constructing fingerprint maps of Hainan rosewood, comprising the following steps:

[0033] (1) Sample collection and DNA extraction: Hainan rosewood samples were collected for testing, and genomic DNA was extracted from the samples. Specifically, single leaves of each variety were mixed and thoroughly ground into powder with liquid nitrogen, and genomic DNA was extracted using the Tiangen reagent kit method; the DNA concentration was detected using a Qubit nucleic acid quantification instrument, and the DNA quality was detected by agarose gel electrophoresis. A total of 40 DNA samples were tested, including 20 natural population samples and 20 family population samples;

[0034] (2) Whole genome resequencing and SNP detection;

[0035] (3) MNP locus mining and screening: Using 303 Hainan rosewood family population samples as research materials, the whole genome sequence of Hainan rosewood was obtained through genome sequencing technology. The whole genome sequence was screened for variant sites to identify species-specific and highly polymorphic MNP loci, thus completing the development of MNP markers. The screening criteria for the Hainan rosewood MNP loci development were: consecutive SNP count ≥ 2, PIC > 0.5, MAF ≥ 0.2, and DP (discrimination) > 0.2. A total of 28 Hainan rosewood MNP markers were identified.

[0036] (4) Multiplex PCR primer design and validation: For the 28 MNP markers obtained in step (3), specific multiplex PCR amplification primers were designed. A pair of specific primers were designed for each MNP marker, and the length of the amplification product was controlled between 175 and 231 bp. The primer sequences are shown in Table 3.

[0037] (5) Multiplex PCR amplification and library construction: Based on the MNP marker developed above, using the Hainan rosewood genomic DNA extracted in step (1) as a template, multiplex PCR amplification was performed using the specific primers designed in step (4). After purifying the PCR amplification products, a sequencing library was constructed according to the conventional high-throughput library construction process.

[0038] (6) High-throughput sequencing and data quality control: The qualified libraries in step (5) are subjected to high-throughput sequencing to obtain raw sequencing data; the raw data are filtered for quality control (removing adapter contamination, low-quality bases and short sequences) to obtain clean data that can be used for subsequent analysis;

[0039] (7) DNA fingerprinting and genetic diversity analysis: The quality control qualified data in step (6) are compared with the reference genome, and the MNP marker genotype information of Hainan rosewood is extracted for each sample. Based on the genotype information, the DNA fingerprint of Hainan rosewood is constructed to realize the identification of Hainan rosewood varieties. For any two samples, if the major genotype and minor genotype composition are completely identical at the commonly detected MNP loci, they are judged to be consistent in type; otherwise, they are inconsistent in type. At the same time, genetic diversity analysis is performed based on the genotype data (including the number of alleles, observed heterozygosity, expected heterozygosity, polymorphism information content, genetic distance, phylogenetic tree, principal component analysis and population differentiation coefficient, etc.) to comprehensively evaluate the genetic structure of Hainan rosewood germplasm resources.

[0040] The beneficial effects achieved by this invention are:

[0041] 1. This invention addresses the technical need for precise identification of Hainan rosewood germplasm resources. Through whole-genome resequencing and MNP marker development, 28 candidate MNP markers were screened and specific amplification primers were designed. Validation on 40 independent samples showed a 100% detection rate for the 28 loci, with an average PIC value of 0.3651 and an average DP value of 0.4262. Based on these markers, DNA fingerprinting of the 40 samples was constructed, achieving a 100% individual identification rate, thus realizing precise identification and digital management of Hainan rosewood germplasm resources.

[0042] 2. This invention provides an MNP marker combination for the identification of Hainan rosewood, comprising 28 MNP markers and their specific amplification primers (the correspondence between marker names and primer sequences is shown in Table 3). Only 28 markers are needed to achieve a 100% individual identification rate, resulting in high detection efficiency and low cost, making it suitable for large-scale application.

[0043] 3. This invention constructs a DNA molecular identity card for Hainan rosewood. Based on the genotype codes of three core markers—MNP_003 (PIC=0.8717), MNP_039 (PIC=0.8403), and MNP_041 (PIC=0.5392)—a 27-digit molecular identity card code for each sample is generated by concatenation, and further converted into QR codes and barcode labels. By scanning the QR code, the variety name, sample number, sample origin, molecular identity card code, and testing information can be obtained, realizing the digital identification and traceability management of germplasm resources. Attached Figure Description

[0044] To more clearly describe the inventive objectives, technical solutions, and advantages of the specific embodiments of the present invention, the solutions in the specific embodiments of the present invention will be described in detail below with reference to the accompanying drawings. The drawings are used to provide a further understanding of the present invention and constitute a part of this specification. They are used together with the embodiments of the present invention to explain the present invention and do not constitute a limitation thereof. It should be noted that the scope of protection of the present invention is not limited to the specific structures, steps, or parameters shown in the drawings. The features in the drawings are only used to schematically illustrate the technical solutions of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention. In the drawings:

[0045] Figure 1 This is a statistical chart showing the detection rate of the 28 MNP markers of this invention in 40 test samples.

[0046] Figure 2 This is a distribution diagram of the polymorphic information content (PIC) of the 28 MNP markers in this invention.

[0047] Figure 3 This is a histogram showing the frequency distribution of heterozygous alleles in 40 test samples from this invention.

[0048] Figure 4 This is a histogram showing the genetic distance distribution of 40 test samples in this invention.

[0049] Figure 5 This is a scatter plot of principal component analysis (PCA) of 40 test samples in this invention.

[0050] Figure 6 This is the phylogenetic tree of the 40 test samples of this invention using the neighbor-joining (NJ) method. Detailed Implementation

[0051] The specific technical solutions involved in the following specific embodiments are merely for the purpose of clearly and completely describing the innovative technical solutions of the present invention. They are only a part of the specific implementation schemes that the present invention can adopt, not all the embodiments, and should not be construed as limiting the innovative solutions of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort, as long as they adopt the same or similar inventive concept and technical solutions as the present invention, are within the scope of protection of the present invention.

[0052] The specific experimental conditions listed in the following embodiments are merely illustrative examples. Those skilled in the art can make equivalent adjustments or optimizations according to actual needs without departing from the concept of the present invention, and such adjustments all fall within the protection scope of the present invention.

[0053] The routine experimental procedures involved in this specific embodiment, such as DNA extraction, multiplex PCR amplification, sequencing library construction, and electrophoresis detection, all employ conventional techniques known in the art and will not be elaborated upon here.

[0054] Example 1

[0055] A method for developing MNP markers for Hainan rosewood includes the following steps:

[0056] 1. Collection of resequencing materials and DNA extraction

[0057] The MNP marker development population consisted of 303 closely related F1 families from mixed open-pollination cultivation (number A). 001 - A 303In March 2019, this group collected seeds from eight healthy, open-pollinated Hainan rosewood mother trees in Jianfengling, Hainan, and subsequently sowed them in sand beds at the Agricultural Science Base of Hainan University's Danzhou Campus. In January 2020, the F1 generation seedlings from four of the more vigorous mother trees were selected and transplanted to the base nursery at a density of 1.5 m × 1.5 m. In September 2021, the 303 surviving F1 generation individuals were uniformly numbered, and 10 tender leaves were collected from each tree, flash-frozen in liquid nitrogen, and stored at -80°C for later use. DNA extraction from the leaf samples was performed using the Tiangen Genomic DNA Rapid Extraction Kit. At least 10 leaves from each tree were pooled and thoroughly ground into powder using liquid nitrogen, and total DNA was extracted from the samples using the kit. After completion, the concentration of the obtained DNA was determined using a Qubit 4.0 quantitative PCR instrument, and the DNA purity was detected by agarose gel electrophoresis and spectrophotometry. The A260 / A280 ratio was between 1.8 and 2.0 to ensure high-quality genomic DNA. The extracted DNA was stored at -80°C for later use.

[0058] 2. Whole-genome resequencing and MNP locus development

[0059] DNA samples from 303 F1 generation families passed quality testing and were used for whole-genome resequencing analysis. The acceptable standards were a DNA concentration of at least 5 ng / μL, an A260 / A280 ratio between 1.8 and 2.2, and an A260 / A230 ratio of at least 2.0. Library construction and sequencing were performed by Annoroad Genetics (Beijing) Co., Ltd., using the standard workflow of the DNBSEQ-T7 sequencing platform, with a sequencing depth of approximately 10×.

[0060] The raw sequencing data was first processed using FASTP software to filter and remove sequences contaminated with adapters, of low quality, or with an N base content exceeding 5%, ultimately yielding clean data suitable for subsequent analysis. Variant site detection was performed using the Sentieon Genome Analysis Toolkit (v202112.04), following the software's standard workflow based on the filtered clean data. Subsequently, the Select Variants module in GATK software (v4.3.0.0) was used to isolate SNPs and extract genotypic information. After initial filtering, a total of 11,853,845 high-quality SNP sites were obtained, with the filtering criteria being a minor allele frequency greater than 0.01 and a deletion rate less than 5%.

[0061] Based on the filtered SNP loci, a Python script was used to merge adjacent SNPs into MNP markers. Another Python script was written to calculate the polymorphism information content (PIC) and the maximum minor allele frequency (MAF), and to screen candidate MNP loci. The screening criteria were: distance within 300 bp, containing at least two SNPs, and a PIC > 0.5, MAF ≥ 0.2, and discriminant power (DP) > 0.2, while also meeting the requirement of uniform genomic distribution. A total of 28 preliminary candidate MNP marker loci were obtained.

[0062] Table 1 Information on 28 MNP sites

[0063] Serial Number MNP tag name chromosome Corresponding SEQ ID NO Location of MNP markers in the fragment 1 MNP_001_chr01A_2571044_2571172 chr01A 57 Positions 301–429 2 MNP_003_chr01A_32383041_32383197 chr01A 58 Positions 301–457 3 MNP_004_chr01A_76737812_76737921 chr01A 59 Positions 301–410 4 MNP_005_chr01A_80816867_80816896 chr01A 60 Positions 301–330 5 MNP_006_chr02A_15622135_15622246 chr02A 61 Positions 301–412 6 MNP_007_chr02A_15629269_15629424 chr02A 62 301–456 7 MNP_009_chr02A_16800134_16800254 chr02A 63 Positions 301–421 8 MNP_010_chr02A_24986574_24986675 chr02A 64 Positions 301–402 9 MNP_012_chr02A_74699419_74699476 chr02A 65 Positions 301–358 10 MNP_013_chr03A_25753757_25753786 chr03A 66 Positions 301–330 11 MNP_015_chr03A_26981200_26981268 chr03A 67 Positions 301–369 12 MNP_016_chr03A_39739461_39739563 chr03A 68 Positions 301–403 13 MNP_017_chr03A_51877321_51877440 chr03A 69 Positions 301–420 14 MNP_018_chr03A_57086260_57086310 chr03A 70 Positions 301–351 15 MNP_019_chr03A_57092145_57092207 chr03A 71 Positions 301–363 16 MNP_020_chr03A_57463859_57464039 chr03A 72 Positions 301–481 17 MNP_023_chr04A_35800205_35800250 chr04A 73 Positions 301–346 18 MNP_024_chr04A_42152519_42152689 chr04A 74 Positions 301–471 19 MNP_025_chr04A_42153349_42153482 chr04A 75 301–434 20 MNP_027_chr04A_52867248_52867363 chr04A 76 Positions 301–416 21 MNP_029_chr04A_54163885_54163980 chr04A 77 Positions 301–396 22 MNP_031_chr05A_42055031_42055112 chr05A 78 Positions 301–382 23 MNP_032_chr05A_43634633_43634795 chr05A 79 301–463 24 MNP_034_chr05A_56599346_56599436 chr05A 80 Positions 301–391 25 MNP_035_chr06A_7886056_7886092 chr06A 81 Positions 301–337 26 MNP_039_chr06A_24105775_24105811 chr06A 82 Positions 301–337 27 MNP_040_chr07A_20651237_20651311 chr07A 83 Positions 301–375 28 MNP_041_chr07A_41342891_41343033 chr07A 84 Positions 301–443

[0064] Example 2

[0065] A method for verifying MNP molecular markers in Hainan rosewood includes the following steps:

[0066] 1. Genomic DNA extraction

[0067] Forty young leaves of Hainan rosewood were collected, including 20 family populations and 20 natural populations. Genomic DNA was extracted from Hainan rosewood using the Tiangen reagent kit. DNA concentration was detected using a Qubit 4.0 real-time fluorescence instrument, and DNA integrity was checked by 1% agarose gel electrophoresis to ensure that the DNA quality met the requirements for multiplex PCR.

