Extracellular vesicles with anti-aging potential

Abstract

The application discloses extracellular vesicles with anti-aging potential, and belongs to the field of biotechnology and anti-aging. The extracellular vesicles are derived from brown adipose tissue or plasma of young mice treated by exercise or cold induction. The extracellular vesicles can play a significant anti-aging role by improving the aging-related phenotypes of old mice, including appearance parameter phenotypes, enhanced exercise capacity, metabolic characteristics transformed to be younger, and reduced aging markers. The application provides a new natural active substance and application prospect for anti-aging treatment.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and anti-aging, and specifically relates to an extracellular vesicle with anti-aging potential. Background Technology

[0002] Aging, as an inevitable degenerative process that organisms undergo with age, has far-reaching and widespread harmful effects. At the metabolic level, aging can trigger lipid metabolism disorders, manifested as a decrease in lipid turnover rate and abnormal accumulation of intracellular lipids, significantly increasing the risk of obesity and related metabolic diseases. At the functional level, various tissues and organs in the body exhibit progressive functional decline, including reduced protein synthesis efficiency, decreased metabolic rate, and weakened immune function. The cardiovascular system is characterized by decreased vascular elasticity and exacerbated arteriosclerosis. The digestive system experiences reduced gastric juice secretion and gastric mucosal atrophy, leading to impaired digestive function. The respiratory system suffers from a decrease in lung capacity due to a reduction in the number of alveoli. The nervous system is accompanied by characteristics such as memory loss and cognitive decline.

[0003] Current anti-aging methods have significant limitations: while chemical drugs can intervene in the aging process to some extent, they often come with serious side effects such as liver and kidney damage; stem cell therapy faces issues such as immune rejection, cell source safety, and the potential risk of tumor formation, limiting its clinical application. It is worth noting that exercise and cryo-induction, as non-pharmacological interventions, have shown positive effects in regulating brown adipose tissue function and extracellular vesicles, providing new directions for anti-aging research. Exercise can promote enhanced brown adipose tissue activity and regulate the transport and delivery of substances in plasma extracellular vesicles, thereby affecting processes such as adipocyte metabolism; cryo-induction can activate brown adipose tissue, causing its secreted extracellular vesicles to regulate functions such as glucose metabolism by carrying specific substances. However, the effectiveness of these methods may be affected by individual adherence and duration, making it difficult to promote them as stable treatment methods.

[0004] Brown adipose tissue (BAT) is considered an active endocrine organ that produces and secretes various adipokines, especially extracellular vesicles, which regulate the function of distant target organs via blood circulation. Studies have confirmed that adipose tissue is the main source of exosomes in peripheral blood circulation. BAT-derived exosomes (BATEVs), as key carriers of long-distance signal transduction, can specifically bind to recipient cells via endocrine pathways, transferring their contents to recipient cells and thereby regulating gene expression in distant tissues. Compared with BAT transplantation, BATEV therapy not only achieves similar metabolic regulatory effects but also has significant advantages such as no aneuploidy, no immune rejection, and no dependence on donor tissue. Furthermore, it is easier to store, non-invasive, and safer, making it an ideal alternative to BAT transplantation.

[0005] Therefore, this patent aims to study the effect of BATEVs derived from young mice on improving the lifespan and healthy lifespan of aged mice. It also explores whether BATEVs derived from young mice subjected to cold induction or exercise treatment can bring better results. By injecting naturally aging 18-month-old mice with BATEVs derived from 2-month-old mice, the potential of this treatment method in improving lifespan and healthy lifespan can be investigated. Summary of the Invention

[0006] This invention addresses the limitations in efficacy or safety of existing anti-aging substances by providing an extracellular vesicle with a clearly identified source and significant anti-aging activity to improve various aging-related phenotypes.

[0007] This invention provides an application of brown adipose tissue exosomes in the preparation of anti-aging drugs. The method for preparing brown adipose tissue exosomes is as follows: After culturing mice at 4-8℃ for 3-4 weeks, the brown adipose tissue between the scapulae of the mice is dissected and extracted from the brown adipose tissue; or the mice are subjected to forced treadmill exercise with the following parameters: speed 10-15 m / min, incline 0-10°, 30-40 min daily, 5-6 times per week, for 3-4 weeks, after which the brown adipose tissue between the scapulae of the mice is dissected and extracted from the brown adipose tissue. In one embodiment of the present invention, after culturing mice at 4°C for 3-4 weeks, the brown adipose tissue between the scapulae of the mice is dissected and separated, and exosomes are extracted from the brown adipose tissue; or the mice are subjected to forced treadmill exercise with the following parameters: speed 10 m / min, incline 0-10°, 30 min per day, 5 times per week, for 3-4 weeks, after which the brown adipose tissue between the scapulae of the mice is dissected and separated, and exosomes are extracted from the brown adipose tissue.

[0008] In one embodiment of the present invention, the drug further contains pharmaceutically acceptable pharmaceutical excipients; the pharmaceutical excipients refer to conventional drug carriers in the pharmaceutical field.

[0009] In one embodiment of the present invention, the excipients include one or more of the following: binders such as cellulose derivatives, alginate, gelatin, and polyvinylpyrrolidone; diluents such as starch, pregelatinized starch, dextrin, sucrose, lactose, and mannitol; fillers such as starch and sucrose; humectants such as glycerin; disintegrants such as sodium carboxymethyl starch, cross-linked polyvinylpyrrolidone, and dry starch; absorption promoters such as quaternary ammonium compounds; surfactants such as polysorbate, fatty acid sorbitan, and fatty acid glycerides; colorants such as titanium dioxide, sunset yellow, methylene blue, and pharmaceutical iron oxide red; lubricants such as hydrogenated vegetable oil, talc, and polyethylene glycol; coating materials such as acrylic resin, hydroxypropyl methylcellulose, povidone, and cellulose acetate; and other excipients such as flavoring agents and sweeteners may also be added to the composition.

[0010] In one embodiment of the present invention, the dosage form of the drug includes, but is not limited to, oral dosage form, injection dosage form, and inhalation dosage form.

[0011] In one embodiment of the present invention, the oral dosage form includes, but is not limited to, tablets, capsules, granules, oral liquids, and oral suspensions.

[0012] In one embodiment of the present invention, the injectable dosage form includes, but is not limited to, an injectable solution or an injectable powder.

[0013] In one embodiment of the present invention, the inhalation dosage form includes, but is not limited to, aerosols and powder inhalers.

[0014] In one embodiment of the present invention, the anti-aging related phenotypes include: (1) Phenotypic improvement: selected from at least one of weight regulation, hair condition improvement or skin elasticity enhancement; (2) Improved metabolism: selected from at least one of the following: decreased blood glucose level, increased insulin sensitivity, increased energy consumption, or increased fat metabolism rate; (3) Improved athletic performance: selected from at least one of the following: increased treadmill endurance, enhanced grip strength, or accelerated post-exercise recovery rate; (4) Improved memory function: selected from at least one of the following: increased spontaneous alternation rate in Y maze, shortened escape latency in water maze experiment, improved recognition index in new object recognition experiment, or prolonged latency in passive avoidance experiment; (5) Decreased aging markers: selected from at least one of the following: decreased DNA damage marker γ-H2AX signal, decreased p16 protein expression, decreased β-galactosidase activity, increased mtDNA copy number, or prolonged telomere length.

[0015] In one embodiment of the present invention, the drug further contains miRNA.

[0016] In one embodiment of the present invention, the miRNA includes let-7i-5p, let-7f-5p, miR-143-3p, let-7a-5p, miR-378a-3p and / or let-7c-5p.

