RNA aptamer for fluorescence imaging of fusobacterium nucleatum, screening method and application thereof

Abstract

The application discloses an RNA aptamer for fluorescence imaging of Fusobacterium nucleatum, a screening method and application thereof, and belongs to the technical field of microorganism detection and molecular imaging, and specifically, the aptamer is constructed based on an optimized broccoli fluorescence module and a 3WJ support independently designed, is named 3WJ-2dBro, and has a nucleotide sequence as shown in SEQ ID NO:1, can emit stable fluorescence after being combined with DFHBI fluorescent dye, realizes efficient and stable labeling of the Fusobacterium nucleatum, is used for solving the problems that detection of the Fusobacterium nucleatum in the prior art depends on complex pretreatment, is complicated in operation and is difficult to realize in-situ real-time imaging of live bacteria, can specifically combine with and stably label the Fusobacterium nucleatum, can realize non-invasive, dynamic and high-resolution fluorescence imaging under a live state of the bacteria, and is especially suitable for spatiotemporal dynamic tracking of bacteria in an anaerobic or low-oxygen environment and accurate positioning of intracellular bacteria.

Description

Technical Field

[0001] This invention relates to an RNA aptamer for fluorescence imaging of Fusobacterium nucleatum, its screening method, and its application. Specifically, it relates to a fluorescent RNA aptamer that can specifically bind to and stably label Fusobacterium nucleatum, a screening method for the aptamer, and the application of the aptamer in fluorescence imaging of live bacteria, belonging to the field of microbial detection and molecular imaging technology. Background Technology

[0002] Fusobacterium nucleatum ( Fusobacterium nucleatum Bacterial microorganisms (BMI) are Gram-negative anaerobic bacilli closely related to periodontitis, and their detection is of great significance for the early diagnosis and treatment monitoring of periodontal disease. Traditional bacterial detection methods include bacterial culture, PCR, and immunological detection, but these methods have limitations such as being complex to operate, time-consuming, and unable to achieve real-time detection of live bacteria.

[0003] Currently, antibody-based immunofluorescence techniques can be used for bacterial detection, but antibodies suffer from problems such as complex preparation, poor stability, and limited cell penetration. Genomic and imaging technologies are the main methods for identifying bacterial tumor niches. Genomic methods, from 16S rRNA genome sequencing to metagenomic sequencing, have gradually improved resolution and sensitivity, but it remains difficult to distinguish between low-biomass bacterial signals from tissues and those from environmental contamination. Differentiation between invading bacteria and cell-neighboring bacteria also remains a major obstacle. Imaging technologies are increasingly being developed to supplement genomic low-biomass microbial signals, including immunohistochemistry (IHC), fluorescence in situ hybridization (FISH), and high-resolution electron microscopy. However, bacterial immobilization limits the use of these methods in live-cell detection. Furthermore, the maturation of fluorescent protein chromophores and the luciferase-catalyzed luminescent substrate processes require oxygen, making these reporter genes unsuitable for imaging anaerobic bacteria and anaerobic conditions.

[0004] In recent years, significant progress has been made in the screening of nucleic acid aptamers based on whole-bacterial SELEX (Systematic Evolution of Ligands by Exponential Enrichment) technology. For example, studies have used SELEX technology to screen for single-stranded DNA aptamers that specifically recognize Fusobacterium nucleatum (see patent CN115820649B). Furthermore, researchers have combined Fusobacterium nucleatum-specific aptamers with rolling circle amplification (RCA) and CRISPR / Cas12a technology to develop a dual-mode biosensor for non-invasive colorectal cancer screening, achieving ultrasensitive detection of Fusobacterium nucleatum with a detection limit of 3.68 CFU / mL (see Wang Xinjing, et al., 2025, Development of an Aptamer / CRISPR-Cas12a-Based Dual-Modal Biosensor for Fusobacterium nucleatum Detection in Non-Invasive Colorectal Cancer Screening. Analytical Chemistry). However, the aforementioned DNA aptamer-based detection methods are all in vitro detection methods, suitable for qualitative or quantitative analysis of bacteria in ex vivo samples, and still cannot achieve in situ, real-time, dynamic fluorescence imaging of live bacteria.