[0068] Table 2. DNA sample information used for multiplex PCR

[0069] Sample number Sample source Sample varieties DNA concentration (ng / μL) A260 / A280 1 A-3 Family Group 186.4 1.96 2 A-11 Family Group 167.3 1.84 3 A-21 Family Group 683.8 1.83 4 A-36 Family Group 154.2 1.85 5 A-46 Family Group 269.6 1.84 6 A-50 Family Group 137.4 1.81 7 A-60 Family Group 378.9 1.82 8 A-66 Family Group 327.2 1.86 9 A-78 Family Group 268.8 1.88 10 A-83 Family Group 715.9 1.81 11 A-87 Family Group 353.1 1.86 12 A-96 Family Group 231.6 1.83 13 A-109 Family Group 144.3 1.81 14 A-116 Family Group 175.3 1.84 15 A-156 Family Group 390.1 1.82 16 A-168 Family Group 196.4 1.83 17 A-174 Family Group 187.4 1.86 18 A-188 Family Group 338.1 1.85 19 A-225 Family Group 504.1 1.87 20 A-242 Family Group 107.0 1.85 21 F-3 Natural groups 660.1 1.81 22 F-14 Natural groups 251.0 1.84 23 F-027 Natural groups 297.8 1.82 24 F-037 Natural groups 409.1 1.84 25 F-042 Natural groups 493.6 1.84 26 F-057 Natural groups 408.3 1.85 27 F-063 Natural groups 187.2 1.84 28 F-078 Natural groups 309.6 1.85 29 F-088 Natural groups 362.7 1.88 30 F-99 Natural groups 228.6 1.83 31 F-100 Natural groups 378.5 1.85 32 F-118 Natural groups 419.6 1.85 33 F-129 Natural groups 160.0 1.81 34 F-139 Natural groups 262.9 1.83 35 F-145 Natural groups 777.7 1.83 36 F-149 Natural groups 418.4 1.84 37 F-151 Natural groups 496.2 1.86 38 F-168 Natural groups 246.7 1.84 39 F-174 Natural groups 231.0 1.85 40 F-191 Natural groups 248.4 1.92

[0070] 2. MNP primer design

[0071] Based on 28 previously developed MNP molecular markers, multiplex PCR amplification primers were designed. A pair of specific primers was designed for each MNP marker, with the amplification product length controlled between 175 and 231 bp. Primer design principles included: primer length 18–25 bp, GC content 40%–60%, annealing temperature 58℃–62℃, and avoidance of primer dimers and hairpin structures. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and dissolved in 1×TE solution to a concentration of 10 μmol / L for later use. The primer sequences for the Hainan rosewood MNP markers developed in this invention are shown in Table 3.

[0072] Table 3. MNP marker primer sequence information for Hainan rosewood

[0073] Serial Number MNP tag name Upstream primer sequence (5′→3′) Downstream primer sequence (5′→3′) Product length (bp) 1 MNP_001 CGTATGGCATTGGGGCTATT (SEQ ID NO.1) AAGGTCACCTCAAGACACCTTGT (SEQ ID NO.2) 200 2 MNP_003 AGTGCATCCCACCTTTTTCC (SEQ ID NO.3) GAGGGAAGAAGCATGCCTAGAA (SEQ ID NO.4) 231 3 MNP_004 CAAACCTAAGCGATACATTCAAAAC (SEQ ID NO.5) TGTTTGATGCATTGGGTTGC (SEQ ID NO.6) 217 4 MNP_005 AACTTGAAGAGAGGAAAGTACGAA (SEQ ID NO.7) CGTTCAGAAGTTGTAACGATCC (SEQ ID NO.8) 178 5 MNP_006 CGACGACAATCCAATCCAAA(SEQ ID NO.9) AAATAACTTGAGAGGAACACACTTG(SEQ ID NO.10) 181 6 MNP_007 GGAGTCTCCGCATTCTGCAT(SEQ ID NO.11) ATGGGGCTCATGGCTACCTA(SEQ ID NO.12) 195 7 MNP_009 TGCCTTTTACCATTCTTCTCACTC(SEQ ID NO.13) TCCCTTATGCATAGCAATTCTCA(SEQ ID NO.14) 191 8 MNP_010 TCTTTTAGCCACTTTAGTGTTTAGTCG(SEQ ID NO.15) AGTTTTTGGCCAATGCCACT(SEQ ID NO.16) 200 9 MNP_012 CGATTTCAGGGTTCTGAATTTGA(SEQ ID NO.17) CTATGCAATGAAGCTGAAACACTC(SEQ ID NO.18) 175 10 MNP_013 CCACCCAGGGGTTGGTATTA(SEQ ID NO.19) GGACATATCGCCCCATGCT(SEQ ID NO.20) 178 11 MNP_015 TCAGTACGAAGTGGGTGTTTAGGA(SEQ ID NO.21) TCCATTGAAGACGGTAAAAGCA(SEQ ID NO.22) 177 12 MNP_016 CATTCACGACTTGCTTTCATGG(SEQ ID NO.23) TTGGCTATGCAGATGCAGGA(SEQ ID NO.24) 175 13 MNP_017 TGTTTTGTCCATTGGAAATGCT(SEQ ID NO.25) CAGGGAAGATTCAAAGTTTTGTGG(SEQ ID NO.26) 206 14 MNP_018 CTCGTGTTTCCGATTAGGTTTTG(SEQ ID NO.27) GAAGAGCTGAACGACAGATCG(SEQ ID NO.28) 175 15 MNP_019 TCAGATTGTATCAGCGATGGTG(SEQ ID NO.29) AATATTGAATGGATGCCATGTGGT(SEQ ID NO.30) 176 16 MNP_020 CAAAAGCAACTTCCCAGCAG(SEQ ID NO.31) TCATTTCAGCCCAAATTGCT(SEQ ID NO.32) 184 17 MNP_023 GGATATCTGCAAGTTAGTTTAGAGTGC(SEQ ID NO.33) TTGATAAGATGGTGCAACAAAGG (SEQ ID NO.34) 177 18 MNP_024 TCCTAACTTCCCTTTGCACTCC (SEQ ID NO.35) TGAGAAGAACCTGCCTCTAGCA (SEQ ID NO.36) 196 19 MNP_025 TTTGAAATACTCTCGCTTGTATGGA (SEQ ID NO.37) TGCGAACCACATTATCCTTCC (SEQ ID NO.38) 212 20 MNP_027 GGTATACCTTGGGCGCTAACA (SEQ ID NO.39) GGTGACCAGGATAGCATGATT (SEQ ID NO.40) 214 21 MNP_029 TGTTTCGCCTTTTATGACCCTTA (SEQ ID NO.41) GATGGGGAAGCCAAAATCTG (SEQ ID NO.42) 188 22 MNP_031 CAACGCAGCAACTGACAATG (SEQ ID NO.43) GATTCAACCTCACTACGTACAATGC (SEQ ID NO.44) 202 23 MNP_032 GCTTTTACATGTGTGTTTTTGG (SEQ ID NO.45) TCTTCTCTAAGCCTATGATCAGCTC (SEQ ID NO.46) 181 24 MNP_034 GCACCCACTAATTTGACGTTTGT (SEQ ID NO.47) TGAACCCTACCAGCCTCTTCA (SEQ ID NO.48) 204 25 MNP_035 TGATCTCTATTGGTGAAGGAAACA (SEQ ID NO.49) AAGCTTATGCTGCCTCAACTG (SEQ ID NO.50) 179 26 MNP_039 TGGAATCCCTGGAGAAAGAAGA (SEQ ID NO.51) TGCAATGCTCATTAGCACCA (SEQ ID NO.52) 216 27 MNP_040 AGATCATGCAGAAAGATCCACA (SEQ ID NO.53) TCCAAAGCCAGAAATTGCAT (SEQ ID NO.54) 176 28 MNP_041 TGCATAATAGTTCAACGGCGTAA (SEQ ID NO.55) AATTGCAACCATCAACCCATT (SEQ ID NO.56) 207

[0074] 3. Multiplex PCR amplification

[0075] A primer pool containing 28 MNP markers was designed and synthesized, and the amplification of the target MNP sites and the preparation of Illumina-compatible sequencing libraries were completed by a two-step PCR method.

[0076] The first-round PCR system is as follows: DNA template (10 ng / μL) 2 μL; upstream primer pool (10 μM) 1 μL; downstream primer pool (10 μM) 1 μL; 2 × PCR Ready Mix (Kapa HiFi Ready Mix) 15 μL, and double-distilled water to a total volume of 25 μL. After preparing the reaction system, perform the following reaction program on a PCR instrument (BIO-RAD, T100™): 98°C pre-denaturation for 3 minutes; 8 cycles of 98°C denaturation for 30 seconds, 50°C annealing for 30 seconds, and 72°C extension for 30 seconds; followed by 25 cycles of 98°C denaturation for 30 seconds, 66°C annealing for 30 seconds, and 72°C extension for 30 seconds; and a final extension at 72°C for 5 minutes, followed by storage at 4°C. After the PCR reaction was completed, the PCR products were detected by 1% agarose gel electrophoresis. After confirming that the product size was correct, the PCR products were purified and recovered using AMPure XP magnetic beads (Beckman Coulter, USA).

[0077] The purified product from the first round was used as a template for a second round of PCR, introducing sequencing adapters and sample-specific tags (barcodes). The reaction mixture was as follows: 2 μL of purified product; 1 μL of universal P7 primers (containing molecular tags, 10 μM); 1 μL of universal P5 primers (10 μM); 15 μL of 2 × PCR Ready Mix (Kapa HiFi Ready Mix); and double-distilled water to a total volume of 30 μL. The reaction program was: 98°C pre-denaturation for 3 minutes; 5 cycles of 94°C denaturation for 30 seconds, 55°C annealing for 20 seconds, and 72°C extension for 30 seconds; a final extension at 72°C for 5 minutes, followed by storage at 4°C. The final PCR product was purified and recovered using AMPure XP magnetic beads. After quantitative analysis, each library was mixed in equal volumes and paired-end sequencing (PE150) was performed using a NovaSeq Xplus sequencer (Illumina, San Diego, CA, USA).