[0017] The present invention provides the use of a composition in the preparation of an anti-aging drug, the composition comprising miRNA extracted from brown adipose exosomes, the miRNA including let-7i-5p, let-7f-5p, miR-143-3p, let-7a-5p, miR-378a-3p and / or let-7c-5p.

[0018] In one embodiment of the present invention, the preparation method of the brown adipose tissue exosomes is as follows: after culturing mice at 4-8°C for 3-4 weeks, the brown adipose tissue between the scapulae of the mice is dissected and separated, and the exosomes in the brown adipose tissue are extracted; or the mice are subjected to forced treadmill exercise with the following parameters: speed 10-15 m / min, slope 0-10°, 30-40 min per day, 5-6 times per week, for 3-4 weeks, after which the brown adipose tissue between the scapulae of the mice is dissected and separated, and the exosomes in the brown adipose tissue are extracted.

[0019] In one embodiment of the present invention, after culturing mice at 4°C for 3-4 weeks, the brown adipose tissue between the scapulae of the mice is dissected and separated, and exosomes are extracted from the brown adipose tissue; or the mice are subjected to forced treadmill exercise with the following parameters: speed 10 m / min, incline 0-10°, 30 min per day, 5 times per week, for 3-4 weeks, after which the brown adipose tissue between the scapulae of the mice is dissected and separated, and exosomes are extracted from the brown adipose tissue.

[0020] In one embodiment of the present invention, the drug further contains pharmaceutically acceptable pharmaceutical excipients; the pharmaceutical excipients refer to conventional drug carriers in the pharmaceutical field.

[0021] In one embodiment of the present invention, the excipients include one or more of the following: binders such as cellulose derivatives, alginate, gelatin, and polyvinylpyrrolidone; diluents such as starch, pregelatinized starch, dextrin, sucrose, lactose, and mannitol; fillers such as starch and sucrose; humectants such as glycerin; disintegrants such as sodium carboxymethyl starch, cross-linked polyvinylpyrrolidone, and dry starch; absorption promoters such as quaternary ammonium compounds; surfactants such as polysorbate, fatty acid sorbitan, and fatty acid glycerides; colorants such as titanium dioxide, sunset yellow, methylene blue, and pharmaceutical iron oxide red; lubricants such as hydrogenated vegetable oil, talc, and polyethylene glycol; coating materials such as acrylic resin, hydroxypropyl methylcellulose, povidone, and cellulose acetate; and other excipients such as flavoring agents and sweeteners may also be added to the composition.

[0022] In one embodiment of the present invention, the dosage form of the drug includes, but is not limited to, oral dosage form, injection dosage form, and inhalation dosage form.

[0023] In one embodiment of the present invention, the oral dosage form includes, but is not limited to, tablets, capsules, granules, oral liquids, and oral suspensions.

[0024] In one embodiment of the present invention, the injectable dosage form includes, but is not limited to, an injectable solution or an injectable powder.

[0025] In one embodiment of the present invention, the inhalation dosage form includes, but is not limited to, aerosols and powder inhalers.

[0026] This invention provides a method for preparing brown adipose exosomes BAT-exos: The method is as follows: SPF-grade C57BL / 6J young mice (2 months old) were randomly divided into 3 groups: a control group (no special treatment) and a cold treatment group (treated at 4℃ for 2 weeks). Mice in each group were sacrificed after the corresponding treatment, anesthetized with isoflurane inhalation (5%), and brown adipose tissue was obtained through dissection. BATEVs were isolated and purified by ultracentrifugation, identified, and then used for further processing. The extraction methods for extracellular vesicles include ultracentrifugation, density gradient centrifugation, size exclusion chromatography, ultrafiltration, commercial reagent kits, or automated exosome extraction systems; the EXODUS fully automated exosome extraction system is preferred.

[0027] Laboratory animal intervention: SPF-grade C57BL / 6J aged mice (18 months old, naturally aged) were randomly divided into 7 groups: Group 1 (18-month-old aged mice treated with brown adipose tissue exosomes (BATEVs) from young mice); Group 3 (18-month-old aged mice treated with cold-treated brown adipose tissue exosomes (Cold BATEVs) from young mice); Group 4 (18-month-old aged mice treated with plasma exosomes (MPEVs) from young mice); Group 5 (18-month-old aged mice treated with exercise-induced plasma exosomes (Exercise MPEVs) from young mice); Group 6 (18-month-old aged mice treated with cold-treated plasma exosomes (Cold MPEVs) from young mice); Group 7 (18-month-old aged control group); and 5 young mice as young controls in each group. All groups received a tail vein injection once a week for 6-8 weeks.

[0028] Effectiveness evaluation: Behavioral assessment: After the intervention, the mice's activity level, cognitive function, muscle strength and coordination were assessed through open field test, new object recognition test, forelimb grip strength test, rotarod fatigue test and Y maze test.

[0029] Physiological indicators were measured: skin tissue morphology (paraffin embedding and H&E staining), glucose and tolerance were measured, and energy metabolism (oxygen consumption and carbon dioxide production) was monitored using the CLAMS system.

[0030] Mechanism investigation sample collection: After euthanizing mice, skin, serum, brown adipose tissue, muscle, liver, spleen, lung, kidney, hippocampus and testis tissue were collected for aging phenotype detection (serum metabolite analysis, telomere length, mtDNA expression level, SASP factor expression, β-galactosidase activity, etc.).

[0031] This invention provides an extracellular vesicle with anti-aging activity, wherein the extracellular vesicle is derived from brown adipose tissue or plasma of young mice subjected to exercise treatment or cold induction treatment; the extracellular vesicle can improve at least one aging-related phenotype in aged mice, wherein the aging-related phenotype includes: (1) phenotype improvement: selected from at least one of weight regulation, hair condition improvement or skin elasticity improvement; (2) metabolic improvement: selected from at least one of decreased blood glucose level, increased insulin sensitivity, increased energy consumption or increased fat metabolism rate; (3) improved athletic ability: selected from at least one of prolonged treadmill endurance, enhanced grip strength or accelerated recovery rate after exercise; (4) improved memory function: selected from at least one of increased spontaneous alternation rate in Y maze, shortened escape latency in water maze test, increased recognition index in new object recognition test or prolonged latency in passive avoidance test; (5) decreased aging markers: selected from at least one of decreased DNA damage marker γ-H2AX signal, decreased p16 protein expression, decreased β-galactosidase activity, increased mtDNA copy number or prolonged telomere length.

[0032] The present invention provides a method for preparing extracellular vesicles, the method comprising the following steps: (1) pre-treating young mice: the pre-treating is exercise treatment or cold induction treatment; (2) separating brown adipose tissue or plasma from the pre-treated young mice; (3) extracting extracellular vesicles from the brown adipose tissue or plasma, thereby obtaining the vesicles.

[0033] This invention provides the application of the above-mentioned extracellular vesicles in the preparation of anti-aging products; the young mice are 6-12 week old SPF-grade mice; the old mice are 18-24 month old SPF-grade mice; the extraction method of extracellular vesicles in step (3) is ultrasonic nanofiltration, ultracentrifugation, density gradient centrifugation, or extraction using a kit. The anti-aging products are drugs, health products, or cosmetics. The dosage form of the drugs is injection, lyophilized powder injection, or nano-formulation; the dosage form of the health products is oral liquid, capsules, or tablets.

[0034] Beneficial effects The exosomes of this invention are naturally derived from young mouse tissue / plasma, exhibiting high safety and low immunogenicity. The exosomes of this invention can achieve multi-target anti-aging: simultaneously improving phenotype, metabolism, exercise capacity and aging markers, with comprehensive effects; The method for preparing exosomes according to the present invention is simple: they can be extracted using conventional centrifugation techniques and are easy to scale up for production. Attached Figure Description

[0035] Figure 1 Electron micrographs of extracellular vesicles (A) from brown adipose tissue and extracellular vesicles (B) from plasma extracted according to the embodiments of the present invention.

