Mckat gene for regulating synthesis of benzene ring floral fragrance substances of michelia figo and application thereof

Abstract

This invention discloses a McKAT gene that regulates the synthesis of benzene-ring floral fragrance compounds in Michelia champaca and its applications, belonging to the field of plant genetic engineering technology. This invention screened and obtained the McKAT gene from Michelia champaca through transcriptome-metabolome association analysis, and then isolated, cloned, and analyzed it using bioinformatics. Heterologous overexpression in Petunia 'W115' confirmed that McKAT has the function of positively regulating the synthesis of benzene-ring floral fragrance compounds. This invention reveals that the McKAT gene can regulate the synthesis of benzene-ring floral fragrance compounds in plants and can be applied to improve the floral fragrance quality of Michelia champaca or Petunia.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, and in particular to a McKAT gene that regulates the synthesis of benzene ring-type floral fragrance substances in Michelia champaca and its applications. Background Technology

[0002] Michelia crassipes is an evergreen small tree or shrub belonging to the genus Michelia in the family Magnoliaceae. Its flowers are purplish-red and have a rich fragrance with a unique "fruity aroma". It is a rare fragrant ornamental plant in my country and has important application value and development potential in landscaping and specialty flower industry. It can be used to extract essential oils, perfumes and cosmetics.

[0003] The main contributing component to the characteristic fragrance of Michelia champaca is methyl benzoate, a benzene ring compound (C6-C1). Its release is highest in the stamens during the initial flowering stage, which is closely related to its "fruity" aroma. The biosynthesis of benzene ring compounds mainly occurs through the β-oxidation pathway, in which 3-ketoacyl-CoA thiolylase (KAT) is the key rate-limiting enzyme catalyzing side chain shortening, responsible for generating benzoyl-CoA, which is then converted into volatile components such as methyl benzoate.

[0004] Currently, there are no reports on the regulation of benzene ring-based aromatic compounds synthesis by the KAT gene in aromatic plants of the Magnoliaceae family, such as Michelia champaca. Therefore, identifying the key KAT gene in Michelia champaca that regulates the synthesis of benzene ring-based aromatic compounds is of great significance for elucidating the mechanism of floral fragrance formation and carrying out targeted improvement of aromatic quality. Summary of the Invention

[0005] To address the aforementioned deficiencies in existing technologies, this invention proposes a McKAT gene that regulates the synthesis of benzene-ring aromatic compounds in Michelia champaca and its application. Based on previous metabolomics and transcriptomics association analysis, this invention screened a gene—McKAT—that is highly correlated with the release pattern of methyl benzoate, and verified its function in regulating the synthesis of benzene-ring aromatic compounds, thereby solving the problems mentioned in the background technology.

[0006] To achieve the above objectives, the present invention provides the following technical solution: This invention discloses a McKAT gene that regulates the synthesis of benzene ring-type floral fragrance substances in Michelia champaca, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0007] Preferably, a primer pair for amplifying the McKAT gene, the sequences of which are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0008] Preferably, a real-time PCR primer for detecting the McKAT gene is provided, the sequence of which is shown in SEQ ID NO.4 and SEQ ID NO.5.

[0009] The present invention provides a recombinant vector containing the McKAT gene.

[0010] The present invention provides a recombinant bacterium containing the recombinant vector.

[0011] The present invention provides a cell line comprising the recombinant vector.

[0012] This invention provides the application of the McKAT gene in regulating the synthesis of benzene ring-type floral fragrance substances in Michelia violacea.

[0013] Preferably, the McKAT gene regulates the synthesis and release of benzene ring-based floral fragrance substances in Michelia violacea by catalyzing key reactions in the benzene ring (C6-C1) synthesis pathway.

[0014] This invention provides the application of the McKAT gene in improving the floral fragrance quality of plants. By overexpressing the McKAT gene in plants, the content of benzene ring floral fragrance substances, heterocyclic compounds A and fatty acid derivatives is increased, while the content of heterocyclic compounds B is decreased. The plants include one or more of Michelia champaca and Petunia.