[0078] 4. Amplification product detection and sequencing

[0079] Two μL of multiplex PCR amplification products were taken and the amplification effect was detected by 2% agarose gel electrophoresis. Electrophoresis conditions: voltage 120V, time 30 min. Clear bands were amplified for all 28 MNP targets, and the product size was consistent with expectations (175~231 bp), with no nonspecific amplification. After purification of the qualified amplification products, sequencing libraries were constructed, and paired-end sequencing (PE150) was performed using the Illumina NovaSeq Xplus sequencing platform. The sequencing data quality control results are shown in Table 4.

[0080] Table 4 Sequencing data quality statistics

[0081] Statistical indicators average value Total number of samples 40 Average number of Clean Reads 1,598,020 Average Clean data volume (bp) 222,259,782 Average Q30 percentage (%) 86.44 Average GC content (%) 53.32 Average alignment rate (%) 85.00

[0082] 5. Identification of MNP markers

[0083] For the 28 developed MNP markers, flanking sequences of about 300 bp were extracted from the upstream and downstream sides of their core polymorphic regions to obtain genomic fragments containing complete MNP marker regions as reference genomes, which were numbered SEQ ID NO.57 to SEQ ID NO.84 respectively.

[0084] SEQ ID NO.57 (MNP_001 genome fragment):

[0085] TTGAGGTGAAAAAGAGAAGAAAACTCCTTGGACAAATGCTTGAAAAGCTAGTGTTTGTGCTAGTATTTCACAAGAGCCAAAAAGATGCAGCTCTTGCAAGGCTTAGTGTGGCTCTTTGTGGTTTGGAAATGGAAAGGAATGCAAGAGATTTTGGAGAGAGCTTGAAGTGGAAAGAACAAGAGAAAAATGGAAGAAGAAGAACACTTGGAAAGCGTAGAAGATGGAGGAAGTTACAACTGAAAGCAAAGACTAAAATGAAGTTCAAATGCCTCATATTTATAGGCACAAGAACCGTATGGCATTGGGGCTATTTGGAGCAGGTTTTTGTCTTCACTTAGTTGATCTAGTTAGCCATTTAGTTAAGTTGGAGTAAATACTAGTTATAATTTAGTTGAGTTATCTAGTTAGTTTTAATGCTTAATATGCTTGCTAATGTAGGCTAGACCATGTCTAAAAGTGTTGATTTATGACAAGGTGTCTTGAGGTGACCTTTATCATGTTTTCAAAGTGTCATCCATCTTTGAACAATTCAATTTTCTCCTTCCCCATGGCCTCCAATTACAGCCACGGTTTGGTGTATGCATGGAGGTTGAAATTTTCCAACTTTGCATGCATGCATGCATCATAGATTTACATCATCTAACCTTATGCTTTAATGGGTGAATTTAATGTTTGGCATATGATTGTCTATGTGCATGTATGTGGCTGAAAATATGCATGAGATTATGA

[0086] SEQ ID NO.58 (MNP_003 genome fragment):

[0087] ATAAAACTTTTTTCATTTTTGTATCAACATCTCTCCAGCAGCTTTGTAGTTAGTTGCATTGTTCGTGACAACCTGGACAACTTTCTCTTCACTAACCTCCTCTACAACATCATCTATCATTTGAAATATCCTATCAGTAGTTTTAGAAATATGAGATGTACCAACAGACTTCAAAAAAATAGTTCCCTTAGGGCTATTTACAAGAAAATTCAATATAGTCCGTCTTCTCTTATCCATCTACCCATCAGTCATGATAGTGCATCCCACCTTTTTCCAAACAACTTTATGTTCTTCTAGTGATTCCATTGTCAAAAGATTTGGTTCAAGTATTTGACTCTTAATTCATGATAAGAAGGTGGCTTAAATCCTAAGCCATGTCATGCAACCTTTTCAAACATCTTACCAAATTCTTCACTCTTTGCCACATTAAAAGGTATGGCATTATTGTAGAAAAAAGAAGCAATTTCTAGGCATGCTTCTTCCCTCAGATTCTTCTTAAAGATGGTATTGATGGTGGCCTGAGTGGTAATAACCTTTCTCTTGAAAAGGTTTCAAGGTGTCTCCACTTTTTTCCCTTTTCTTTTTTCACCAACAGAATCCTCCTCCTCATTATCTTTGTTGCCTACTCCTCCTTCGTCTAGTTATCTTAATTTTTTTTTATCAAATTTTGTTGCAATCCAACTACAATTTCAAACGTTTGTTTTCTTACATCATCTGTAACTGCCATGCAAGGTGCAACATTTTTTTATGGTCCAGC

[0088] SEQ ID NO. 59 (MNP_004 genome fragment):

[0089] ACAATCTTCAGGGGCCTGAAAATAAAATCAAATGATTAAATATGAATAGATAACCCTGACACAATAAAGAACAGACAACTACCGCCTTTCTATAGAAGTTTCATTCGCATCTCAACTCAGTCTTGTAGTACTGTTTAATTGTTTATGTCATAGACGGATACAAATGTTCTCTGTCATTAAAACAAGCCTTGATACAAGTACCTTAGAGACCGCAAAAAATATATGCATCAACATGCAGATCAAACCTAAGCGATACATTCAAAACTAGTAAAAAGGAAAGGTCAAAGTAATTCAGATTTGAGGTAACCTGAAAAAGAGTTGAATCTTTACATTCATGTTTTGCATCTAGCTGCACATTTCCTTCCTCAAAATAGTGGGCGCCCACCTGAAAATAGGACAAAAAAGAATATTGTTAAATAAGGCTAGCCCCATCTCGTGCAACCCAATGCATCAAACATCCGAACATACCTGCATTTTACCCTTTATTTCCACTGTTTGTTGTTCATCTCTGAACTCAATATTCCATACTGAACACCAACTCCCGTTGCTATACAAAAAAATGCCAAAGAAAAAAAAAATTACAAAATGTATTGAAATATTAGATTTAGATGTACCAATTTTCTTATTTTTTGACTAGTAATGTAGAGAGCAATCATCAAAATGGGAAAGCATAGTTGGGATTTCAGTAGACTACTAAGTTCACACACCAG

[0090] SEQ ID NO.60 (MNP_005 genomic fragment):

[0091] ATTGATTTGGTAAGTTCTCCGGCAAATGCTGGACTCTAAGAGAGAGAGAGTGTGTGTGTGTATAATCTTAATAGTTGTTTTATCAATCTCAATCTCAATCTTCAATATAAAATAACTCTTTATAATCTTGGTCAGGAGCGCATACCATTGGAAGAAGTATTTGAACAGTTGAGAACATCACGAAGAGGACTTTCATCCGAAGATGCTGAAGCCCGACTGCAGATATTTGGCCCAAACAAACTTGAAGAGAGGAAAGTACGAATAAATATCACATCTTCTGAAAGTTCATCCAATTGAACTCTGTGAAGCCAGATAGAAGTATAAAAATAAGCACCTTGTTGGCTTGGTCATTGAATTACAACAACATAGTAACATACATATATAGGAGGGGAGGGGATCGTTACAACTTCTGAACGAACAAAGGATAAAATATTTGAAAGATAATTTGAGGTTGATTATGTGCATAATGTCTTAATTCCATATTAAGAACTTTCACTTACCTCACATGCTTAAAATGCTTATGAAGATGAATTTGCTCAATTTGACACTAATCCTGTGGCATTGACATACTGCATCCGCTGCACATCTCAATATTAGCTAGATTCCTTCCTTCCCTCCCTTACAAAGG

[0092] SEQ ID NO.61 (MNP_006 genome fragment):

[0093] CTTGGAACGGAAAAGTAAAGGGTTAAAAGGTGCGTCAGGTTTGGGGTGGTTGAGCCGGCAGAAACAAGCTCTGGCTGGGCCGGCCTGGCAACTAATTAACCAAAGCACATGGCCCATGATGTGTTAAGTTAGCTGGCCCTTTAAGTCTAATGGACATGGACGTGATTGCTATTTTCTTGCCGCTGCTGCTTTCTTTCTTGGTTACTTTCCTTTTGTGCCAAATCTATCACATGCTTTGGTTTCTGCTCCAACATTTATTCCTTCCATCGTTAGCGGCTAAGACTACAGCGGCCACCTGCCGACGACAATCCAATCCAAAAACAATCAGGGCAGCCCACTCACAGCTCCGCAAATTTTTTGGTTGGCCTTTCCTCGTTCTCCACAACTCTCCTTCATGTCATAGCCAAAACAACTATAACAGGTTTGACCAATAATAATAATGATGATAATAATAACAAGTGTGTTCCTCTCAAGTTATTTTTTGACACTGCGTCATCGTCAACTCATCACGTTTAAAATCTCCCCATTTCATGAAAAGTGAGGATTTAACATGACAAGCTCATGTCAAAAATTAACAGGAGGGAGGGAATTCAAACCCATGAGGGGTGTGACACCGTCAATATAATTTTTACATGATCATCAAATAATAAATAATCACATCATTAAAAGTGTTTAATAGTTTTTACATAAAAATATGTAATAAGATATAATC

[0094] SEQ ID NO.62 (MNP_007 genome fragment):

[0095] AAAATGTCTGTCGGTTGTATTTGTTGAGAGGGGCATCAAACATAAATCTCTTTGGAAAATCTGGATTAGCTAAGAACAAACGACCATATGCAACAAGGTCTGCCTTGTTATTAGCTATGGCTTTGATCCCATCTTCCCGATCATAGCCTCTTGCAACAATAAAAGTGCCATTGAAGGTCTTTCTCATTGGCACAAAGTTGTGAGAGCATTCAACTTTTTCTCCAATAGTTTTCATTCTTGGTTCCACCATGTGACAGTATACAATACCATACTTATTGAGGGCATTAACCATATAAAGCCCTAATGCTTCAGGATTGGAGTCTCCGCATTCTGCATATTCTGCATAAGGGGATAATCTAATTCCAACTCTTTCAGCCCCTATCTCATTTCATAACAGCTTCAACAACTTCTAATGTGAAACAACAACGATTCTCAAAGGATCTACCATATTTATCTGTGGTCATTCACTTTATCTTTCATAAATTGCTCAAGTAGGTAGCCATGAGCCCCATGGATCTCAACACCATCAAAACCTACAATTTGCAAGACCATGGGTATGTTACATGATTTCTAAAATGTCTCAGTACCCCTTAAAGCAATAAGCTGTCCAGTTTTTGAGGATTGTATTATGATTGAAGCAATTTAAATTTTGGAAAAACTCGAACACTGAAAAATCAATGAACTTACCTGCTTCTATGGCATTCCTTGCAGCTAGTCTGAAGTCATTGACAATATGAGGAATTTTGTAACACCCTAA