[0036] Figure 2 The particle size distribution of brown adipose tissue extracellular vesicles (A) and plasma extracellular vesicles (B) extracted according to the embodiments of the present invention is shown in the figure.

[0037] Figure 3 This is to adopt the treatment strategy described in the embodiments of the present invention.

[0038] Figure 4 Phenotypic scores of physiological appearance parameters after treatment with extracellular vesicles as described in the embodiments of the present invention.

[0039] Figure 5 The results are from a rotator test after treatment with extracellular vesicles as described in the embodiments of the present invention.

[0040] Figure 6 The results of the pole climbing test after treatment with extracellular vesicles as described in the embodiments of the present invention.

[0041] Figure 7 The results of immunofluorescence staining of γ-H2AX, a marker of DNA damage in mouse liver, after treatment with extracellular vesicles as described in the embodiments of the present invention.

[0042] Figure 8 The results show the statistical intensity of the immunofluorescence signal of γ-H2AX, a marker of DNA damage in mouse liver, after treatment with extracellular vesicles as described in the embodiments of the present invention.

[0043] Figure 9 The relative length of telomeres in mouse livers after treatment with extracellular vesicles as described in the embodiments of the present invention.

[0044] Figure 10 The mtDNA copy number in mice after treatment with extracellular vesicles as described in the embodiments of the present invention.

[0045] Figure 11 This is a heatmap of serum metabolites in mice after treatment with extracellular vesicles as described in the embodiments of the present invention.

[0046] Figure 12 The results of PCA analysis of serum metabolic profiles in mice treated with extracellular vesicles as described in the embodiments of the present invention are shown.

[0047] Figure 13 This is an experimental flowchart illustrating the use of BATEVs and Exercise BATEVs in combination to intervene in an in vitro cell aging model, as described in this embodiment of the invention.

[0048] Figure 14 The results show the concentration of IL-6 in the cell supernatant after intervention with BATEVs and Exercise BATEVs as described in the embodiments of the present invention.

[0049] Figure 15 The results show the expression levels of intracellular P21 and P53 after intervention with BATEVs and Exercise BATEVs as described in this embodiment of the invention.

[0050] Figure 16 The results are based on the intersection screening of BATEVs and MPEVs co-expressing miRNAs and age-related downregulated miRNAs as described in the embodiments of the present invention.

[0051] Figure 17 The results of the co-selected miRNA target gene pathway and functional enrichment analysis obtained by screening according to the embodiments of the present invention are shown.

[0052] Figure 18 The results of the functional clustering analysis of the biological processes of co-selected miRNA target genes obtained by screening according to the embodiments of the present invention are shown.

[0053] Figure 19 The results of apoptosis-related fluorescence signal detection after treatment with candidate miRNAs obtained by screening according to the embodiments of the present invention. Detailed Implementation

[0054] To further illustrate the technical means and effects adopted by the present invention to achieve its intended purpose, the specific embodiments, structures, features, and effects of the present invention will be described in detail below with reference to the accompanying drawings and preferred embodiments. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available.

[0055] The detection methods involved in the following embodiments are as follows: Immunofluorescence staining of liver tissue DNA damage marker γ-H2AX After dewaxing, hydration, and antigen retrieval, liver tissue sections were blocked using a blocking solution. Subsequently, anti-γ-H2AX specific primary antibody (4°C overnight) and corresponding fluorescently labeled secondary antibody (room temperature, protected from light) were added sequentially for incubation. Finally, the slides were stained with DAPI-containing mounting medium, and images were acquired and the fluorescence expression level of γ-H2AX was analyzed under a fluorescence microscope.

[0056] Detection of liver telomere length Total DNA was extracted from samples using a commercial kit (Biomed). 10 ng of total DNA was used as a template for real-time quantitative PCR amplification. The amplification levels of the mitochondrial coding gene MT-CO1 and the internal reference gene GAPDH were amplified separately, and the mitochondrial target genes were normalized to calculate the relative copy number of mitochondria. The primer sequences used for the assay are as follows: telo Forward: CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTTT; telo Reverse: GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCTT; B2m Forward: CTCGGTGACCCTGGTCTTTC; B2m Reverse: CACTCACTCTGGATAGCATAC; MT-CO1 Forward: TTGGTCCCCTCCTCCAGC; MT-CO1 Reverse: CCAGTGCTAGCCGCAGGCA; Serum metabolite analysis Sample preparation and collection: 20 μL of plasma sample was mixed with 2 μL of phosphate buffer containing internal standards TSP and D2O, and transferred to a 1 mm NMR tube. Proton 1H NMR spectra were acquired at 310 K using a Bruker Avance DRX600 spectrometer equipped with a triple resonance probe. A single-pulse presaturation sequence was used, with 256 transient acquisitions and a data point of 65 kJ.

[0057] Data processing and quantification: Chemical shifts were calibrated using the alanine signal (1.475 ppm). Spectra were preprocessed using MestReNova 8.1, and resonance signals in the 0.50–4.70 ppm (aliphatic region) and 5.20–10.00 ppm (aromatic region) ranges were extracted using MATLAB. Metabolites were identified using the Chenomx database, and their peak areas were normalized to the total aliphatic spectral area after removing lipid signals. The final relative levels of metabolites were then calculated.

[0058] The specific methods for evaluating the physiological appearance parameters of aged mice involved in the following examples are shown in Table 1.