[0015] Preferably, the benzene ring floral fragrance substance includes at least one of phenethyl β-butyrate, hexyl benzoate, 2,3-dimethylphenol, and 3,4-dimethylphenol; the heterocyclic compound A includes at least one of isonicotinic acid ethyl ester, 4-tert-butyl-1-isopropyl-1H-imidazol-2-thiol, and nicotinic acid ethyl ester; the fatty acid derivative includes at least one of pseudoionone and 1-acetyl-2-methyl-1-cyclopentene; and the heterocyclic compound B includes 1,3-dimethyl-4-piperidinone.

[0016] This invention also provides a method for constructing a transgenic plant with increased content of benzene ring-based floral fragrance substances. The method involves using Agrobacterium-mediated transformation to transfer a vector containing the McKAT gene into the plant genome, followed by screening to obtain transgenic plants. The plants include one or more of Michelia champaca and Petunia purpurea.

[0017] Compared with the prior art, the beneficial effects of the present invention are: (1) Using molecular biology and bioinformatics techniques, the McKAT gene, which has a regulatory effect on benzene ring fragrance substances in Michelia purpurea, was screened out. Its nucleotide sequence is shown in SEQ ID NO.1. Its function was further verified and it was found that the McKAT gene can regulate the synthesis of benzene ring fragrance substances in Michelia purpurea. (2) This invention provides the application of the McKAT gene in improving the fragrance quality of Michelia champaca or Petunia florida. The synthesis of benzene ring fragrance substances is enhanced by overexpressing the McKAT gene in plants. The function of the McKAT gene in regulating the synthesis of benzene ring fragrance substances is verified by overexpression analysis in Petunia florida. The correlation between the expression pattern of the McKAT gene and fragrance release is clarified, providing important gene resources and theoretical basis for molecular breeding of fragrance traits in Michelia champaca and Petunia florida. Attached Figure Description

[0018] Figure 1 The perianth segments, stamens, and pistils of Michelia champaca at three different flowering stages; Figure 2 It is the main component of the volatile compounds in Michelia champaca flowers; Figure 3 Spatiotemporal analysis (a), principal component analysis (b), and hierarchical clustering of the release patterns of the main fragrance components of Michelia champaca. Class analysis (c); Figure 4 This study analyzed the spatiotemporal expression pattern of the McKAT gene and the release of characteristic aroma compounds in Michelia purpurea. Figure A shows the morphology of complete flowers, perianth segments, pistils, and stamens at three flowering stages (S1: bud stage, S2: initial flowering stage, S3: full bloom stage), with a scale bar of 1 cm. Figure B shows the relative expression levels of the McKAT gene in different flowering stages and different floral organs as detected by qRT-PCR. Figure C is a bar chart showing the release levels of the key floral aroma compound methyl benzoate in different floral organs and at different flowering stages. Figure 5 Heatmap analysis of FPKM values ​​for differentially expressed genes related to the benzene ring (C6-C1) synthesis pathway during the three flowering stages of Michelia purpurea. Candidate McKAT genes are marked with a red asterisk; the heatmap color represents the log2 FPKM value. Figure 6 Electrophoresis diagram of the McKAT gene in Michelia champaca; Figure 7 The physicochemical properties and secondary structure prediction analysis of McKAT protein in Michelia purpurea are presented in Figure A, which shows the hydrophilicity / hydrophobicity analysis of McKAT protein, and Figure B shows the results of the secondary structure prediction analysis of McKAT protein. Figure 8 Results of McKAT protein sequence analysis for Michelia violacea; Figure 9 Subcellular localization analysis of McKAT protein in tobacco leaves; Figure 10This study validated the overexpression of the McKAT gene in *Michelia champaca* 'W115' petunia. Figure A shows the PCR identification results of positive lines of the McKAT transgenic petunia, with the target band at 300 bp. Figure B compares the flower phenotypes of wild-type (WT) and transgenic (OE-McKAT) petunias (scale bar 1 cm). Figure C shows the OPLS-DA analysis of the metabolomes of wild-type and transgenic petunias. Figure D shows the flower patterns of wild-type and transgenic petunias. Figure E shows a comparison of the proportion of major volatile aroma compounds (VOCs) in wild-type and transgenic petunias; Figure F shows a volcano plot of differential metabolites in transgenic petunias, where red, green, and gray dots represent metabolites that are significantly upregulated, downregulated, and have no significant difference, respectively; Figure G shows a bar chart of the relative contents of 10 differential metabolites, where different lowercase letters (a, b) indicate significant differences in relative contents between different samples (P<0.05). Detailed Implementation