[0096] SEQ ID NO. 63 (MNP_009 genome fragment):

[0097] GATTGTAGGACTTCTGTGTTGTTCCGCGCACAAGATTGTAAGTTATCGTGCTTGTGGTACAGGTTAGTTAACATTCCAATGTTATTTCATTGCTCTAGAAGGTTCCTCTTCGGATTTGGCTATTCTAAAATGAGGAGAATGATAATATGTAAAAGTGAGGGGTTAATTGCCATTGGATAAATAACTTCCATTATATGTGGGTTTCATCAAATGATCTAAGAGTGATTAATCTCTCAATTTTGCCTTTTACCATTCTTCTCACTCTAGATAAGACAAATCCATGCTCTTTAACCTTTTTTATCCCTTTTGAAGCTGGGTGGGGGATGGGTTACTAATGCCCAATGCGAAGTTCCTAATGAAAATTTCAAAATTAGGATATGAGGAGCCTACATGAAATTGGATTCAAGATGAGAATTGCTATGCATAAGGGATTTCTGTCCTATATCAGAGTCACAATAAAGATTCACAATCCTATAGTTTGCATTAGTTGAAAGTACTAATAGTGTGTTTCAATAATTATTTGACAAAATGGCATTTGTTCATTAATAACCCAAATTTGTATTTCTTCCTGTATAATCTAGAACGATAGAAGCCATTGAATCGAGCTCAGTGAAATCAGATATTATTCTTGTCAAGAATTCAATTAGCATTGACGCCATTATTCAGAAATACGTAACTTACTTTCGCATTAATGTTCTTTCCATTGCAAGTAATGGAAGAG

[0098] SEQ ID NO. 64 (MNP_010 genome fragment):

[0099] AATTATTATTGATCCCTCGAGAACCTATGTTATCTGAGGTGAAAGAAGACAAAGATCGTCCAGACGATTGAGAACCAATATTTGATAGAAGACTCAAGCTAAGGATTAAAACTAACAAATCGATAAGGCCACATGTAATATTCTTTAGAGCAGGAAACTATTTCAAATAGAAGATGGTTATGAAAGGAGTGCATGAGTAAGACAGTATAAATACCCCAAGATCCACCATTTGCAAAGGTCATTGACCAAATCAACACATTACTTATTTCCTTGTATCTTTTAGCCACTTTAGTGTTAGTCGTAGACTTAGTTTCCTTGTAAATTGATGATGATCCTAGGCAATTTTTGTTAATTATCCTTGTAGTTTGGCAATGCCTATTATAAACATTCCTTAAGTGTATGAATAGACTTGTCTGATTATACTCAATTTCTTTGTTGTGTTTTATTTACTTCTTAGTGGCATTGGCCAAAAACTTAACATTAAGAACTTTGGAAATTCATATTCAAAGAGCCAATTTCTCTCTTTGAATTAATCATTTGATCTTTGGAATTCACAGAATGGCTATGTTTCTAAGGCCAGATGATTTAATTGATCTAACATGCCTAGCACACTCACACTCATATAGCCAAAAATTAAGTTGAACGCAATCTAATTAAAATTTATAGCTTATGAGAGAATTTAATAAAAGCACATTCATATTG

[0100] SEQ ID NO.65 (MNP_012 genome fragment):

[0101] CAGCAAACACTAATGTACCCAACAACCACATCCACCAAAGACTTCACCTCCTTCATCGCCTTCTTCTCTCTCTTCAGCCTCAAATCCCTTCCAGAAAGTTCTAGAAGCACCTTGTGAACCTCACAAATAACTGGGGGAAGCAAAGCCACGCTCTTTGAAGCACCAACTGAAGCAGAACACGCTGATAGAATCTGAAACAATGCTTTTGCGGCCAATATTCGATCCAAGGAGTCACCTTTATCCGATTTCAGGGTTCTGAATTTGATTGCAGCGTAGACCCATATCGCCTCAAAAGGTGGACCAACGCTGGCTTGCATCAGCTCGTAGAATGCATCAAGGAAAAGAGAAAGATCAGGAGATTCTTTTTTAATCTCGGAAATTAGGTCTTTCACTGAGTGTTTCAGCTTCATTGCATAGTTTTCACCCACAAGAGGGACGAAATTGGAAGAATCTGTGATCTCCATTCTTGATTTTCCGAGGTACAAAAAAGTGGGGTCTGGGGTTTATCAGAAGGGGTTTTGGTCATACACATTTTGGGCCTGGCCCAGGTTATTTTTTTTTCTTGCTTTGACTCCAGCGTGGGAGATGGGAGAGAAATTCGATTTTTCATTTTTTTGGGAAAATTCGAAATTTTTTAATCTTAGATTAACGGCGTGGT

[0102] SEQ ID NO.66 (MNP_013 genome fragment):

[0103] TAAAAGTGGGTGTCCAATTGCGATATCTACTAATTACCATTGAATGTAATGGATGAGTGGAGGAAGTTTGAACCACTATCACCTCCAATTAGACACATACTTTTGAGTGGTAGAATAATATTTTTATTATTTAATTTAGTTTATTATAATGAATGGATTTGAAACTTTTGAGCATGTAAGATTTAACTTAATTTACGTGTTACGTTTCTCTGGCCATTGAGATGTAATTAAACACAAAAAGCCACCCAGGGGTTGGTATTATTATAAGGAAATGACAGGTCTCAATCAACAATTTGGCTTCACTAAAAAGATCCTGGTAGATCTTTTTTTTTTTGATAAATTAAGACAGATCACTATTCTCCCCTCTTCATCTATCATGTTGATATTGTCATAAGTCCAAGCATGGGGCGATATGTCCAAACATTCGATCCAAACCCTTTTCGACTAACAAAATTCTTGTTCAAACCACCGCCTTATTTATTTATTTATATTCCAACGGAGGATCATACCACCGACGGCTCGCAGCTCCCGTTGTGCAAAGTGCTGAATGGGGAGTTTGAATTTTGATACAATAGTAGGGTAGATTTTCTCTCTCCACCTATAGTGTAGTTTTGTTTGGTAAAAGAAAG

[0104] SEQ ID NO. 67 (MNP_015 genome fragment):

[0105] CTAAAAAAACTACAAGGGAGTTTCTAATTTAAAAGCAGTTTCTCATAATAGAGTTCTTAGAGACATTTCCAAGGGTGTGGGAACTAGATCTTCTCTTAGAAATATGTCAAATTGTGCTTTCGTCTACCATTGAACCTAGATGCATTGAAGTAGCTTTGAGTGATCAAAGTTGGGTGGATGCTATGCAAGAAGAACTAGACTAGTTCGAGAAAAGCAAAGTCTGGATGCTTATTAAAAGACTGAATAGGAAGACCATTATCAGTACGAAGTGGGTGTTTAGGAATAAGCTCGATCAAGTTGGCAAAGTCACAAGGAACAAAGCAAGATTGGTTGTATGAGGATATAATCAATAAGAGGGAATTGATTATGATGAAACCTTTTCACCGGTAACCAGAAGCCATCAGAATGCTACTTGCTTTTACCGTCTTCAATGGATTCAGTCTCTACCAAATGGATGTCAACTTTGCATTCCTAAATGCATTCCTCTACGAGGAAGTATATGTGAAGCAGCCTCCTGGTTTTGAGAATGAAAACCTTTCCAACCATATCTTCAAGTTGATGAAGGCTCTCTATGGTCTGAAACAAGCTCTTCGAGCTTGGTAGGAAGACTAAGTACCTTCCTGCTGAAGAATGGGTTCAAGAGAGGTAATATTGATACTACTCTTTTTA

[0106] SEQ ID NO.68 (MNP_016 genome fragment):

[0107] TGAACAAATCTGTCAAATTGTCGCTTGAACAAATTTGTTGAATATTAATTGCTCCTTGCTTTTGAAGATCGTGTGTAAAGAAGAATATTTGAAAAATATGTTTTGTTCTATCTCCTTTGATGTACCTTCTTTTGAGTTGAGCTATACATGCAACATTGTCCTCATATAAAGTTATTGGAGTTTGTTCTTTATCAGATAGTCCACGTGACACTTGAACATGCTGATTTATCTCCCTTAGCCAGAAACATTCACGACTTGCTTCATGGATTACAATTATCCTTACATGATTTGAAGATGTAGCGGCTAGAGTTTGCTTTGTAGATCTCCATGATATGGTTATATCACCATATGTGAATAAATAACCTATTTGAGATCTTCCTTTATGTGGATCTGATAAATATCCTGCATCTGCATAGCCAACCAACTGTAACTTGGATTCATATGAATAAAATAACCCTTTATCAACAGTTCGACGAAGGTATCAAAGAACATGTTTTATTCCATTCCAATGTCTTCTAGTTGGAGAGGAATTGTATCTTGCTAATACAGTTACAGGAAATGCTATATCAGGTAGTGTATTATTAGCAAGGTACATAAGTGCTCCTATGGCACTAAGATATGGTACTTCAGGACGAAGCACTTCTTCCTGAGGACAAAATGGATCCTTCTTTACATCCAACAACCTCACAACCATTGAAGTACT

[0108] SEQ ID NO. 69 (MNP_017 genome fragment):

[0109] CCCATTCGGATGAGGAAAGTTGCAAGCTTAATAGATTTGTATATAGCAGAAATAGCCCCTGATCCTTGTCTAAGACCTTCCAAGTTCTTGGCTCTTGCCACATCACTTCCAGATTCTGCAAGAGATTCTTGTGATGAGCTCTACCATGCAATGGACATGTACCTCGAGGTACAATAATTTATTCCAAGTTTCATTACAAATTGGATGTCTTTAACTTTGGTCACATATGGTCAACTACTTGATTAAGATATTGACTTAAATTCTTTGTGTTTTGTCCATTGGAAATGCTAATATGATATGTGAAGCATAGTTCTCAAATCACAGCTTAAACTTCTAAGGGTGTGCTTGGTATGAGCGTAAAAACGGGGGAGAAAATTTCACTAATGAACTCCATATGTAATTTTACACATAAAACTCATTTACATAATTTTCTCTCTCATGCTAGACACACCACAAAACTTGAATCTTCCCTGAATTTAAGGACTACTGCAGACCATGGTGTAGTTGGACTGACTATGATCTGTTATAGGTACATGCTCAATTGTCACAAGAAGAAAGGGTGAAGATATGCTGTGCCTTAAATTATGAAAAGCTTTCCCCTCAAGCTTGCCTAAACCTTTCTCAGAACCCCAAATTCCCTTCAAAATCAGCAGTTCAGGCTCTCATTTCTCAACAACCAAAGCTCAAAAATTTACTCCAAGTTACTCCCTGCACAACTCC

[0110] SEQ ID NO.70 (MNP_018 genome fragment):