[0059] Table 1: Specific Evaluation Methods Signs of aging Clinical symptom assessment Rate hair removal Check the mice for signs of hair loss. 0 points: Normal; 0.5 points: Less than 25% hair loss; 1 point: More than 25% hair loss. Loss of coat color The color of the fur changes from black to gray or brown. 0 points: Normal; 0.5 points: Partially gray / brown; 1 point: Completely gray / brown dermatitis Record whether there are lesions on the mouse skin. 0 points: None; 0.5 points: Localized lesions (e.g., neck, sides, below the jaw); 1 point: Extensive or multifocal lesions. Beard falling out Check the mice for signs of reduced whisker count. 0 points: No detachment; 0.5 points: Feet reduced in number; 1 point: Feet missing. Hair condition Observe whether the mice show signs of poor hair care. 0 points: Smooth, silky, and glossy coat; 0.5 points: Slightly frizzy coat; 1 point: Frizzy, unkempt, and matted coat. piloerection Observe the mice, especially the back of the neck, to see if they show signs of hair standing on end. 0 points: No piloerection reaction; 0.5 points: Hair stands on end only at the base of the neck; 1 point: Generalized piloerection reaction. cataract Perform a visual examination on the mice to observe whether there is central cloudiness in the eyes. 0 points: No cataracts; 0.5 points: Small opaque spots; 1 point: Lens is noticeably opaque. Eye discharge / swelling Check for eye discharge or swelling. 0 points: Normal; 0.5 points: Mild swelling and / or discharge; 1 point: Obvious bulge and / or discharge. Microphthalmia Check the mice for uneven eyes and sunken eyes. 0 points: Normal size; 0.5 points: Slightly smaller or sunken in one or both eyes; 1 point: Very small or severely sunken in one or both eyes. corneal opacity Check the cornea for white spots or opacities. 0 points: Normal; 0.5 points: Minor corneal changes; 1 point: Significant corneal opacity and / or spots. Nasal secretions Check the mice for nasal discharge. 0 points: No discharge; 0.5 points: Small amount of discharge; 1 point: Obvious discharge, involving both nostrils. rectal prolapse Hold the mouse by the base of its tail and observe for signs of rectal prolapse. 0 points: No prolapse; 0.5 points: A small amount of rectum is visible below the tail; 1 point: The rectum is clearly visible below the tail. Penile prolapse Hold the base of the tail and observe for signs of vaginal / uterine or penile prolapse. 0 points: No prolapse; 0.5 points: Small amount of prolapsed tissue visible; 1 point: Prolapsed tissue clearly visible. diarrhea Turn the mice upside down to check for signs of diarrhea and observe the cage for fecal stains. 0 points: None; 0.5 points: Small amount of feces or bedding near the rectum; 1 point: Feces, blood, and bedding near the rectum, smeared inside the cage. Physical condition score Place the mouse on a flat surface, hold it by the base of its tail, and manually assess the fat and muscle condition of the area covering the iliac bone (back and pubic bone). 0 points: Bone is palpable but not protruding; 0.5 points: Bone is protruding or barely palpable; 1 point: Bone is very prominent or cannot be palpated due to obesity. Gait disorder Observe freely moving mice and check for abnormal gait, such as jumping, swaying, circling, standing wide or weak. 0 points: No abnormality; 0.5 points: Gait abnormality but the animal can still walk; 1 point: Obvious abnormality, affecting mobility. Threat Reflex Use an object (cotton swab) to bring close to the mouse's face (between the eyes) three times and record whether the mouse blinks. 0 points: Always responds; 0.5 points: Nearly no response after 1 or 2 attempts; 1 point: Nearly no response after 3 attempts. Tremor Observe whether the mice exhibit tremors when at rest or when attempting to climb a slope. 0 points: No tremor; 0.5 points: Slight tremor; 1 point: Obvious tremor; animals cannot climb. tumor Observe whether the mice are symmetrical and manually examine them for visible or palpable tumors. 0 points: None; 0.5 points: <1.0 cm; 1 point: >1.0 cm or multiple smaller tumors. kyphosis Examine the mouse for spinal curvature or kyphosis by sliding your finger along both sides of the spine to detect abnormalities. 0 points: None; 0.5 points: Slight kyphosis; 1 point: Obvious hunchback posture. respiratory rate Record the respiratory rate and depth of the mice and observe whether they exhibit panting behavior. 0 points: Normal; 0.5 points: Moderate change in respiratory rate and / or depth; 1 point: Significant change in rate / depth, shortness of breath. stiff tail Hold the base of the tail with one hand and gently touch the tail with your fingers with the other hand. When the mouse relaxes, the tail should freely wrap around your fingers. 0 points: No stiffness; 0.5 points: Tail reacts but does not curl; 1 point: Tail does not react at all. malocclusion Hold the mouse by the skin folds around its neck, turn the mouse upside down, and check for uneven or overgrown teeth. 0 points: Lower incisors are longer than upper incisors. 0.5 points: Slight malocclusion. 1 point: Very malocclusion and overgrowth. Abdominal distension Hold the mouse vertically at the base of its tail and tilt it behind your hand to observe if there is any excess fluid causing a bulge under the ribs. 0 points: None; 0.5 points: Slight bulge; 1 point: Obvious abdominal distension. Vestibular dysfunction Hold the mouse by the base of its tail and slowly bring it close to a flat surface. Check for any signs of head tilting, rotation, circling, head retraction, or body curling. 0 points: None; 0.5 points: Slight head tilt and / or slight rotation when lowered; 1 point: Severe imbalance. Righting Reflex Suspend the mouse in a supine position (abdomen up) about 25 cm above the table and quickly release it. Under normal circumstances, the mouse should land on its feet. 0 points: Normal; 0.5 points: Lands on their side or back but can immediately right themselves; 1 point: Lands on their back and cannot right themselves. Vision loss Mice were brought close to the mesh cage cover, and their posture in contact with the surface was observed to assess visual function. 0 points: Before tentacles make contact; 0.5 points: When tentacles make contact; 1 point: Unable to reach (nose touching the surface). The young mice involved in the following examples are 2-month-old mice.

[0060] Example 1: Isolation and identification of extracellular vesicles in brown adipose tissue and plasma of young mice, exercised young mice, and cold-induced young mice. The specific steps are as follows: 1. Pretreatment of young mice (36 mice, divided into 3 groups): Control group: 12 young mice were routinely fed without any special treatment for 4 weeks.

[0061] Cold induction treatment group: 12 young mice were placed in a small animal constant temperature incubator at 18 ℃ for 1 week for acclimatization, and then placed in a constant temperature incubator at 4 ℃ for 3 weeks.

[0062] Exercise treatment group: 12 young mice were subjected to forced treadmill exercise with the following parameters: speed 15 m / min, incline 15°, 30 min daily (16:00-16:30), 5 times a week (Monday to Friday), for 4 weeks.

[0063] 2. Collection of brown adipose tissue and plasma After pretreatment, mice in each group were anesthetized by inhalation of 5% isoflurane (flow rate 0.8 L / min), blood was collected from the heart (0.8-1.0 mL per mouse), and plasma was separated by centrifugation at 3000×g for 10 min (4 ℃) and stored at -80 ℃.

[0064] Brown adipose tissue between the scapulae of mice in each group was dissected and separated. 0.1 g of the tissue was taken from each mouse, rinsed three times with pre-cooled PBS, and then cut into small pieces and placed in sterile centrifuge tubes.

[0065] 3. Extraction of extracellular vesicles (1) Centrifuge the plasma at 4°C and 12000 g for 30 min to remove microbubbles or protein aggregates and collect the supernatant.

[0066] (2) The brown adipose tissue obtained in step 2 was added to 2.4 U / mL Dispase II and digested overnight at 4 °C. After removing the Dispase II, the tissue sample was washed twice with PBS and then transferred to a 10 cm cell culture dish containing PBS. The tissue sample was cut into pieces of approximately 1 mm using ophthalmic scissors. 3 Small tissue fragments were placed in 50 mL centrifuge tubes. Five volumes of 0.2% type I collagenase solution were added to the centrifuge tubes, and the tubes were placed in a constant temperature incubator at 37 °C with gentle shaking for 1.5 h until the cell suspension became milky. The mixture was gently pipetted to obtain a single-cell suspension, and PBS was added to the appropriate volume. The supernatant was collected for exosome isolation.

[0067] (3) Filter the supernatant obtained in step (1) and the supernatant obtained in step (2) with a 0.22 μm filter to remove apoptotic bodies and microvesicles. Take the filtered supernatant and extract exosomes using the EXODUS fully automated exosome extraction system. (3) Place the EXODUS chip in the chip position and the filtered sample in the sample position. Set the program on the EXODUS interface: enter the sample number, sample volume, select the chip type, and select the separation program. Start the automated exosome separation and purification program. After the automated processing is complete, press "Out of Chamber" to remove the chip and resuspend the purified exosomes in the chip with PBS in a clean bench.

[0068] 4. Following the method described above, obtain exosome samples from different groups.

[0069] The morphological results of extracellular vesicles observed by transmission electron microscopy are as follows: Figure 1 As shown, the extracted extracellular vesicles are typical double-membrane vesicles with a clearly defined cup-shaped structure. The particle size distribution of the exosomes, as determined by a particle size analyzer, is shown below. Figure 2 As shown, the average particle sizes of brown adipose cell extracellular vesicles and plasma cell extracellular vesicles are 162.6 nm and 104.7 nm, respectively, exhibiting a relatively normal distribution.

[0070] The extracellular vesicles obtained above are denoted as: Brown adipose exosomes from young mice were named BATEVs. Extracellular vesicles of brown adipocytes in young mice after exercise were named Exercise BATEVs. Brown adipose tissue exosomes from young mice after cold treatment were named Cold BATEVs. Exosomes from the plasma of young mice were named MPEVs.