[0005] RNA aptamers are small single-stranded nucleic acids obtained through in vitro screening or rational design, and they have advantages such as high binding specificity, ease of synthesis and modification, and good stability. Among them, fluorescent RNA aptamers, represented by Broccoli, can directly emit fluorescence after binding to DFHBI series fluorescent dyes. The generation of their fluorescence signal does not depend on the protein translation and folding process, and theoretically, they are suitable for imaging live bacteria under anaerobic conditions.

[0006] In recent years, significant progress has been made in the rational design and screening of Broccoli fluorescent RNA aptamers. He Zuyang et al. obtained a four-site mutant (named Bro) with a 3.3-fold increase in fluorescence intensity through three rounds of mutation screening of Broccoli. They constructed a new 3WJ scaffold and used the embedded tandem repeat Bro to build the 3WJ-nxBro fluorescent aptamer family. From this family, they screened out the 3WJ-4×Bro aptamer, which has excellent fluorescence intensity and high stability, providing a new visualization tool for live-cell RNA imaging (see He Zuyang, Bai Jiuyuan, Zhao Yun, Design and Screening of Broccoli-based Fluorescent RNA Aptamers, Journal of Sichuan University (Natural Science Edition), July 2024, Vol. 6, No. 4). In addition, 3WJ-4×Bro has also been publicly used for RNA imaging of plant live cells (see Bai JY, et al., 2020, A protein-independent fluorescent RNA aptamer reporter system for plant genetic engineering. Nature Communications). However, none of the above-mentioned Broccoli-based fluorescent RNA aptamers are involved in the live labeling and imaging of anaerobic bacteria such as Fusobacterium nucleatum. Their applicability in anaerobic environments has not been verified, and they cannot meet the research needs of dynamic tracking of live anaerobic bacteria.

[0007] Therefore, there is an urgent need to provide a novel molecular tool that can specifically identify Fusobacterium nucleatum and achieve non-invasive, dynamic, and high-resolution fluorescence imaging in its active state, in order to overcome the limitations of existing technologies in in vivo imaging of Fusobacterium nucleatum and provide new technical means for the research and clinical diagnosis of Fusobacterium nucleatum. Summary of the Invention

[0008] This invention aims to provide an RNA aptamer for fluorescence imaging of *Fusobacterium nucleatum*, its screening method, and its applications. This addresses the technical challenges of existing *Fusobacterium nucleatum* detection, such as reliance on complex pretreatment, cumbersome operations, and difficulty in achieving real-time in-situ imaging of live bacteria. Furthermore, it addresses the structural redundancy issue inherent in the tandem repeat Bro strategy of the existing 3WJ-4×Bro aptamer. This invention uses site-directed mutagenesis screening to obtain Bro units with significantly improved fluorescence performance. Two Bro units are then aggregated to construct a polymerized suitable aptamer, dBro, containing dual-luciferin synergistic binding sites. This aptamer is then embedded in a self-selected 3WJ scaffold, forming the more compact and more fluorescence-efficient 3WJ-2dBro aptamer. This aptamer emits strong and stable fluorescence upon binding with DFHBI fluorescent dye, achieving efficient and specific labeling of *Fusobacterium nucleatum*. It is particularly suitable for in vivo, non-invasive, dynamic, and high-resolution fluorescence imaging of bacteria in anaerobic or hypoxic environments, providing a more valuable molecular tool for spatiotemporal dynamic tracking, pathogenic mechanism research, and rapid clinical detection of *Fusobacterium nucleatum*.

[0009] The present invention is achieved through the following technical solution: an RNA aptamer for fluorescence imaging of Fusobacterium nucleatum, the RNA aptamer being named 3WJ-2dBro, the nucleotide sequence of which is shown in SEQ ID NO: 1.