[0111] CAAAAGTGTCTCGCACAGGAAGGAGTGTGTGTATCTATAAACTATTAAACTCAGAAACAAAAACGAGAGCTCTCAAACCACGCGAAATTGTAGAAAGACGGAAAGGAAAAAGGAAAAAAGAAGAAGAAGAAGAACGCGCAGAGAGAGAGAGTGGTTCTTCACACTCTCACATTCGACAGATCGAGATCCGAAACAATTCCTTATTCCTAGATCTATTTGAATTTCGGATTCGCGATTCCAATTTCTCGTGTTTCCGATTAGGTTTTGGTTTTTCCATTTCTTCTTTTTTTGCGAGGAATCAAAAAAATGGCGTGCATCAAAGGGGTGAATCGATCGGCGTTGGTGGCTCTGGCGCCGGACGCGCCGTACATGGCCGCGGGGACTATGGCCGGCGCCGTCGATCTGTCGTTCAGCTCTTCGGCGAACCTCGAGATATTCAAGCTCGATTTCCAGTCCGACGAATCGGAACTCCCTCTCGTCGCGGAGTGCCCTAGCTCAGAGCGCTTCAACCGCCTCTCGTGGGGGAAGAACGGTTACGCTTCCGATGGATTCGCGCTCGGACTCATCGCCGGTGGACTCGTCGACGGGAACATCTATATCTGGAATCCTCTCACTCTGATCCGGTAACCGCACCTCTCTTCTGCTATTGTG

[0112] SEQ ID NO.71 (MNP_019 genome fragment):

[0113] TTAGTTCTTGGGGATTACAAGGGAGCAGTTGTGCAGTGCATATCTGCGAATAAATGGGCCGATGCTTTAGTCATTGCTCATGTGGGTAGTGCTTCTTTGTGGGAAAGTACACGAGATCAATACCTTAAAATGATCCGATCGCCATACTTAAAGGTAGCTGATCATATGACTTAAATCTGTCCAATAACAACCAGATATTTGACTTTTATAAGCTCCATTTATTTGGGGTACTTTCCATTTTCAGATTGTATCAGCGATGGTGAGCAATGATCTCTTGAGCCTTGTGAATACTAGGCCTCTTAAATTTTGGAAAGAAACCCTTGCTCTTCTTTGTAGTGTAAGTCTCTTTCGGTCTTTGTTGCTTGTCTAATTTCATTTTTACATAGTTTTTGAACCACTGGCATCCATTCAATATTATGTTCCTGTAAGTGATGCAAAGTTCCCTAAAGAAGTTTTTGCTGGCATCTCAGACTCACTCAATCTTCTTTATTTTACCCAAGGTTTCTATAATAGTTTGTTATTTCTTGTAATCAATCTCCCTTTTGATTTATCCTTTCGATTATATTGTCTTCATAGTATTGCTACTTATGGAGTTAGGGTGATTATGCATTAGTGGAATCTAATATCCTGATGCAATATATGGATGTTATAATATATATATAT

[0114] SEQ ID NO.72 (MNP_020 genome fragment):

[0115] TTATTTGTACAACTTGAATAATCACATAATAATAACACATAAGGACTGGGTTGGGTGAGGATTTGGGCAAAAAGGTAGCAGATTCGGGGGAAAAGGGGGGGAAAACTCACATGGAATATGCAGAACTCAAAAGTACCATTTTGGTCTCATTGCCTCTTCTTTTTCTGTTAATTCTCGATACTGGTACCATTCTGCTCCAGCCTTGCCAACTGGTAATGGTGACCTCACAAAAATCTCAACAGGCTTGGGGACGTGCACGGCCAAAAGCAACTTCCCAGCAGTTTCTGTTGGTTTTGGTCCTGAGATTTTGTGTGACCTGCTAATTGGATCAACAGTAAACCATCCTAGACCTGATATAGCTATATCACAAGCTGGCCTGCCTCAAGAAAAACATTTCATATTTATCAATTTTATTCACCAGTGTTAGCAATTTGGGCTGAAATGACTCAACAGTAAACATTAGAATGAACTACAATCTAACGCCAAATAAAACGAGTAAAAAGTCGCTACAAAAGAAACTAAATCAAGTGGTACCTTTCCACATCTTCAAATTTTATTTGTAATTTACGTTCTGATTCGAGTCCTCTCCAGTTCTCAGCCTTTTCTTCTCCACTTGGTGGGATCAGCAGAACTCCAAGTTCTTTCTGAGACATGCAAAGCCCTCATTAAGGTTTGAAGTAGAAAGATCATTAAATTTACACCTGGTACAAATCCCAATTTTGTTGACATAGAGTTAGTCTCACGGTTTCTCTAAACAGATTGAATAACTGTCAACACCTGA

[0116] SEQ ID NO.73 (MNP_023 genome fragment):

[0117] AATGCTTGTGACTGAGGCTATTACTTTTCATAAAAACTTGTTTGGTTCAGAGGGTACCATTGTTACGAAAGATTGCCAAAGGGTGAGAGTTCCTTCTATCTCTTTGGAAGCTAAACTTGACCTTTAGAAACAAGTGTCAATGGAGGAAGTCATCGCAGCCATTATGGCATGTAACCTTATAAAGTGTCTGGTCTAGATAGTTTCCATTCATTTTTACAAGAAATTTTGGCATGTGGTGTGGGAGGATATCTGCAAGTTAGTTTAGAGTGCCTTTGCTACCAGTTTGTTTGACCTACAACTGCTTGAGATACTAGACTATTTAAAATTTTTCAAACCTATTAGTCTCTTTAATGTGATTTATATGTTCATTACTAAGGTTATTGTTAACCATATTAGACCTTTGTTGCACCATCTTATCAATGCTTTACAAGGTAGTTTTATCTCGGGTGGTGGTATAACAAATAACATTATTCTTGCTCAAGAAAATGATTCATTGGATGCATTATTCCAAAAGGAAAAAAGGTGCATTTGCTTGTAAGCTAGATTTGGATAAGGCATATGATAGAGTGGAATGGAGTTTTCTTAAGGCAACTTTGCAAGATTTTGATTTTCCACCTAGGCTTATTAAGCTTATCATGCATTGTAT

[0118] SEQ ID NO.74 (MNP_024 genome fragment):

[0119] AATTTTTCATATATAAATTTGTATATCATCAAAAGCTTATGTGATCAATATTTTAGTACAGAACTGCTGATAACTTGGAGAATTGAAGCTGTTAATGAGGTTCTAGTTATGGTCAAACCATTAATGAGCACTTGTTCCAAGCATACCATGCAAATCTAAATCTAAATAAACATTTGATGGACATTATGAGGAGGAGGGAATAAACAAACCTAAGTCTATACATAGAACTCATCACATTGTTGTCCTTTATTTATTTATGATTTGAATAGAGAAGAGAGATAAAACAAAAAATTGAAGTGATGGTAAAGTTGGATAATTAAATGTCAACTTAGCTCCTAACTTCCCTTTGCACTCCCTTAAATGATTTGTGAACTTCTACTCTAAAAGATTAATTTTGTTTCTGCTTAAAGGGAAGCTTTATTTGGAGAAATGTGAGGAGCCTGATTTCAAAAGAGCAGGGGATTGCTTTTATCTAGCTCGATGTTTCGAAACTGCAGCTCAAGTGTATGCTAGAGGCAGGTTCTTCTCAGATTGTTTGACTGTTTGTGCAAAAGGACGGTTGTTTGACATTGGTTTAGATTACATTCAACACTGGAAACATAGTGAAACTGCTGACCATAGTATGGTTGGAAGTCATGAATTATTCACAATGGAACAGAAGTTTCTGGAAAGTTGTGCTCGTTATTATTATGATTGTAAAGATACCAGATCCATGATGAAATTTGTTCGAGCTTCTCATTCAATGGAATCAAAACGTGAGTTCTTATGATC

[0120] SEQ ID NO.75 (MNP_025 genome fragment):

[0121] CAGCAAATATTGCTAAGACGACGGGTGACGTTCTGTGTGAGGCTGATCTGCTGGCAAAAGCTGGTAAGTTCATTGAATCTTATGAACGTATTTTTTTCGATGTATTTGCCAATTCTCTTTGGTCTGCAGGCAGTCAAGGATGGCCATTGAAGCAGTTTTCACAGAAGGCTGAGTTTTGAATAGAGCCTTATCATGTGTAAAGGAAGAGTCAAGCAGCTTTTATGAGCTTGCTTCGACTGAAGCTGAAATATTATCAAATGACAATAGAAATATTTTCAAGATAATGATTCATTTGAAATACTCTCGCTTGTATGGAAGTATGAGAGGTGAAATATTGTGTTTGTGGAAACTTCTGGATTTTCATTTTCAGCTTAACTGCTCAAAGTATGTCTGGCAAGACAATATGTTTGATGATTCTGTGGAAGGAATGATGGTGAAGAATCAGCTTTCTGTTGAGACCCTGTTTTACTGTTGGACCTGTTGGAAGGATAATGTGGTTCGCATATTAGAGTATCTTCCAAGTTTCAAATCCCAAGATATTCATCAGCATAGTAGTCATGGATTGTTTGCATTGAATTATTTGGGTGTCCAAAAGGAGACTTCTAATCTAAAAGACATTTACCTTTTGCTCATCCCGGATGCCAATTGGGTGATAAAATGGGTGATGGATTTCTGAAGAAGAATGGGAGGCTTGTTTCTGTTGATGTTCATTGTTTAGTCTCTGCTGCCCGGAG

[0122] SEQ ID NO. 76 (MNP_027 genome fragment):

[0123] AAATCTTAAAGAACTTCTTTTGCTCAAATAAATAAATAAATATCCAACAAACTAGAATGAAGAAATACAAAACTTCATGCATCAAATGTCTTCTTACCGGTTGAAAATAAATAATTTTGGATGAATGTTACATATCATATAACCACTTTTTGATCACTTTTAACAAGAATTCATTTCTTATAATTTTCTCAACCTTTTTAAGATTTGAGTTCCTCTATGGCTTCAAAATTTTCAACCAACTAGCTGAAACTGAGCCAAAAAACTGAGGTATACCTTGGGCGCTAACATGTAATAGATACTGTTGTCAACACCTCTGAAAGAAATAATGGGACCCTTCTCATTCCCTTCAGCTGTATGATTGAAAACAACATCCATGATGACCTGCTCCAGTAATATAGCATTGAAAAGATAATCTAATTCTAAAAAAGATAGAGGAACTAAACAGAATTGACAGAATGAAATCATGCTATCCTGGTCACCTCTATTCCTCGTTTGTGTGCCTCCTTGATCATGAACTTCATTTCATTGACCCCATCACGGCCACAATTTCTTATCCCAGTAGATGAGTATCTGATCATTGGCGAAAAGTAATTGACAGTTGAATAGCCCCAAAAGTTGACCCTAAAAGTAAAAAAGATACAACATTATCTTAGACTTTAAATAAATTTACAGGAGAATCAAAATGAGAATTGTACAGAGCCACAAATGTAGAATTC

[0124] SEQ ID NO.77 (MNP_029 genome fragment):