[0071] Extracellular vesicles in the plasma of young mice after exercise were named Exercise MPEVs. Extracellular vesicles in the plasma of young mice after cold treatment were named Cold MPEVs. Example 2: Brown adipose tissue and plasma extracellular vesicles from young mice, exercised young mice, and cold-induced young mice possess anti-aging potential. 1. Animal experiments (exosomes were dissolved in PBS solution at pH 7.4, and the concentration of BCA protein in the solution was measured before injection into mice): Eighteen-month-old SPF-grade C57BL / 6J aged mice were randomly divided into eight groups of five mice each. The treatment strategy and protocol are detailed below. Figure 3 As shown in Table 2.

[0072] Table 2: Animal Grouping Group processing method quantity Group 1 (18-month-old aged mice treated with brown adipose tissue exosomes (BATEVs) from young mice) After the adaptation period, patients were given a weekly tail vein injection of 20 μg BCA protein concentration exosomes / 100 μL PBS, at a dose of 100 μL, for 6 weeks. 5 Group 2 (18-month-old aged mice treated with exercise-induced brown adipose tissue exosomes from young mice (Exercise BATEVs)) After the adaptation period, patients were given a weekly tail vein injection of 20 μg BCA protein concentration exosomes / 100 μL PBS, at a dose of 100 μL, for 6 weeks. 5 Group 3 (18-month-old aged mice treated with cold-treated brown adipose tissue exosomes (Cold BATEVs) from young mice) After the adaptation period, patients were given a weekly tail vein injection of 20 μg BCA protein concentration exosomes / 100 μL PBS, at a dose of 100 μL, for 6 weeks. 5 Group 4 (18-month-old aged mice treated with plasma exosomes (MPEVs) from young mice) After the adaptation period, patients were given a weekly tail vein injection of 20 μg BCA protein concentration exosomes / 100 μL PBS, at a dose of 100 μL, for 6 weeks. 5 Group 5 (18-month-old aged mice treated with exercise-induced plasma exosomes from young mice (Exercise MPEVs)) After the adaptation period, patients were given a weekly tail vein injection of 20 μg BCA protein concentration exosomes / 100 μL PBS, at a dose of 100 μL, for 6 weeks. 5 Group 6 (18-month-old aged mice treated with cold-treated plasma exosomes from young mice (Cold MPEVs)) After the adaptation period, patients were given a weekly tail vein injection of 20 μg BCA protein concentration exosomes / 100 μL PBS, at a dose of 100 μL, for 6 weeks. 5 Group 7 (18-month-old elderly control group) After the adaptation period, 100 μL of PBS was injected into the tail vein once a week as a blank control for 6 weeks. 5 Group 7 (2-month-old young control group) After the adaptation period, 100 μL of PBS was injected into the tail vein once a week as a blank control for 6 weeks. 5 The specific group handling methods are as follows: Group 1 (BATEVs treatment group): 18-month-old aged mice were routinely fed for 1 week. After the adaptation period, 100 μL of brown adipose tissue exosomes BATEVs from young mice were injected into the tail vein once a week for 6 weeks. The concentration of BATEVs was 20 μg BCA protein concentration exosomes / 100 μL PBS. Group 2 (Exercise BATEVs treatment group): 18-month-old aged mice were routinely fed for 1 week. After the adaptation period, 100 μL of brown adipose tissue exosomes (Exercise BATEVs) from young mice that had undergone exercise were injected into the tail vein once a week for 6 weeks. The concentration of Exercise BATEVs was 20 μg BCA protein concentration exosomes / 100 μL PBS. Group 3 (Cold BATEVs treatment group): 18-month-old aged mice were routinely fed for 1 week. After the adaptation period, 100 μL of cold-treated brown adipose tissue exosomes Cold BATEVs from young mice were injected into the tail vein once a week for 6 weeks. The concentration of Cold BATEVs was 20 μg BCA protein concentration exosomes / 100 μL PBS. Group 4 (MPEVs treatment group): 18-month-old aged mice were routinely fed for 1 week. After the adaptation period, 100 μL of young mouse plasma exosomes MPEVs were injected into the tail vein once a week for 6 weeks. The MPEVs concentration was 20 μg BCA protein concentration exosomes / 100 μL PBS. Group 5 (Exercise MPEVs treatment group): 18-month-old aged mice were routinely fed for 1 week. After the adaptation period, 100 μL of exercise-induced young mouse plasma exosomes (Exercise MPEVs) were injected into the tail vein once a week for 6 weeks. The concentration of Exercise MPEVs was 20 μg BCA protein concentration exosomes / 100 μL PBS. Group 6 (Cold MPEVs treatment group): 18-month-old aged mice were routinely fed for 1 week. After the adaptation period, they were injected once a week via the tail vein with 100 μL of cold-treated young mouse plasma exosomes Cold MPEVs for 6 weeks. The concentration of Cold MPEVs was 20 μg BCA protein concentration exosomes / 100 μL PBS. Group 7 (aged control group): 18-month-old aged mice were routinely fed for 1 week. After the adaptation period, they were injected with 100 μL of PBS once a week via the tail vein for 6 weeks. Group 8 (young control group): Two-month-old young mice were routinely fed for one week. After the adaptation period, they were injected with 100 μL of PBS once a week via the tail vein for 6 weeks. 2. Evaluate the physiological appearance parameters of aged mice.

[0073] (1) Mice were examined weekly to assess typical signs of aging, including: hair condition (color, luster and hair loss), beard loss, kyphosis (hunchback), cataracts and palpable tumors.

[0074] The results are as follows Figure 4 As shown; The results showed that the scores were as follows: Group 1 (BATEVs treatment group) 4.5, Group 2 (Exercise BATEVs treatment group) 3.7, Group 3 (Cold BATEVs treatment group) 5.1, Group 4 (MPEVs treatment group) 4.7, Group 5 (Exercise MPEVs treatment group) 4.2, Group 6 (Cold MPEVs treatment group) 4.1, and Group 7 (elderly control group) 5.8.

[0075] It is evident that administration of exosomes significantly improved the aging appearance parameters in aged mice.

[0076] (2) After the experiment in step 1, the mice in each group were subjected to pole climbing and tumbling bar experiments. The specific methods are as follows: 1) For the rotator bar experiment: After the first day of adaptation training, on the second day, the mice were placed on a rotatable fatigue tester with a rotation speed of 28 r / min and the fall time was recorded. If the fall time exceeded 300s, it was recorded as 300s. Each mouse was measured 3 times. The results are as follows Figure 5 As shown, The results showed that the latency time was as follows: Group 1 (BATEVs treatment group) was 178.5 seconds; Group 2 (Exercise BATEVs treatment group) was 298 seconds; Group 3 (Cold BATEVs treatment group) was 209 seconds; Group 4 (MPEVs treatment group) was 211 seconds; Group 5 (Exercise MPEVs treatment group) was 253.8 seconds; Group 6 (Cold MPEVs treatment group) was 241.6 seconds; and Group 7 (elderly control group) was 160.6 seconds. The latency time in group 8 (young mouse control group) was 300 seconds. .

[0077] It is evident that the rotarod ability of aged mice injected with brown adipose tissue exosomes from young mice was significantly improved compared to that of aged mice, while the other treatment groups showed improvement, but the difference was not statistically significant.

[0078] 2) For the pole climbing experiment: Place the mouse face up on top of the bar and start a stopwatch / timer. Stop the timer when the mouse has completely descended and both front paws have touched the ground (Ttotal), and record the time. The results are as follows: Figure 6 As shown.

[0079] The results showed that the total pole climbing time was 9.13 seconds for group 1 (BATEVs treatment group), 7.71 seconds for group 2 (Exercise BATEVs treatment group), 8.13 seconds for group 3 (Cold BATEVs treatment group), 10.31 seconds for group 4 (MPEVs treatment group), 9.45 seconds for group 5 (Exercise MPEVs treatment group), 8.13 seconds for group 6 (Cold MPEVs treatment group), and 11.22 seconds for group 7 (control group). The total time for climbing the pole in group 8 (young mouse control group) was 5.11 seconds. .