[0010] The present invention also provides a method for screening RNA aptamers for fluorescence imaging of Fusobacterium nucleatum as described above, comprising the following steps: S1. Based on the sequence and crystal structure of broccoli, the core motif that maintains the planar stability of the G-quadruplex within broccoli was subjected to site-directed mutagenesis. After in vitro fluorescence screening, broccoli units with enhanced fluorescence intensity were obtained and named Bro. S2. Based on the three-dimensional structure of F30 RNA, eight three-dimensional structure variants were constructed and used as RNA scaffolds to stabilize the Bro conformation. After in vitro fluorescence screening, the Bro scaffold with the best fluorescence intensity enhancement was obtained and named 3WJ. S3. The two Bros are polymerized to construct a polymeric suitable ligand containing dual luciferin co-binding sites, named dBro; S4. Using 3WJ as a scaffold, dBro is embedded to form a tetrad broccoli aptamer. The aptamer with the strongest fluorescence signal is selected as 3WJ-2dBro.

[0011] Preferably, in step S1, site-directed mutagenesis is used to construct 10 mutants, which are named bro#1, bro#2, bro#3, bro#4, bro#5, bro#6, bro#7, bro#8, bro#9, and bro#10, respectively. Among them, bro#10 is the mutant with the best fluorescence intensity enhancement, and it is named Bro.

[0012] Preferably, in step S2, the eight triaxial structure variants constructed are named F30#1, F30#2, F30#3, F30#4, F30#5, F30#6, F30#7, and F30#8, respectively. Among them, the F30#2 scaffold has the best effect on improving the fluorescence intensity of Bro, and it is named 3WJ.

[0013] Preferably, in step S3, five types of polymeric ligands dBro are constructed and named dBro#1, dBro#2, dBro#3, dBro#4, and dBro#5, respectively. After fluorescence imaging and quantitative screening, polymeric ligands dBro#1 and dBro#2 with fluorescence intensity increased by more than 2 times are obtained.

[0014] Preferably, in step S4, 3WJ is used as a scaffold to embed appropriate ligands dBro#1 and dBro#2 to form a tetraploid broccoli aptamer. The 3WJ-2dBro aptamer with the strongest fluorescence signal is selected by photophysical characteristics and in vitro fluorescence intensity evaluation.

[0015] The present invention also provides the application of the RNA aptamer described above in the preparation of a fluorescence imaging kit for Fusobacterium nucleatum, the kit comprising the RNA aptamer and DFHBI fluorescent dye.

[0016] And, a kit for fluorescence imaging of Fusobacterium nucleatum, comprising: (1) Nucleotides such as the RNA aptamer shown in SEQ ID NO: 1; (2) DFHBI fluorescent dye.

[0017] Compared with the prior art, the present invention has the following advantages and beneficial effects: (1) The RNA aptamer 3WJ-2dBro obtained by screening in this invention can recognize Fusobacterium nucleatum with high specificity and has excellent nucleic acid stability and continuous fluorescence signal output ability, which can achieve stable labeling of target bacteria and avoid the problems of non-specific binding, easy degradation and large batch differences in traditional antibody labeling.

[0018] (2) The RNA aptamer provided by the present invention is suitable for live bacteria and dynamic imaging. The labeling process does not require fixing or lysing the bacteria. It can perform real-time imaging of live Fusobacterium nucleatum under physiological conditions, maintaining the biological activity of the bacteria and providing a new tool for studying the biological behavior of Fusobacterium nucleatum.

[0019] (3) This invention uses RNA aptamers to label Fusobacterium nucleatum. The generation of its fluorescent signal does not depend on the protein translation and folding process, avoiding the labeling failure problem caused by the low protein folding efficiency of traditional fluorescent proteins in anaerobic or hypoxic environments. Compared with protein reporter genes, it has more stable and reliable labeling and imaging capabilities. Furthermore, it is the first time that fluorescent RNA aptamer technology has been successfully applied to the field of anaerobic bacterial in vivo imaging.

[0020] (4) Compared with the 3WJ-4×Bro constructed based on the tandem repeat Bro strategy in the prior art, the 3WJ-2dBro of the present invention obtains high-performance Bro units through site-directed mutagenesis, and aggregates two Bro units to form a dBro with dual luciferin synergistic binding sites, which is then embedded in the 3WJ scaffold. With only 2 Bro units, it achieves a comprehensive improvement in extinction coefficient, photobleaching half-life, and thermal cycling stability. This shows that the "site-directed mutagenesis-dual-unit aggregation-synergistic binding" strategy adopted in the present invention has unexpected technical effects compared with the tandem repeat strategy of the prior art.