[0125] TGGTTCACTAATTTGGATGTTAATACTTATCCACATGGATCTATATACGTATATATATTTTGCTAGCTTCTCCATCTTGATCTGAGATTCATCACAATCACACACACGCATATATATGCAAAAAGTTCGTCATTCCTACTACTTGTCTTGTGATCACAGTTTCATTTTCCTTTTCTTATTATCCCTCCCCTTTGATCATGTGAGTCTTGTTTCGCCTATAGGCTAAAGTAGTCAATGAGACACTTCTCAAATTATGTTTCGCCTTTTATGACCCTTATGGTGTTATCTGTCTTCAGTGGGCTTTTGGTTTGGTCAGTATGTACTGTTTAGTGTTCATCATACGACAAACTACTAACTCTAATCGCACAGGGTCAATTTTCTATCATTGTCATTATCGAAAATAGAACTCATTGGGTTCTGTGCAGATTTTGGCTTCCCCATCTTCCCCAATCAAATTTGACCTTAACATAAGGTACAATTATTATAACTAGTCTGCTTTGGAATTTGCAACATTCAAGCAGTTGGTTGAGACTTAAGCGGCAAAGGAACTTCTTTCAGCTCAGATTTGCCTGTGTTGCTGAGAATAAAAAAGGTTAAGAGATGGGGAAACTTACTAAGATATTAGACACGTTCTGTCTTTCTTCTGGTTCAAACTCCTGCTTGTGTGTAAATTCCATGGAATCTGAAGATGAGTTT

[0126] SEQ ID NO.78 (MNP_031 genome fragment):

[0127] ATTTGCATGTGCAAAATTTGAGTTCTAGATGTCATCACTACCAAGATTAAAGCATAACTCTCGCTATTTCAGCTTGTATTATAATCATTGAAAAGGTGATGTGAAAATTATATACGATCAGGCCGGTTATGTATTGGCTTTTACCATTGATCAGATTCTCTTGTGAATCCCATATTTGCTCTCACCTAGTTGATTAATGGTGAAAATTAAGAGAGCTAAGTCACCGACAACACAGCAACTAAAGGCTATTCCATGGATAAGTGACCGACAACGCAGCAACTGACAATGTCAACTTGGTAACATATGGATCAGACGTGCTTCAACTGCAGTTTGAGAGAGGAATCTCATTTGTTACTAGATATACTTCCTTAATAGACACATAAGCGTCCAGTTCATGGGATTCAGATTTCAGTTTAAGATACTTGTAAGCATGTTACATTAGTATGCATTGTACGTAGTGAGGTTGAATCTATGTATTACCCACACAAAAGATCGTATCTGCACTCCATTTAAACTACTCTTGCCATGATTGCTGGGTATATATTCGTCGTAACAGCGAGTGCAGCATAGTTTTCTAGTCTCTGAAGTCTGAACTTCCTTGACTTTTCCCCCTCAAACATACCATGTATTTACTGAAAATGCCAACTTTATTTCTAGATCTGGCAAAATATGACACCACAAC

[0128] SEQ ID NO.79 (MNP_032 genome fragment):

[0129] ACGATTCACTTGTTTATTCATGAGTTAATAGACACATGGCATCGTTCTGAGTTCTGACAACTAAATTCTGGTAAACTTTTGACACACCCTAGAATTTTTGTGCCTCAAATATGCTTGAAGTTTTTAAGAAATGGACTGAAGTTAGCTATTGTTTATGTTATTATCTTGATTTGTAATTTAGGACAACATGATTTAGTTGTGCTAAGTACGAAACTCTTACCTTGATACATGAGAGCATCATTAAGCATTATTAGTTTTAGATAAAGTCACAAACTCATCATATTTGAAATGGCTTATTTTGTACTCATTTTTTCTTCGTCTTTTATTCTGATATACATTGCTTTTACATGTGTGTTTTTGGTTTACTTATTACTGTACTTGTTCAGCTAGAGGGGCCACTTTCACCAGCTGAGCTAGTGGGGATTCTGCAAAGGACATTGGAAGAACAAGGGGCGGCTTTTGGAAGTGGAAAAGCTAAGCAGGAAGAAAAGATCAGAGCTGATCATAGGCTTAGAGAAGAAAAGATTCAAGCAGACCGAAGGCTTAGAGAAGAACAAGATGCTGCATATCTTGCAGCTTTGCAAATAGACAAGGTGTATACCCCTCTACTCTCCACATTTCAACTGCTAATTTAAGCTCATACTAAATGAACACACATTTAACTTTATTTCTTTTTCTAAGAATGATTAGTTAACCAATATTTCTTCCTAAATATAGGAAAAGGAAAAACACAAGAACTCTCCTTCAAGAGTGGGAGTTCAGA

[0130] SEQ ID NO.80 (MNP_034 genome fragment):

[0131] CATTCGAGTCATACAGCATAACTGCAACTAATTTGAACTACTAGTAGATGGATTCATGGATAGCTAATTTGCTTCCGAAACAAGTCATCATGACCATAGCCAGAGTTTGTGGGTTAACGGAAATTTAAACAGGGTAGTTATGAGAGAACCTAGAAGATCGAATGACAATACCAGAGATTTACCAGCAAAGTTCACAGCAAAATGCACTTGAAAAGATAGATAATGCAGGTAAGAAGTTGAGACTATGATATGCTTCGATTGATTCATAAAGCACCCACTAATTTGACGTTGTAGTTGTTGAAAAAAGGGAAACACAAGAGACTCGCACCTCTGGTTGAAGAGCTATGCTCATTACTCACTCCCGAGGCCATCATCGCCCATGCACCCAGCAATATTTTCATCAGGAAAGAAAAAATTAAAAAGCAACATAGTGGGAATATCCGACCCAAAATTTGAAGAGGCTGGTAGGGTTCAAAATTACATCATTTTTACTTCATCCCACACTGCAGAAAATGGCCTTTCTTTGACCATTCACCAAGCTAGACAGGTAAGGCCCAAGTGTAAAGTGCTCAACCAAAAGAATGCTAGTATAATAATTAATTACAGATTAATTAATGAATTTTTCAACCAAAACAGTTCCTTGCCTGACATTCCAATTAGTAAACCTAGAGAAATTGGCAATTATTATAAT

[0132] SEQ ID NO. 81 (MNP_035 genome fragment):

[0133] TTCCTCCTTCTCACCGCAGAACACATCACTCGATCAGAGCTGTGTCAAACGTTGCTTTCTGCAGAGGATGAAATTAAAACACCTCTTCTATTGGCATGTGCACGTTTAGTGGAAAATGACTGGAGAAAGAAAAATCAGTGTCGTGTCCTATATACAAAAGTTCAAAACAGGTGAGCCCAAGAGATAAAAGAAAATGAGCCATACCTAATAATCAACTGCATAGATACATTCATACAGAAGCTGATCTCTATTGGTGAAGGAAACAGTGAAGGCGATGAGACAGTTCATATATAATAATATAATACTAGGCGTGTGGATAATAGTTCCCAAAACAGTACACGAAACCAAACAAAGGATAATTAAGAATACAAGTCGGATATGCCTAAATGGCGATTGAAACAGTTGAGGCAGCATAAGCTTCAATCAGTACAAGTACAACCCAACAGATTAATTAGTGAGTGAAACCAGACCCAACAGTTTCATCCCAACCTCCATTCAAAGATGCTCCTTCAATTCATTTCTTCCATGTGTGCTAGGCTCCTTTCTTAATTAAAGCATTGAACTTTACAAATTGAAACACATAGCAGAAGAAGGAAGAAAAAAATAAATAGGAATAACAGTAATAATTATTACTATT

[0134] SEQ ID NO.82 (MNP_039 genome fragment):

[0135] AATACATGCAATATAAAAAGAAGGTCTCAAACATCATCCCAATCCATTCAGAAACGCTTACACTAGTGAGAAAATCCACTTCTCTATCTCTGAACGATTAAACCGTAAAATAAAAAGAGTAGTTGAAGAAAATAACAATGATACTTGTCAAAATCTCCAAGAACTAAGTAAATTCACCTATGGAATCCCTGGAGAAAGAAGAATAGTGAAGAATGAGATAGAGAGAGGAAGTGGTTGTCAAAGGCTAAAAACAATTGATTCAAATGTAGGGTAAAAGTCTGTGCTAATCCTATTTATACTATACTAAAAAAAAAGCTAAGCAGGGCCCAAAATTAAAGCCAAAATTTGACTTCCATGCACTGTTGCATAAGCTTTGTGGTGCTAATGAGCATTGCAGTGCTCACTAGTGAGTTGCTCTCTTTAAACTCTTTTTTTCAGGCGCTGTTGAGCACCATGGCACCCATTGAGCACTGCACTTTGGGCAGAGTGGATGTCTTCCTTCATTTGGTTATTTTGGCCCCTTAAATATCTGAATCTATACTTGGCACTAGAAATAGAAATGGTTTCCCTTTAAATAAGCTTTCCAATGCTAGAAAAATTCATCTCAATTGGACATCTATAGCTCCAAATATTGATA

[0136] SEQ ID NO.83 (MNP_040 genome fragment):

[0137] TTTGTTCAGGTTAGTGTAGTCAACGCACATATGATGTTCTCCATTGGCTTTGGGGACCAGCACAAAGTTTGATATCCAAGTTGAGTAAAAGATTTCCTTAATAAATCCATTTACAGCAATTTAGAGGTTTGTTCCATGGTGACCTTTGCCTTCTCCTTTGACATTCGTTTTCTCCTTTGAGCTACCAGCTTAGAGCTAAGGTAGACTAAAAGGTGATGAGTTAGGACCTTTGGGTTTATGCCCAGTATATCAATTATAGATCATGCAGAAAGATCCACACTTTCTTGCAAGAACTTTGTCAATGCTTGCTTAGATGAGGCTAGGAGGTTTTTGTTTATTCTTGCATCTTGGTCGAATATTTTCTTTTTCCAATTTGAATTTCCTTTAGCTCACCTTCTGGCTAAGGCCTATTATGCAATTTCTGGCTTTGGATATCTAGGCCTACCATCATTACATTCCAGGCACCTTGGCTTTAATTATTTTGCTTCTTAGTTCTAACTCCCAGGCTGACATTGTAGCATTGGCTCGCCATTACCTAGTTGCCCTTTCAAATGATCTCCTCGTTTTTGGAAGGGAACTTTATCACCAAATGCAGAGTCAAAACTACAGCTTTAAGCTTGTTTTTCCATTACTCCTAAGAATTTGACTAACTCATCTAGGTAAGTTTAACGCTT

[0138] SEQ ID NO.84 (MNP_041 genome fragment):

[0139] TTGTCAATCTTAAATATGTCAATTTTTCTTACAATAGACTACAAGGAGAGATTCCCAATGGTGGACCTTTCATAAATTTCACTGCCCAATCTTTCACGCATAATGAAGCACTTTGTGGCAACCCTCGTTTTCTAGTCCCTCCATGCGCTGAACAAATTATAACTAGGAAAAGATCAAGAAGAAAG TTGCTTCTAATCAAATGCATATTGCCTATAGTTGTGTCACTGTCAATCATTTTGGTGGTTACATGCATAATAGTTCAACGGCGTAAAAGAAAAAATTTGAAAAATCCACTTGCACGGAATAACTCATCAACTTTAGGAGCACCAAAAAGGGTTTCCTATTATGAGCTTGTACAAGCAACGAATGGA TTCAGTGAGAGTAATTTGCTTGGAAGGGGGAGTTTTGGCTCTGTGTATCAAGGGATGCTCTCTAATGGGTTGATGGTTGCAATTAAAGTGCTTCATCTGGACTTGGAAGGAACATCAAAGAGCTTTGATGCAGAATGCAATGCAATGCGCAATCTACGTCATCGAAATCTAGTTAAAATTATCAGC AGTTGCTCAAATGTTGATTTCAAATCTTTGGTAATGGAGTTCATGGAAAATGGAAGCCTCGATAGATGGTTATACTCTCATAACTATTGTTTAGACTTCTTGCAAAGGTTGAGTATAATGATAGACGTGGCATCTGCATTGGAATATCTCCATCATGGTTCTTCGGTACCGGTTATTCATTGCGAT

[0140] Multiplex PCR amplification of the test samples was performed using the 28 pairs of specific primers listed in Table 3. The amplified products were then subjected to high-throughput sequencing, and sequence alignment was performed using sequences shown in SEQ ID NO. 57 to SEQ ID NO. 84 as references. At each MNP marker site, the variation information of multiple SNP sites within the same amplification region was combined to form the MNP haplotype of that site, thereby enabling the identification of Hainan rosewood varieties.