[0080] It is evident that intervention with brown adipose tissue exosomes from young active mice and brown adipose tissue and plasma exosomes from young cold-treated mice significantly shortened the pole-climbing time of older mice, further suggesting the potential anti-aging effect of exosomes.

[0081] (3) Immunofluorescence staining was performed on the DNA damage marker γ-H2AX in the liver tissue of aged mice, and the results are as follows: Figures 7-8 As shown.

[0082] The results show: The fluorescence expression level of the damage marker in group 1 (BATEVs treatment group) was 23.21; In group 2 (Exercise BATEVs treatment group), the fluorescence expression level of the damage marker was 19.62. The fluorescence expression level of the damage marker in group 3 (Cold BATEVs treatment group) was 24.37. The fluorescence expression level of the damage marker in group 4 (MPEVs treatment group) was 32.40; The fluorescence expression level of the damage marker in group 5 (Exercise MPEVs treatment group) was 30.83. The fluorescence expression level of damage markers in group 6 (Cold MPEVs treatment group) was 27.78. The fluorescence expression level of injury markers in group 7 (elderly control group) was 43.63. The fluorescence expression level of damage markers in group 8 (young mouse control group) was 25.97.

[0083] The results showed that the fluorescence intensity of damage markers in aged mice after treatment ( Figure 8 All were lower than those in the elderly control group.

[0084] (4) The telomere length and mtDNA copy number of mouse livers were detected (results are shown in the figure). Figures 9-10 (as shown) The results show: In Group 1 (BATEVs treatment group), the relative length of liver telomeres was 1.26 and the relative copy number of mtDNA was 0.776. In Group 2 (Exercise BATEVs treatment group), the relative length of liver telomeres was 1.13 and the relative copy number of mtDNA was 0.649. In group 3 (Cold BATEVs treatment group), the relative length of liver telomeres was 0.81 and the relative copy number of mtDNA was 0.704. In group 4 (MPEVs treatment group), the relative length of liver telomeres was 1.02 and the relative copy number of mtDNA was 0.896. In group 5 (Exercise MPEVs treatment group), the relative length of liver telomeres was 1.19 and the relative copy number of mtDNA was 0.861. In group 6 (Cold MPEVs treatment group), the relative length of liver telomeres was 0.88 and the relative copy number of mtDNA was 0.694. In group 7 (aged mouse control group), the relative length of liver telomeres was 0.66, and the relative copy number of mtDNA was 0.610. In group 8 (young mouse control group), the relative length of liver telomeres was 1 and the relative copy number of mtDNA was 1.

[0085] The results showed that mice treated with exosomes had longer liver telomere lengths and higher mtDNA copy numbers than the aged control group (e.g., ...). Figure 10 As shown in the figure, there was no significant difference.

[0086] (5) Metabolite analysis was performed on mouse serum. The results are shown in the heatmap in Figure 11. The serum metabolite expression profiles of each group of mice showed significant clustering characteristics. In the figure, red represents relatively high metabolite abundance, and blue represents relatively low abundance. The results indicate that extracellular vesicles (EVs) extracted from different sources and under different physiological interventions (exercise, cold stimulation) can significantly alter the metabolic state in mice, and each has its own specificity.

[0087] from Figure 12 It is evident that the spatial distribution of the aged control group (O1 group, Aged, red data points and red confidence intervals) is significantly separated from that of the young control group (O8 group, Young, light green data points and green confidence intervals). This indicates that the aging process leads to a fundamental change in the metabolic profile of mice, confirming the effectiveness of the aging model.

[0088] Surprisingly, the sample distribution points of aged mice treated with different types of extracellular vesicles as described in this invention (groups O2 to O7, covering BAT-EVs and MP-EVs with different pretreatments such as simple, exercise, and cold stimulation) all showed extremely significant migration. The sample points of these treatment groups were completely separated from the red aging characteristic area of ​​the aged control group (O1).

[0089] Furthermore, the data points from all the EV treatment groups (O2-O7) clustered highly densely within or closely around the green confidence interval of the young control group (O8). This strong clustering result demonstrates that the various extracellular vesicle interventions described in this invention can effectively and systematically remodel the metabolic network of aged mice, successfully reverse age-related abnormal markers, and significantly restore their overall biological phenotype to a level highly close to the healthy baseline of young individuals.

[0090] The results showed that after six weeks of exosome intervention, the serum metabolic characteristics of aged mice all changed to those of young mice, further suggesting the potential anti-aging effect of exosomes.

[0091] Example 3: Synergistic anti-aging effect of extracellular vesicles (BATEVs and Exercise BATEVs) under different physiological intervention states in vitro. 1. Experimental Objective This embodiment aims to verify whether combining extracellular vesicles from the same tissue source but under different physiological pretreatment states (taking resting BATEVs and exercise-pretreated BATEVs as examples) at half doses can overcome the limitations of a single intervention state at the cellular level and produce a more superior anti-aging synergistic effect.

[0092] 2. Experimental methods and grouping (1) Cell culture and aging model construction Reference Figure 13 The method involves dividing C2C12 myoblasts into cells at a density of 5 × 10⁻⁶. 4 Cells were seeded per well in 6-well plates. After culturing for 24 hours, D-galactose (25 mg / mL) was added and the cells were treated continuously for 48 hours to induce an in vitro cell senescence model.

[0093] (2) Experimental grouping and drug intervention (exosomes were dissolved in PBS solution at pH 7.4, and the concentration of BCA protein in the solution was detected before cell culture). The successfully modeled C2C12 senescent cells were randomly divided into the following groups and subjected to a 48-hour intervention: Group 1 (Model, aging model group): After successful modeling, add the same volume of PBS buffer as other groups; Group 2 (BATEVs monotherapy group): After successful modeling, BATEVs were added to achieve a final concentration of 10 μg / mL (10 μg BCA protein concentration exosomes / 1mL PBS). Group 3 (Exercise BATEVs monotherapy group): After successful modeling, Exercise BATEVs were added to achieve a final concentration of 10 μg / mL (10 μg BCA protein concentration exosomes / 1mL PBS). Group 4 (exercise-rest combination therapy group): After successful modeling, a mixture of BATEVs and Exercise BATEVs with a final concentration of 5 μg / mL was added (the final concentration was kept constant at 10 μg / mL, 5 μg BCA protein concentration exosomes / 1mL PBS + 5 μg BCA protein concentration exosomes / 1mL PBS).

[0094] (3) Detection indicators After the intervention, cells and supernatants from each group were collected for aging marker detection: ELISA was used to detect the concentration of IL-6, the core component of SASP, in the cell supernatant; RT-qPCR was used to detect the expression levels of P21 and P53 in cells. The primer sequences used for the assay are as follows: P21 Forward: AACATCTCAGGGCCGAAA; P21 Reverse: TGCGCTTGGAGTGATAGAAA; P53 Forward: ATTTCACCCTCAAGATCCGC; P53 Reverse: CCCTTCTTGGTCTTCAGGTA; 3. Experimental Results (1) Deep inhibition of aging-related molecular markers (SASP, P21, P53) Detection at the molecular level further confirmed the synergistic mechanism, as shown in Table 3 below: Table 3: Expression levels of aging-related molecular markers in different groups Group IL-6 concentration P21 expression level P53 Expression Level Group 1 (Model, aging model group) 73.003 ± 3.614 1.00 ± 0.09 1.00 ± 0.09 Group 2 (BATEVs single treatment group) 64.537 ± 4.255 0.79 ± 0.07 0.82 ± 0.08 Group 3 (Exercise BATEVs single treatment group) 61.064 ± 1.759 0.72 ± 0.06 0.74 ± 0.07 Group 4 (Exercise-Rest Combined Therapy Group) 53.310 ± 0.751 0.50 ± 0.05 0.49 ± 0.06 The results show: SASP core factor (IL-6): The IL-6 secretion level in the supernatant of group 4 (combination group) was reduced to the lowest level. Figure 14This indicates that the combined action of basal BATEVs and exercise-induced specific Exercise BATEVs can more comprehensively block the release of pro-inflammatory senescent secretory phenotypes (SASPs).