[0021] (5) The method of the present invention is simple to operate and fast to detect. The entire imaging process can be completed within 1 hour. It is suitable for rapid detection of clinical samples and laboratory research and has good prospects for promotion and application.

[0022] (6) This invention is not only applicable to periodontitis-related research, but can also be extended to the mechanism research and diagnostic development of other anaerobic bacterial infection models, providing new molecular tools and imaging strategies for early diagnosis, efficacy evaluation and precise intervention of bacterial-related diseases. Attached Figure Description

[0023] Figure 1 This is a flowchart illustrating the steps involved in preparing fluorescent RNA aptamers.

[0024] Figure 2 In vitro fluorescence detection for bro#1-bro#10.

[0025] Figure 3 For F30#1-F30#8, in vitro fluorescence detection was performed.

[0026] Figure 4 In vitro fluorescence detection for dBro#1-dBro#5.

[0027] Figure 5 For in vitro fluorescence detection of 3WJ-2dBro.

[0028] Figure 6 Photostability evaluation of 3WJ-2dBro.

[0029] Figure 7 Thermal stability assessment of 3WJ-2dBro.

[0030] Figure 8 A schematic diagram of in vitro imaging results of Fusobacterium nucleatum labeled with fluorescent RNA aptamers.

[0031] Figure 9 The effect of 3WJ-2dBro on the morphology of Fusobacterium nucleatum.

[0032] Figure 10 The effect of 3WJ-2dBro on the growth rate of Fusobacterium nucleatum.

[0033] Figure 11 This demonstrates the stable inheritance of 3WJ-2dBro in Fusobacterium nucleatum. Detailed Implementation

[0034] The invention's objective, technical solution, and beneficial effects will be further explained in detail below.

[0035] It should be noted that the following detailed descriptions are exemplary and intended to provide further illustration of the claimed invention. Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0036] This invention proposes an RNA aptamer for fluorescence imaging of *Fusobacterium nucleatum*. The aptamer consists of a 3WJ scaffold and a polymeric aptamer dBro embedded within the 3WJ scaffold. The dBro polymeric aptamer is composed of two optimized broccoli units and contains a dual-luciferin co-binding site, enabling stable fluorescence emission after binding to DFHBI fluorescent dye. This achieves efficient and stable labeling of *Fusobacterium nucleatum*, offering advantages such as ease of operation, rapid detection, and high specificity. It not only enables precise detection and in vivo spatiotemporal dynamic tracking of anaerobic bacteria, filling a gap in current anaerobic live-cell imaging technology, but also provides direct evidence for exploring the interaction mechanisms between anaerobic bacteria and tumor cells.

[0037] Specifically, the fluorescent RNA aptamer provided by this invention is named 3WJ-2dBro, and its nucleotide sequence is shown in SEQ ID NO: 1.

[0038] SEQ ID NO: 1: TTGTCATGTGTATGTTGGGAGACGGTCGGGTCCACCTGAGACGGTCGGGTCCAGATATTCGTATCTGTCGAGTAGAGTGTGGGCTCAGGTGTCGAGTAGAGTGTGGGCTCCCACATACTTTGTTGACCAGACGGTCGGGTCCAAATGAGAGGGTCGGGTCCAGATATTAGTATCTGTTGAGTAGAGTGTGGTCTCATTTGTCGAGTAGAGTGTGGGCTGGTCAATCATGGCAA. The specific methods for screening and constructing the fluorescent RNA aptamer are as follows: Step 1: The core motif that maintains the planar stability of the G-quadruplex within broccoli was optimized. After in vitro fluorescence screening, the optimized broccoli unit was obtained and named Bro, whose nucleotide sequence is shown in SEQ ID NO: 2.

[0039] SEQ ID NO: 2: AGACGGTCGGGTCCACCTGAGACGGTCGGGTCCAGATATTCGTATCTGTCGAGTAGAGTGTGGGCTCAGGTGTCGAGTAGAGTGTGGCT.