[0141] Example 3

[0142] A method for analyzing the genetic diversity of Hainan rosewood based on MNP markers includes the following steps:

[0143] 1. MNP locus detection rate and quality assessment

[0144] To verify the effectiveness of the 28 MNP markers developed in Examples 1 and 2, 20 families were selected from 303 family populations, and another 20 individuals from independently collected natural populations were selected to form 40 validation samples for independent validation. Genotyping was performed on the sequencing data of these 40 samples, and the detection rate of all 28 MNP loci was 100%. Figure 1 The results indicate that the developed MNP marker has high stability and effectiveness, can be widely present in different Hainan rosewood individuals, and can be successfully amplified in the tested samples, making it suitable for variety identification.

[0145] Table 5 Quality assessment and genetic diversity parameters of 28 MNP loci

[0146] MNP site Detection rate (%) Number of alleles (Na) PIC DP Ho He MNP_001_chr01A_2571044_2571172 100 2 0.2471 0.2888 0 0.2888 MNP_003_chr01A_32383041_32383197 100 16 0.8717 0.8825 1 0.8825 MNP_004_chr01A_76737812_76737921 100 2 0.2879 0.3487 1 0.3487 MNP_005_chr01A_80816867_80816896 100 2 0.0476 0.0488 1 0.0488 MNP_006_chr02A_15622135_15622246 100 3 0.3589 0.4338 1 0.4338 MNP_007_chr02A_15629269_15629424 100 8 0.5276 0.5637 1 0.5637 MNP_009_chr02A_16800134_16800254 100 2 0.3047 0.3750 0 0.3750 MNP_010_chr02A_24986574_24986675 100 2 0.1638 0.1800 0 0.1800 MNP_012_chr02A_74699419_74699476 100 2 0.3744 0.4988 1 0.4988 MNP_013_chr03A_25753757_25753786 100 2 0.2879 0.3487 0 0.3487 MNP_015_chr03A_26981200_26981268 100 5 0.4548 0.5112 1 0.5112 MNP_016_chr03A_39739461_39739563 100 2 0.3515 0.4550 1 0.4550 MNP_017_chr03A_51877321_51877440 100 3 0.3099 0.3587 1 0.3587 MNP_018_chr03A_57086260_57086310 100 2 0.3192 0.3987 1 0.3987 MNP_019_chr03A_57092145_57092207 100 3 0.3589 0.4338 1 0.4338 MNP_020_chr03A_57463859_57464039 100 3 0.3813 0.4712 1 0.4712 MNP_023_chr04A_35800205_35800250 100 2 0.3648 0.4800 1 0.4800 MNP_024_chr04A_42152519_42152689 100 3 0.3099 0.3587 1 0.3587 MNP_025_chr04A_42153349_42153482 100 2 0.0905 0.0950 0 0.0950 MNP_027_chr04A_52867248_52867363 100 2 0.3744 0.4988 1 0.4988 MNP_029_chr04A_54163885_54163980 100 4 0.4205 0.4650 1 0.4650 MNP_031_chr05A_42055031_42055112 100 2 0.3425 0.4387 1 0.4387 MNP_032_chr05A_43634633_43634795 100 2 0.2879 0.3487 0 0.3487 MNP_034_chr05A_56599346_56599436 100 2 0.2688 0.3200 1 0.3200 MNP_035_chr06A_7886056_7886092 100 3 0.4309 0.5263 1 0.5263 MNP_039_chr06A_24105775_24105811 100 10 0.8403 0.8562 1 0.8562 MNP_040_chr07A_20651237_20651311 100 4 0.3058 0.3362 1 0.3362 MNP_041_chr07A_41342891_41343033 100 3 0.5392 0.6138 1 0.6138 average value 100 3.6 0.3651 0.4262 0.8214 0.4345

[0147] The polymorphic information content (PIC) distribution of the 28 MNP sites is shown in the figure. Figure 2 Among them, MNP_003 (PIC = 0.8717) and MNP_039 (PIC = 0.8403) had the highest PIC values, while MNP_025 (PIC = 0.0905) and MNP_005 (PIC = 0.0476) had the lowest PIC values, with an overall average PIC value of 0.3651.

[0148] Meanwhile, as shown in Table 5, the detection rate of all 28 MNP loci was 100%, the average number of alleles (Na) was 3.6, the average PIC value was 0.3651, the average DP value was 0.4262, the average observed heterozygosity (Ho) was 0.8214, and the average expected heterozygosity (He) was 0.4345. Among them, MNP_003_chr01A_32383041_32383197 (PIC = 0.8717, Na = 16) and MNP_039_chr06A_24105775_24105811 (PIC = 0.8403, Na = 10) showed the highest polymorphism, indicating that these regions may be highly variable segments in the Hainan rosewood genome, with high genetic information content and significant genetic variation.

[0149] 2. Allele diversity analysis

[0150] In this embodiment, a total of 100 alleles were detected (28 MNP loci in total). The number of alleles detected at each MNP locus ranged from 2 to 16, with an average of 3.6 (Table 5). This result indicates that the 28 MNP markers developed in this invention have rich allelic diversity in the Hainan rosewood population and can effectively capture genetic variation within the population. Among them, MNP_003 (Na = 16) and MNP_039 (Na = 10) had the most detected alleles, indicating that these regions may be highly variable segments in the Hainan rosewood genome; while the polymorphism of MNP_005 (Na = 2) and MNP_025 (Na = 2) loci was relatively low, but due to their specific distribution location in the genome, they can still be used as auxiliary markers.

[0151] 3. Analysis of heterozygosity and genetic diversity

[0152] In population genetics, heterozygosity is an important indicator of genetic diversity. When the heterozygosity frequency at most loci is concentrated at a moderate level (40% - 65%), it usually indicates that the population has a moderate level of genetic diversity.

[0153] The allele frequencies of all heterozygous loci were statistically analyzed, and the results are shown in [the table below]. Figure 3 The heterozygosity frequency was relatively concentrated around 50%, with most loci having a heterozygosity frequency between 40% and 65%, indicating that MNP markers have a moderate level of genetic diversity. In this example, the average observed heterozygosity (Ho) of the 28 MNP markers was 0.8214, the average expected heterozygosity (He) was 0.4345, and the average Shannon diversity index (I) was 0.7428. The observed heterozygosity was higher than the expected heterozygosity (Ho > He), indicating that the proportion of heterozygotes in the tested population was higher than expected. This is related to the fact that the tested materials included 20 individuals from a natural population, which are not subject to artificial selection and typically have higher heterozygosity.

[0154] 5. Genetic distance and phylogenetic analysis

[0155] Based on genotypic data from 28 MNP markers, genetic distances among 40 Hainan rosewood samples were calculated. The results are shown below. Figure 4 .Depend on Figure 4 It can be seen that among the 780 pairs of comparisons, the average genetic distance was 0.4372, with a range of 0 to 0.7100. Among them, about 65% of the sample pairs had a genetic distance between 0.30 and 0.60, indicating that the test population as a whole has a moderate degree of genetic difference and there is relatively rich genetic variation among individuals.

[0156] A phylogenetic tree of 40 samples was constructed using the Neighbor-Joining (NJ) method. Figure 6 ).from Figure 6 It can be seen that the two groups of samples are intertwined on the phylogenetic tree and do not cluster into independent branches, indicating that the genetic differentiation between the two groups is relatively weak. This result is consistent with principal component analysis (…). Figure 5 The analysis results of the population differentiation coefficient (Fst = 0.0265) corroborate each other.

[0157] Table 6. Genetic distance statistics of 40 Hainan rosewood samples

[0158] Statistical indicators numerical values Total logarithm of pairwise comparisons 780 Average genetic distance 0.4372 Minimum genetic distance 0.0000 Maximum genetic distance 0.7100

[0159] 6. Principal Component Analysis and Population Differentiation

[0160] Principal component analysis (PCA) was performed on 40 Hainan rosewood samples. The first principal component (PC1) explained 14.2% of the genetic variation, and the second principal component (PC2) explained 11.4% of the genetic variation, with a cumulative contribution of 25.6%. (PCA analysis results...) Figure 5 The results showed that group A (family population) and group F (natural population) were mixed in the principal component space without forming obvious clusters, consistent with the phylogenetic tree analysis results. Further calculation of the inter-population differentiation coefficient (Fst) revealed that the average Fst value between group A (family population) and group F (natural population) was 0.0265 (< 0.05), indicating no significant genetic differentiation between the two groups. This result corroborates the PCA analysis, confirming that the genetic background of the family population and the natural population is similar, and no significant genetic differentiation has occurred.

[0161] Example 4

[0162] A method for constructing a molecular identity card for Hainan rosewood includes the following steps:

[0163] In this invention, polynucleotide polymorphism (PNP) refers to sequence polymorphism caused by variations in one or more nucleotides within a nucleotide sequence. MNP markers are used to distinguish the genotypes of different samples, while molecular identity cards are codes generated based on MNP marker genotype detection results, used for the digital identification and management of germplasm resources. These two correspond to different aspects of this invention: MNP marker combinations form the technical basis for variety identification, while molecular identity cards represent the application of this basis in germplasm resource management.

[0164] 1. Screening of core primer combinations

[0165] From the 28 MNP markers screened in Example 3, considering the polymorphism information content (PIC), the number of alleles, and the actual distinguishing effect, the three markers with the highest PIC values ​​were selected as the core marker combination for constructing the molecular identity card: MNP_003 (PIC = 0.8717, Na = 16), MNP_039 (PIC = 0.8403, Na = 10), and MNP_041 (PIC = 0.5392, Na = 3). This combination covers the region with the highest polymorphism in the Hainan rosewood genome, and the primer amplification efficiency is stable.

[0166] Table 7 Core Primer Combination Information

[0167] Primer name PIC value Number of alleles (Na) Product length (bp) MNP_003 0.8717 16 231 MNP_039 0.8403 10 216 MNP_041 0.5392 3 207

[0168] 2. Indigenous ID Card Coding Rules

[0169] This invention is based on MNP marker technology. By detecting the genotypes of three core MNP markers (MNP_003, MNP_039, and MNP_041), its sub-locus information is converted into 0 / 1 numerical codes, constructing a molecular identity card that can be used for the digital management of germplasm resources. This molecular identity card is a coded representation of the MNP marker detection results and is an application product of this invention.