[0095] P21 and P53 gene expression: Compared to using BATEVs alone or Exercise BATEVs, the half-dose combination treatment (group 4) resulted in the most significant downregulation of mRNA expression levels of cell cycle arrest-related gene P21 and pro-apoptosis-related gene P53. Figure 15 This suggests that specific functional molecules enriched in exercise-pretreated EVs (such as exercise-response-related miRNAs or proteins) and basal metabolic regulators in resting EVs create a multi-target synergistic intervention advantage.

[0096] 4. Experimental Conclusions This embodiment demonstrates that combining resting-state BATEVs with exercise-pretreated Exercise BATEVs can produce a significant synergistic anti-aging effect (1+1>2) at the in vitro cellular level. This result indicates that exercise intervention not only endows vesicles with new anti-aging targets, but this specific anti-aging activity may also be highly complementary to vesicle function under basal conditions. Using this combination strategy, the reversal of cellular senescence signaling pathways (P53 / P21 and SASP) can be achieved at relatively low single-component doses, providing a highly promising innovative combination for the development of novel anti-aging biologics.

[0097] Example 4: Screening of miRNAs co-expressed by BATEVs and MPEVs and co-selection analysis of age-related downregulated miRNAs RNA extraction: Total RNA was extracted from BATEVs and MPEVs using the miRNeasy Mini Kit (Qiagen), and RNA integrity (RIN value ≥ 7.0) was detected using an Agilent 2100 Bioanalyzer.

[0098] Library construction and sequencing: The library was constructed using the NEBNext® Multiplex Small RNA Library Prep Set, and single-end 50 bp sequencing was performed on the Illumina NovaSeq 6000 platform, with 3 biological replicates for each sample.

[0099] Data processing: After FastQC quality control, adapters were removed using Cutadapt, and miRNA expression count matrices for each sample were obtained by comparison with the miRBase (v22) database. The following steps were used for screening: Using a TPM (number of reads matching the miRNA per million reads) ≥ 1 as the expression threshold, miRNAs detected in both BATEVs and MPEVs were screened and defined as "co-expressed miRNAs".

[0100] By mining the literature, we collected miRNAs whose expression was significantly downregulated with age (or aging) reported in previous studies, and constructed a reference set of aging-related downregulated miRNAs.

[0101] The intersection of the above-mentioned co-expressed miRNAs with the reference set of aging-related downregulated miRNAs was used to obtain "co-selected miRNAs" for subsequent analysis.

[0102] Experimental results: Sequencing data quality: The number of valid reads for each sample is greater than 1×10⁻⁶. 7 The Q30 ratio is >92%, indicating that the sequencing data quality is good.

[0103] Screening for co-expressed miRNAs: A total of 19 co-expressed miRNAs (TPM≥1) were detected in BATEVs and MPEVs, covering the major known miRNA families.

[0104] Co-selection results of age-related downregulated miRNAs: Through literature mining, a total of 62 miRNAs that were significantly downregulated with increasing age were identified. The intersection of 19 co-expressed miRNAs with this reference set was then calculated. Figure 16 A total of 6 co-selected miRNAs were identified. Some representative co-selected miRNAs include: let-7i-5p, let-7f-5p, miR-143-3p, let-7a-5p, miR-378a-3p, let-7c-5p, etc.

[0105] Target gene pathway enrichment analysis: Pathway enrichment analysis was performed on the target genes of the above 6 co-selected miRNAs, and the results were visualized using heatmaps and functional clustering. Figure 17 , Figure 18 ).

[0106] The results showed that target genes were significantly enriched in the ErbB signaling pathway (Erbb4, Grb2, Kras) and its upstream and downstream regulatory networks, as well as in biological processes such as tissue morphogenesis, vesicle transport, protein homeostasis regulation, and miRNA metabolic feedback loops. Functional cluster analysis further revealed that the above pathways can be divided into three functional clusters: a signal transduction hub (ErbB signaling), a tissue remodeling module, and a regulatory feedback module. These results indicate that co-selected miRNAs, through multi-node and multi-level synergistic regulation, simultaneously act on cellular signaling, tissue regeneration, and homeostasis maintenance networks, providing mechanistic support at the molecular level for anti-aging.

[0107] Example 5: Effects of screened miRNAs on apoptosis The Annexin V-FITC / PI apoptosis detection kit was used to detect apoptosis-related signals in cells treated with selected candidate miRNAs. The kit works by binding to phosphatidylserine residues that extravasate the cell membrane during early apoptosis, while PI enters late-stage apoptotic or dead cells and binds to DNA, thus assessing the apoptotic state. Cells from each group were collected according to the kit instructions, washed with pre-cooled PBS, and 1-5 × 10⁶ cells were collected. 5 Each cell was resuspended in 500 μL of 1×Binding Buffer, and 5 μL of Annexin V-FITC and 5 μL of Propidium Iodide were added. The cells were incubated at room temperature in the dark for 10-20 min, and the fluorescence signal was detected within 1 h.

[0108] The experimental groups included the NC group, the D-gal only group, and the candidate miRNA treatment group. The candidate miRNA treatment groups included the miR-1a-3p group, the let-7i-5p group (representing the let-7 family), the miR-143-3p group, the miR-148a-3p group, and the miR-378a-3p group. The sequences are as follows: miR-1a-3p: TGGAATGTAAAGAAGTATGTAT (SEQ ID NO. 1); let-7i-5p: TGAGGTAGTAGTTTGTGCTGTT (SEQ ID NO. 2); miR-143-3p: TGAGATGAAGCACTGTAGCTC (SEQ ID NO.3); miR-148a-3p: TCAGTGCACTACAGAACTTTGT (SEQ ID NO.4); miR-378a-3p: ACTGGACTTGGAGTCAGAAGG (SEQ ID NO. 5).

[0109] The cells in each group were treated as described in the previous examples, and then the relative fluorescence intensity of Annexin V+ and PI was detected using the above-mentioned kit.

[0110] The specific steps are as follows: (1) C2C12 cells were cultured to the logarithmic growth phase and seeded at a uniform density in culture plates, and divided into three groups: Blank control group (NC group): Transfected with negative control miRNA (NC mimics), cultured routinely (37 ℃, 5% CO2) for 24 h, and then cultured for a final concentration of 20 mg / mL of D-gal (D-galactose).

[0111] D-gal only group: No transfection was performed. After routine culture (37 ℃, 5% CO2) for 24 h, D-gal was added directly to a final concentration of 20 mg / mL (the medium was changed simultaneously with the transfected group) and cultured for a longer period.

[0112] Candidate miRNA intervention group: miR-1a-3p, let-7i-5p, miR-143-3p, miR-148a-3p and miR-378a-3p mimics were transfected respectively. After routine culture (37 ℃, 5% CO2) for 24 h, D-gal was added to a final concentration of 20 mg / mL for further culture.

[0113] (2) All cells in the above groups were placed in a 37 ℃, 5% CO2 incubator and cultured for 48 h after the addition of D-gal (or according to the intervention time preset in the experimental design) to ensure that the D-gal treatment time of each group was completely consistent.