[0040] Step two: Based on the three-dimensional structure of F30 RNA, eight three-dimensional structure variants were constructed and named F30#1, F30#2, F30#3, F30#4, F30#5, F30#6, F30#7, and F30#8, respectively, to serve as RNA scaffolds for stabilizing the Bro conformation. In vitro fluorescence screening revealed that the F30#2 scaffold significantly enhanced the fluorescence intensity of Bro, and it was named 3WJ, with its nucleotide sequence shown in SEQ ID NO: 3.

[0041] SEQ ID NO: 3: GGTCAATCATGGCAA GATATCCATCACACTGGCGGCCG.

[0042] Step 3: The two Bro ligands were polymerized to construct five polymeric ligands containing dual luciferin binding sites, named dBro#1, dBro#2, dBro#3, dBro#4, and dBro#5, respectively. After fluorescence imaging and quantitative screening, two polymeric ligands, dBro#1 and dBro#2, with fluorescence enhancement of more than 2 times were obtained. Their nucleotide sequences are shown in SEQ ID NO: 4 and SEQ ID NO: 5, respectively.

[0043] SEQ ID NO: 4 (dBro#1): AGACGGTCGGGTCCACCTGAGACGGTCGGGTCCAGATATTCGTATCTGTCGAGTAGAGTGTGGGCTCAGGTGTCGAGTAGAGTGTGGGCT.

[0044] SEQ ID NO: 5 (dBro#2): AGACGGTCGGGTCCAAATGAGAGGGTCGGGTCCAGATATTAGTATCTGTTGAGTAGAGTGTGGTCTCATTTGTCGAGTAGAGTGTGGGCT.

[0045] Step 4: Polymerized ligands dBro#1 and dBro#2 are embedded to form tetraploid broccoli aptamers. Based on photophysical characteristics and in vitro fluorescence intensity evaluation, 3WJ-2dBro (see SEQ ID NO: 1) with the strongest fluorescence signal is selected as the final aptamer.

[0046] Furthermore, in application, the above-mentioned RNA aptamer can be used to prepare a fluorescence imaging kit for *Fusobacterium nucleatum*. This kit contains at least the RNA aptamer as shown in SEQ ID NO: 1 and the DFHBI fluorescent dye. In one specific embodiment, the kit is used as follows: the 3WJ-2dBro sequence is integrated into the *Fusobacterium nucleatum* genome to achieve stable expression. Subsequently, it is co-incubated with the DFHBI fluorescent dye under suitable conditions (temperature 37°C, concentration, incubation time 15 min) to form a specific fluorescent complex. Then, using a fluorescence microscope or confocal microscope, non-invasive, real-time dynamic imaging of the labeled bacteria can be performed, achieving live fluorescence imaging of *Fusobacterium nucleatum*, which is particularly suitable for bacterial visualization studies under anaerobic or hypoxic environments.

[0047] The specific implementation of the present invention will be described below with reference to the embodiments. Of course, the scope of protection of the present invention is not limited to the following embodiments.

[0048] Example 1: Preparation of fluorescent RNA aptamers like Figure 1 As shown, based on the sequence and crystal structure of broccoli, site-directed mutagenesis was performed on the core motif within broccoli that maintains the planar stability of the G-quadruplex, constructing 10 mutants (bro#1, bro#2, bro#3, bro#4, bro#5, bro#6, bro#7, bro#8, bro#9, bro#10). Based on in vitro fluorescence imaging and quantification, as shown... Figure 2As shown, Figure 2 A shows in vitro fluorescence imaging images of different mutants; Figure 2 B is Figure 2 Statistical analysis of fluorescence intensity in each group of A revealed a mutant with significantly enhanced fluorescence, bro#4, which was named enhanced broccoli (Bro). Its nucleotide sequence is shown in SEQ ID NO: 2.

[0049] Based on the F30 scaffold sequence and the three-dimensional structure of F30 RNA, eight three-dimensional structure variants (F30#1, F30#2, F30#3, F30#4, F30#5, F30#6, F30#7, and F30#8) were designed as RNA scaffolds to stabilize the Bro conformation. These variants were screened using in vitro fluorescence imaging and quantitative methods, such as... Figure 3 As shown, Figure 3 A shows in vitro fluorescence imaging images of different variants; Figure 3 B is Figure 3 Statistical analysis of the fluorescence intensity of each group in group A revealed that the F30#2 scaffold significantly enhanced the fluorescence intensity of Bro. This superior F30 scaffold variant was named 3WJ, and its nucleotide sequence is shown in SEQ ID NO: 3.