[0170] Encoding Rules: Each MNP marker contains several sub-locus sites (SNPs). The genotype of each sub-locus site is encoded as follows: if the sub-locus site matches the reference genome sequence, it is encoded as 0; if the sub-locus site does not match the reference genome sequence, it is encoded as 1. The encoding of each MNP marker is a concatenation of the encodings of all its sub-locus sites. The encodings of three MNP markers are connected by a "|" separator, in the format: MNP_003 sub-locus encoding|MNP_039 sub-locus encoding|MNP_041 sub-locus encoding. Where: MNP_003 contains 14 sub-locus sites with a encoding length of 14 bits; MNP_039 contains 10 sub-locus sites with a encoding length of 10 bits; MNP_041 contains 3 sub-locus sites with a encoding length of 3 bits. After concatenation, the molecular identification code for each sample is 27 bits long.

[0171] Example:

[0172] Taking family group sample A-3 as an example:

[0173] The genotype codes for the 14 sub-locus sites of MNP_003 are 00010001110100; the genotype codes for the 10 sub-locus sites of MNP_039 are 0100011011; and the genotype codes for the 3 sub-locus sites of MNP_041 are 111. After tandem coding, the DNA molecular identification code for A-3 is: 00010001110100|0100011011|111. Following the above coding rules, the DNA molecular identification codes for the 40 Hainan rosewood samples are shown in Table 8.

[0174] Table 8. DNA molecular identification codes of 40 Hainan rosewood samples

[0175] Serial Number Sample number Sample source Molecular ID Code 1 A-3 Family Group 00010001110100|0100011011|111 2 A-11 Family Group 00010001110100|0100011011|111 3 A-21 Family Group 00010001110100|0100110111|111 4 A-36 Family Group 00010001110100|0100011011|100 5 A-46 Family Group 00010001110100|0001010111|001 6 A-50 Family Group 00010001110100|0110011010|111 7 A-60 Family Group 00010001110100|0100011011|111 8 A-66 Family Group 00010001110100|0110011010|000 9 A-78 Family Group 00010001110100|0110011010|001 10 A-83 Family Group 00010001110100|0100011011|011 11 A-87 Family Group 00010001110100|0001010100|010 12 A-96 Family Group 00010001110100|0100011011|000 13 A-109 Family Group 00010001110100|0110011010|011 14 A-116 Family Group 00010001110100|0100011010|001 15 A-156 Family Group 00010001110100|0110011010|010 16 A-168 Family Group 00010001110100|0100011011|000 17 A-174 Family Group 00010001110100|0100011011|100 18 A-188 Family Group 00010001110100|0100011011|001 19 A-225 Family Group 00010001110100|0100011011|010 20 A-242 Family Group 00010001110100|0100011011|001 21 F-3 Natural groups 00010001110100|0100011011|011 22 F-14 Natural groups 00010001110100|0110011010|001 23 F-027 Natural groups 00010001110100|0110011010|011 24 F-037 Natural groups 00010001110100|0100011011|010 25 F-042 Natural groups 00010001110100|0100011011|101 26 F-057 Natural groups 00010001110100|0100011011|000 27 F-063 Natural groups 00010001110100|0100011011|000 28 F-078 Natural groups 00010001110100|0001010111|001 29 F-088 Natural groups 00010001110100|0100011011|001 30 F-99 Natural groups 00010001110100|0100011011|101 31 F-100 Natural groups 00010001110100|0001010111|111 32 F-118 Natural groups 00010001110100|0100011011|100 33 F-129 Natural groups 00010001110100|0100011011|101 34 F-139 Natural groups 00010001110100|0110011010|011 35 F-145 Natural groups 00010001110100|0100011011|010 36 F-149 Natural groups 00010001110100|0100011011|011 37 F-151 Natural groups 10010001110100|0100011011|011 38 F-168 Natural groups 00010001110100|0100011010|010 39 F-174 Natural groups 00010001110100|0100011011|011 40 F-191 Natural groups 00010001110100|0100011011|010

[0176] As shown in Table 8, the coding of pedigree population (Group A) samples is highly consistent, while the coding of natural population (Group F) samples is highly diverse. The two groups of samples can be distinguished by their coding differences. This coding system can serve as an auxiliary tool for the digital identification and traceability management of germplasm resources.

[0177] The molecular identification codes of each Hainan rosewood variety are input into barcode generation software to generate corresponding barcodes. Simultaneously, information such as variety name, sample number, sample origin, molecular identification code, detection method (MNP marker method), and core markers (MNP_003, MNP_039, MNP_041) are input into a QR code generation tool to generate a QR code. By scanning the QR code, the variety information, detection information, and molecular identification code of the sample can be obtained, facilitating germplasm resource management and variety identification.

[0178] By scanning the QR code, the variety name, sample number, sample source, molecular identification code and testing information of the sample can be quickly obtained, realizing the digital identification and traceability management of germplasm resources.

Claims

1. A primer set based on MNP marker combinations from Hainan rosewood, characterized in that, The MNP tag combination consists of 28 MNP tags: MNP_001_chr01A_2571044_2571172, MNP_003_chr01A_32383041_32383197, MNP_004_chr01A_76737812_76737921, MNP_005_chr01A_80816867_80816896, MNP_006_chr02A_15622135_15622246, MNP_007_chr02A_15629269_15629424, MNP_009_chr02A_1680 0134_16800254, MNP_010_chr02A_24986574_24986675, MNP_012_chr02A_74699419_74699476, MNP_013_chr03A_25753757_25753786, MNP_ 015_chr03A_26981200_26981268, MNP_016_chr03A_39739461_39739563, MNP_017_chr03A_51877321_51877440, MNP_018_chr03A_57086260 _57086310, MNP_019_chr03A_57092145_57092207, MNP_020_chr03A_57463859_57464039, MNP_023_chr04A_35800205_35800250, MNP_024_ chr04A_42152519_42152689, MNP_025_chr04A_42153349_42153482, MNP_027_chr04A_52867248_52867363, MNP_029_chr04A_54163885_541 63980, MNP_031_chr05A_42055031_42055112, MNP_032_chr05A_43634633_43634795, MNP_034_chr05A_56599346_56599436, MNP_035_chr0 6A_7886056_7886092, MNP_039_chr06A_24105775_24105811, MNP_040_chr07A_20651237_20651311, MNP_041_chr07A_41342891_41343033; The 28 MNP markers are shown below: ； The primer set for amplifying the MNP marker combination includes 28 primer pairs, and the nucleotide sequences of the 28 primer pairs are shown in SEQ ID NO.1-SEQ ID NO.

56.

2. A kit for detecting the MNP marker combination of claim 1, characterized in that, The kit contains the primer set as described in claim 1.

3. A method for constructing a DNA molecular identity card from Hainan rosewood, characterized in that, Includes the following steps: (1) Extract genomic DNA from the Hainan rosewood sample to be tested; (2) Using the DNA extracted in step (1) as a template, perform multiplex PCR amplification using the primer set of the MNP marker combination described in claim 1; (3) Perform high-throughput sequencing on the amplification products to obtain genotype data for each MNP locus; (4) Based on the genotype data of three core MNP markers MNP_003_chr01A_32383041_32383197, MNP_039_chr06A_24105775_24105811 and MNP_041_chr07A_41342891_41343033, the DNA molecular identification code of the sample is formed by sequentially cascading them together. The three core MNP markers are MNP_003_chr01A_32383041_32383197, MNP_039_chr06A_24105775_24105811 and MNP_041_chr07A_41342891_41343033 as described in claim 1. The format of the DNA molecular identification code for this sample, formed by sequentially concatenating MNP_041_chr07A_41342891_41343033, is as follows: the codes for 14 sub-sites of MNP_003_chr01A_32383041_32383197, the codes for 10 sub-sites of MNP_039_chr06A_24105775_24105811, and the codes for 3 sub-sites of MNP_041_chr07A_41342891_41343033 are concatenated in sequence, separated by "|"; each sub-site is coded as 0 when it is consistent with the reference genome sequence, and as 1 when it is inconsistent.

4. The method according to claim 3, characterized in that, The PIC values ​​of the three core MNP markers are 0.8717, 0.8403, and 0.5392, respectively.

5. A method for analyzing genetic variation in Hainan rosewood, characterized in that, The genetic variation refers to the nucleotide differences between different individuals of Hainan rosewood at the 28 MNP marker loci described in claim 1, relative to the sequence shown in the reference genome; the genetic variation information of each MNP marker locus is obtained by comparing the sequencing data of that locus with the reference genome sequence and is presented in the form of alleles, specifically including: (a) Allelic information: The number of alleles detected at each MNP marker site ranged from 2 to 16, with a total of 98 alleles detected; (b) Polymorphic information content: ranged from 0.0476 to 0.8717, with an average of 0.3651; (c) Discrimination: The range was 0.0488 to 0.8825, and the average value was 0.4262; (d) Heterozygosity information: The observed heterozygosity average was 0.7857, the expected heterozygosity average was 0.4345, and the heterozygosity frequency was concentrated between 40% and 65%. (e) Highly variable regions: MNP_003_chr01A_32383041_32383197 and MNP_039_chr06A_24105775_24105811 are highly variable regions in the genome of Hainan rosewood.

6. The method according to claim 3 or 5, characterized in that, The reference genome nucleotide sequences are shown in SEQ ID NO.57-SEQ ID NO.84, which simultaneously contain the core polymorphic regions of 28 MNP marker sites and their upstream and downstream flanking sequences.

7. A method for identifying Hainan rosewood varieties, characterized in that, Includes the following steps: (1) Extract genomic DNA from the Hainan rosewood sample to be tested; (2) Using the DNA extracted in step (1) as a template, perform multiplex PCR amplification using the primer set of the MNP marker combination described in claim 1; (3) Perform high-throughput sequencing on the amplification products to obtain genotype data for each MNP locus; (4) Compare the MNP locus genotype data of the sample to be tested with the control sample, and determine the variety based on the genotype difference to achieve the identification of Hainan rosewood varieties.

8. The method according to claim 3 or 7, characterized in that, The reaction system for multiplex PCR amplification in step (2) is as follows: 2 μL of 10 ng / μL DNA template; 1 μL of 10 μM upstream primer pool; 1 μL of 10 μM downstream primer pool; 15 μL of 2 × PCRReady Mix; and double-distilled water to a total volume of 25 μL.

9. The method according to claim 3 or 7, characterized in that, The reaction procedure for multiplex PCR amplification in step (2) is as follows: 98°C pre-denaturation for 3 min; 8 cycles of 98°C denaturation for 30 sec, 50°C annealing for 30 sec, and 72°C extension for 30 sec; followed by 25 cycles of 98°C denaturation for 30 sec, 66°C annealing for 30 sec, and 72°C extension for 30 sec; and finally, 72°C extension for 5 min.

10. The application of a primer set of MNP marker combination according to claim 1 in the identification of Hainan rosewood varieties or the detection of seed purity.

Images