[0114] (3) After the intervention, cells from each group were collected and apoptosis was detected using the Annexin V-FITC / PI cell apoptosis detection kit to ensure that the treatment conditions of each group were completely consistent.

[0115] Experimental results are as follows Figure 19 As shown; Annexin V + The test results show that: There was no statistically significant difference between the NC group and the D-gal only group; Compared with the D-gal only group, the relative fluorescence intensity of Annexin V+ was significantly reduced after treatment with miR-1a-3p, let-7i-5p, miR-143-3p, miR-148a-3p and miR-378a-3p.

[0116] The PI detection results also showed that there was no statistically significant difference between the NC group and the D-gal only group, while the relative fluorescence intensity of PI in all the candidate miRNA treatment groups was significantly lower than that in the D-gal only group.

[0117] The above results indicate that the selected candidate miRNAs can all upregulate apoptosis-related fluorescence signals to varying degrees, suggesting their ability to inhibit apoptosis and reduce cell damage. Furthermore, several candidate miRNAs showed a consistent decreasing trend in both Annexin V+ and PI indicators, further demonstrating their good protective effect on cells. Therefore, the miRNAs screened in this invention can serve as candidate molecules for regulating apoptosis and have application value in related disease interventions, cell protection, or delaying cell damage.

[0118] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. The application of a brown adipose exosome in the preparation of an anti-aging drug, characterized in that, The brown fat exosomes are prepared by any of the following methods: After culturing 2-3 month old mice at 4-8℃ for 3-4 weeks, the brown adipose tissue between the scapulae of the mice was dissected and the exosomes in the brown adipose tissue were extracted. Alternatively, 2-3 month old mice may be subjected to forced treadmill exercise with the following parameters: speed 10-15 m / min, incline 0-10°, 30-40 min per day, 5-6 times per week, for 3-4 weeks. After that, the brown adipose tissue between the scapulae of the mice is dissected and the exosomes in the brown adipose tissue are extracted. Alternatively, after culturing 2-3 month old mice routinely for 3-4 weeks, the brown adipose tissue between the scapulae of the mice was dissected and extracted from the brown adipose tissue. The 2-3 month old mice were then subjected to forced treadmill exercise with the following parameters: speed 10-15 m / min, incline 0-10°, 30-40 min daily, 5-6 times per week for 3-4 weeks. The brown adipose tissue between the scapulae of the mice was then dissected and extracted from the brown adipose tissue. Exosomes-1 and exosomes-2 were then combined to obtain the final product. Preferably, exosome-1 and exosome-2 are obtained by mixing them in a concentration ratio of 1:

1.

2. The application according to claim 1, characterized in that, The drug also contains pharmaceutically acceptable excipients; the excipients refer to conventional drug carriers in the pharmaceutical field.

3. The application according to claim 2, characterized in that, The excipients include one or more of the following: binders such as cellulose derivatives, alginate, gelatin, and polyvinylpyrrolidone; diluents such as starch, pregelatinized starch, dextrin, sucrose, lactose, and mannitol; fillers such as starch and sucrose; humectants such as glycerin; disintegrants such as sodium carboxymethyl starch, cross-linked polyvinylpyrrolidone, and dry starch; absorption promoters such as quaternary ammonium compounds; surfactants such as polysorbates, fatty acid sorbitan, and fatty acid glycerides; colorants such as titanium dioxide, sunset yellow, methylene blue, and pharmaceutical iron oxide red; lubricants such as hydrogenated vegetable oil, talc, and polyethylene glycol; coating materials such as acrylic resins, hydroxypropyl methylcellulose, povidone, and cellulose acetate; and other excipients such as flavoring agents and sweeteners may also be added to the composition.

4. The application according to claim 3, characterized in that, The dosage form of the drug includes, but is not limited to, oral dosage form, injectable dosage form, and inhaled dosage form; Preferably, the oral dosage form includes, but is not limited to, tablets, capsules, granules, oral liquids, and oral suspensions; Preferably, the injectable dosage form includes, but is not limited to, injection solution and injection powder for injection; Preferably, the inhalation dosage form includes, but is not limited to, aerosols and powder inhalers.

5. The application according to any one of claims 1 to 4, characterized in that, The anti-aging related phenotypes include: (1) Phenotypic improvement: selected from at least one of weight regulation, hair condition improvement or skin elasticity enhancement; (2) Improved metabolism: selected from at least one of the following: decreased blood glucose level, increased insulin sensitivity, increased energy consumption, or increased fat metabolism rate; (3) Improved athletic performance: selected from at least one of the following: increased treadmill endurance, enhanced grip strength, or accelerated post-exercise recovery rate; (4) Improved memory function: selected from at least one of the following: increased spontaneous alternation rate in Y maze, shortened escape latency in water maze experiment, improved recognition index in new object recognition experiment, or prolonged latency in passive avoidance experiment; (5) Decreased aging markers: selected from at least one of the following: decreased DNA damage marker γ-H2AX signal, decreased p16 protein expression, decreased β-galactosidase activity, increased mtDNA copy number, or prolonged telomere length; (6) Decreased inflammatory factors associated with aging: decreased concentration of SASP core factor IL-6, decreased expression level of P21 gene, and decreased expression level of P53 gene.

6. The application according to any one of claims 1 to 5, characterized in that, The drug also contains miRNA.

7. The application according to claim 6, characterized in that, The miRNAs include let-7i-5p, let-7f-5p, miR-143-3p, let-7a-5p, miR-378a-3p and / or let-7c-5p.

8. The use of a composition in the preparation of an anti-aging medicament, characterized in that, The composition comprises miRNAs extracted from brown adipose exosomes, the miRNAs including let-7i-5p, let-7f-5p, miR-143-3p, let-7a-5p, miR-378a-3p and / or let-7c-5p.

9. The application according to claim 8, characterized in that, The preparation method of the brown adipose tissue exosomes is as follows: After culturing mice at 4-8℃ for 3-4 weeks, the brown adipose tissue between the scapulae of the mice is dissected and separated, and the exosomes in the brown adipose tissue are extracted; or the mice are subjected to forced treadmill exercise with the following parameters: speed 10-15 m / min, incline 0-10°, 30-40 min per day, 5-6 times per week, for 3-4 weeks, the brown adipose tissue between the scapulae of the mice is dissected and separated, and the exosomes in the brown adipose tissue are extracted.

10. The application according to claim 9, characterized in that, The drug also contains pharmaceutically acceptable excipients; the excipients refer to conventional drug carriers in the pharmaceutical field. Preferably, the excipients include one or more of the following: binders such as cellulose derivatives, alginate, gelatin, and polyvinylpyrrolidone; diluents such as starch, pregelatinized starch, dextrin, sucrose, lactose, and mannitol; fillers such as starch and sucrose; humectants such as glycerin; disintegrants such as sodium carboxymethyl starch, croscarmellose, and dry starch; absorption promoters such as quaternary ammonium compounds; surfactants such as polysorbate, fatty acid sorbitan, and fatty acid glycerides; colorants such as titanium dioxide, sunset yellow, methylene blue, and pharmaceutical iron oxide red; lubricants such as hydrogenated vegetable oil, talc, and polyethylene glycol; coating materials such as acrylic resin, hydroxypropyl methylcellulose, povidone, and cellulose acetate; and other excipients such as flavoring agents and sweeteners may also be added to the composition. Preferably, the dosage form of the drug includes, but is not limited to, oral dosage form, injection dosage form, and inhalation dosage form; Preferably, the oral dosage form includes, but is not limited to, tablets, capsules, granules, oral liquids, and oral suspensions; Preferably, the injectable dosage form includes, but is not limited to, injection solution and injection powder for injection; Preferably, the inhalation dosage form includes, but is not limited to, aerosols and powder inhalers.

Images