[0050] Two Br0 ligands were polymerized to construct five polymeric ligands (dBro#1, dBro#2, dBro#3, dBro#4, and dBro#5) containing dual-luciferin co-binding sites. These were then screened using fluorescence imaging and quantitative methods. Figure 4 As shown, Figure 4 A shows in vitro fluorescence imaging images of different polymers with suitable ligands; Figure 4 B is Figure 4 Statistical analysis of the fluorescence intensity of each group in A revealed two polymeric ligands, dBro#1 and dBro#2, with fluorescence enhancement exceeding 2 times. Their nucleotide sequences are shown in SEQ ID NO: 4 and SEQ ID NO: 5, respectively.

[0051] Using 3WJ as a scaffold, dBro#1 and dBro#2 were embedded to form a tetraploid broccoli aptamer, named 3WJ-2dBro, whose nucleotide sequence is shown in SEQ ID NO: 1. Its fluorescence intensity was increased by 2.3 times compared with dBro#2, and it served as the final aptamer.

[0052] Example 2: Performance evaluation of the 3WJ-2dBro aptamer In this embodiment, the key performance of 3WJ-2dBro was evaluated by detecting its photophysical characteristics, in vitro fluorescence intensity and stability, and 3WJ-2dBro was compared in parallel with dBro#2 and 3WJ-4×Bro.

[0053] (1) Photophysical property testing 50 μM of purified aptamer RNA was added to 1×HEPES buffer containing 5 mM MgCl2 and 10 μM DFHBI-1 (ensuring an excess of RNA relative to DFHBI-1T to eliminate the influence of free DFHBI-1T), forming a 50 μL RNA-DFHBI-1T reaction solution. The solution was heated at 95°C for 3 min in a PCR instrument, then slowly cooled to room temperature with a cooling gradient of 1°C / min. The aptamer RNA was refolded to eliminate misfolding during transcription. The reaction solution was then spectrally scanned using a Hitachi F7000 fluorescence spectrophotometer to determine the maximum excitation and emission wavelengths.

[0054] The test results are shown in Table 1 below.

[0055] Table 1. Photophysical characteristics of the 3WJ-n×Bro family

[0056] As shown in Table 1, 3WJ-2dBro and 3WJ-4×Bro have the same excitation and emission spectra, but the extinction coefficient of 3WJ-2dBro is significantly higher than that of 3WJ-4×Bro.

[0057] (2) In vitro fluorescence intensity assessment of 3WJ-2dBro In vitro imaging was performed on 50 μM complexes of 3WJ-2dBro, 3WJ-4×Bro, and dBro#2 with 10 μM DFHBI-1T under 488 nm excitation light and a 520 nm filter.

[0058] Test results are shown Figure 5 As shown. Figure 5 A shows in vitro fluorescence imaging images of different RNA scaffold-DFHBI-1T complexes; Figure 5 B represents the statistical analysis of the fluorescence intensity of each group in A.

[0059] Depend on Figure 5 It is evident that the fluorescence intensity of 3WJ-2dBro is significantly higher than that of 3WJ-4×Bro and dBro#2.

[0060] (3) Evaluation of the photostability of 3WJ-2dBro The aptamer RNA-DFHBI-1T complex (4 μM RNA, 50 mM KCl, 5 mM MgCl2, and 20 μM DFHBI-1T) was prepared, and the initial fluorescence (Fi) was measured using a fluorescence spectrophotometer. After incubation under a fluorescent lamp (1500 Lux) for 5 h, the residual fluorescence (F) was measured again hourly. t ), measured 5 times.

[0061] The photobleaching half-life is calculated using the following formula: The photobleaching process of DFHBI-1T conforms to first-order reaction kinetics as a whole, that is, it satisfies: F(t) = F0e kt F(t): fluorescence intensity at millisecond t; F0: initial fluorescence intensity; k: photobleaching rate constant; t: time (milliseconds); k: photobleaching rate constant. The formula for calculating the photobleaching half-life is: t1 / 2 = ln2 / k.

[0062] Test results are shown Figure 6 As shown. Figure 6 The photobleaching half-life of 3WJ-2dBro was significantly longer than that of 3WJ-4×Bro and dBro#2.

[0063] Depend on Figure 6 It is evident that 3WJ-2dBro exhibits the best photostability, with an average photobleaching half-life of 8.17 hours, significantly higher than 3WJ-4×Bro and dBro#2.

[0064] (4) Thermal stability assessment of 3WJ-2dBro RNA solutions (4 μM RNA, 50 mM KCl, 5 mM MgCl2, and 20 μM DFHBI-1T) were prepared and refolded using the above method. Samples were added to 96-well plates, and melting curve analysis was performed using a real-time PCR instrument. Temperature control conditions were: 25–95 °C, increasing by 0.5 °C every 10 s, with each temperature held for 30 s before plate reading. Melting curves and automatically calculated Tm values ​​were determined using BioRad software on a CFX96.

[0065] Thermal cycling stability assessment: The aptamer RNA-DFHBI-1T complex was heated at 95℃ for 3 min, then slowly cooled to room temperature with a cooling gradient of 1℃ / min. The aptamer RNA was refolded and cycled 15 times, with residual fluorescence intensity measured after each cycle. The melting cycle number was defined as the number of thermal cycles required for the fluorescence intensity to decrease to half of its initial intensity during multiple thermal cycles.

[0066] Test results are shown Figure 7 As shown, Figure 7 A is the Tm value of aptamers such as 3WJ-2dBro, which is defined as the temperature at which fluorescence decays by 50%. Figure 7 B is the melting cycle number of aptamers such as 3WJ-2dBro, which is defined as the number of thermal cycles required for the fluorescence intensity to decrease to half of its initial intensity during multiple thermal cycles.

[0067] Depend on Figure 7As can be seen, the Tm value of 3WJ-2dBro is 52.83℃, which is significantly higher than that of 3WJ-4×Bro and dBro#2. Furthermore, the average melting cycle number of 3WJ-2dBro is 4.8, which is also significantly higher than that of 3WJ-4×Bro and dBro#2. This indicates that 3WJ-2dBro can still recover a high effective folding ratio after multiple rounds of thermal deformation, thus exhibiting high thermal stability.

[0068] Therefore, the 3WJ-2dBro obtained in this invention, by embedding a smaller number of Bro units into the 3WJ scaffold, achieves superior performance in photophysical properties, photostability, and thermal stability compared to the best-performing 3WJ-4×Bro in the prior art. Furthermore, the aforementioned test results show that the polymeric dBro embedding strategy employed in this application, compared to the tandem repeating Bro strategy (3WJ-4×Bro) of the prior art, can achieve stronger fluorescence output and better stability with fewer Bro units. This advantage is particularly important in live bacteria imaging applications—stronger fluorescence brightness improves the imaging signal-to-noise ratio and detection sensitivity, while better photostability supports long-term dynamic tracking of live bacteria, providing a more reliable molecular tool for in vivo imaging studies of anaerobic bacteria.

[0069] Example 3: In vitro live bacterial imaging of Fusobacterium nucleatum based on fluorescent RNA aptamer labeling The fluorescent RNA aptamer labeled with 3WJ-2dBro (final concentration 30 uM) was mixed with Clostridium nucleatum bacterial culture (1×10⁻⁶). 9 The bacterial culture (CFU / mL) was incubated in a co-culture incubator at 37°C and 5% CO2 for 15 min. The labeled bacterial culture was then dropped onto a glass slide and imaged using a confocal microscope at an excitation wavelength of 488 nm.

[0070] See imaging results Figure 8 As shown.

[0071] Depend on Figure 8 As can be seen, the nucleated Fusobacterium tumefaciens labeled with fluorescent RNA aptamers exhibited obvious green fluorescence, while the control group (without aptamers) showed no fluorescence signal.

[0072] Example 4: Evaluation of the effect of 3WJ-2dBro on the biological properties of Fusobacterium nucleatum This embodiment is used to evaluate the effects of 3WJ-2dBro labeling on the morphological characteristics, growth status, and host cell adhesion and invasion capabilities of Fusobacterium nucleatum.

[0073] (1) F. nuclearum Morphological characteristics of -3WJ-2dBro Take a culture of *Fusobacterium nucleatum* in the logarithmic growth phase, centrifuge at 6000 rpm for 5 min, discard the supernatant, resuspend and wash with PBS, repeating the washing process three times. After the final centrifugation, discard the PBS, resuspend the cells in electron microscopy fixative, and fix at 4°C for 3 hours. After fixation, wash three times with PBS, 15 min each time. Replace the water in the sample successively with 30%, 50%, 75%, 95%, and anhydrous ethanol solutions, treating for 15 min at each concentration. Finally, treat three times with anhydrous ethanol, 20 min each time, to ensure complete water replacement. Place the sample in a desiccator for drying. Attach the dried *Fusobacterium nucleatum* sample to a sample stage with conductive adhesive, spray a layer of metallic film onto the surface, and then photograph.

[0074] See results Figure 9 As shown.

[0075] Depend on Figure 9 It is evident that the 3WJ-2dBro labeling does not affect the morphological characteristics of Fusobacterium nucleatum.

[0076] (2) F. nuclearum Growth curve determination of -3WJ-2dBro Wild-type in the mid-to-late stages of logarithmic growth F. nuclearum and F. nuclearum The -3WJ-2dBro mutant strain was inoculated into fresh BHI liquid medium to achieve an initial OD600 value of approximately 0.5. The culture was then placed in an anaerobic incubator at 37°C and 5% CO2. Samples were taken every 4 hours, and the OD600 value of the bacterial culture was measured at 600 nm using a multi-mode microplate reader. Measurements were performed continuously for 48 hours, and a time-OD value growth curve was plotted.

[0077] See the test results. Figure 10 .

[0078] Depend on Figure 10 It is evident that the wild type F. nuclearum and F. nuclearum The growth curves of the -3WJ-2dBro mutants showed no significant difference.

[0079] (3) F. nuclearum -3WJ-2dBro genetic stability assay Extract from cells that have been cultured for 5 consecutive generations and are in the logarithmic growth phase F. nuclearum RNA of -3WJ-2dBro, after removing genomic DNA, is reverse transcribed to obtain F. nuclearum -3WJ-2dBro cDNA was then subjected to real-time quantitative reverse transcription PCR. F. nuclearum and F. nuclearumUsing the cDNA of -3WJ-2dBro as a template, and Erm-F and 3WJ-2dBro-R as primers, the Erm+3WJ-2dBro gene fragment of this bacterium was amplified by PCR. After PCR amplification, electrophoresis was performed on a 1% (w / v) agarose gel to detect the presence of fragments of the expected size.

[0080] Test results as follows Figure 11 As shown, Figure 11 A represents the relative expression level of the 3WJ-2dBro insert across different generations. Figure 11 B represents the gel electrophoresis verification of the 3WJ-2dBro insert fragment in different generations of strains.

[0081] Depend on Figure 11 It is evident that the expression level of 3WJ-2dBro is not significantly different from that of 16S rRNA, and 3WJ-2dBro can be stably inherited in all 5 generations.

[0082] This invention achieves highly specific labeling and live cell imaging of Fusobacterium nucleatum using a specific fluorescent RNA aptamer, providing a new technical means for the rapid detection of periodontal pathogens.

[0083] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Any simple modifications or equivalent changes made to the above embodiments based on the technical essence of the present invention shall fall within the protection scope of the present invention.

Claims

1. A method for treating Fusobacterium nucleatum (… Fusobacterium nucleatum RNA aptamers for fluorescence imaging, characterized by: The RNA aptamer is named 3WJ-2dBro, and its nucleotide sequence is shown in SEQ ID NO:

1.

2. The application of the RNA aptamer as described in claim 1 in the preparation of a fluorescence imaging kit for Fusobacterium nucleatum, characterized in that: The kit contains RNA aptamers and DFHBI fluorescent dye.

3. A kit for fluorescence imaging of Fusobacterium nucleatum, characterized in that: include: (1) Nucleotides such as the RNA aptamer shown in SEQ ID NO: 1; (2) DFHBI fluorescent dye.

Images