[0019] To enable those skilled in the art to better understand the technical content of the present invention, the technical solution of the present invention will be further described in detail below with reference to specific embodiments.

[0020] Materials sourced from: plasmids EGFP, pBWA(V)H2STMV, and pBWA(V)KS were obtained from Wuhan Boyuan Biotechnology Co., Ltd.; TA / Blunt-Zero Cloning Kit was obtained from Nanjing Novizan Biotechnology Co., Ltd.; Escherichia coli DH5α competent cells were obtained from Shanghai Vidi Biotechnology Co., Ltd.; and Agrobacterium tumefaciens EHA105 and GV3101 were obtained from Wuhan Boyuan Biotechnology Co., Ltd.

[0021] Culture medium and formulation (1) LB medium (100mL): 0.5g yeast extract, 1g tryptone, 1g sodium chloride (if preparing solid medium, add 1.5g agar powder), make up to 100mL with distilled water, sterilize at 120℃ for 20min, and add antibiotics of appropriate concentration as needed; (2) Symbiotic culture medium (1000mL): 4.43g MS medium, 7.5g agar powder, 20g sucrose, 10g glucose, 1mg folic acid, 2mg 6-BA, 0.1mg NAA, pH adjusted to 6.0~6.5, sterilized at 120℃ for 20min, and then added 1mg ZT and 20mg AS in a clean bench; (3) Selective culture medium (1000mL): 4.43g MS medium, 7.5g agar powder, 20g sucrose, 10g glucose, 1mg folic acid, 2mg 6-BA, 0.1mg NAA, pH adjusted to 6.0~6.5, sterilized at 120℃ for 20min, and then added 1mg ZT, 300mg Cef and antibiotics of corresponding concentration in a clean bench; (4) Seedling culture medium (1000mL): 4.43g MS medium, 7.5g agar powder, 20g sucrose, 10g glucose, 1mg folic acid, pH adjusted to 6.0~6.5, sterilized at 120℃ for 20min, and then added 2mg ZT, 300mg Cef and corresponding concentrations of antibiotics in a clean bench. (5) Rooting medium (1000mL): 4.43g MS medium, 7.5g agar powder, 20g sucrose, 10g glucose, 1mg folic acid, 0.1mg IBA, pH adjusted to 6.0~6.5, sterilized at 120℃ for 20min, and then added 300mg Cef and antibiotics of the corresponding concentration in a clean bench.

[0022] Example 1: Screening and identification of the McKAT gene regulating the synthesis of floral fragrance substances (1) Determination of benzene ring-like floral fragrance substances in Michelia violacea The volatile compounds of Michelia violacea at different flowering stages and in different floral organs were identified using a combination of headspace solid-phase microextraction (HS-SPME) and high-resolution gas chromatography (GC-HRMS). The specific steps are as follows: (1.1) The test materials used in this study, Michelia crassipes, were all collected from Hunan Provincial Forest Botanical Garden. On May 4, 2021, at 9:00 AM, under sunny and windless weather conditions, 10 Michelia crassipes plants of uniform age and free from pests and diseases were collected from naturally opened flowers at the following stages: bud stage (flower bud swelling, bracts splitting, exposing purple perianth segments, bud length / cm 1.786±0.016 c), early flowering stage (perianth segments slightly open, exposing stamens and pistils, no pollen shedding, bud length / cm 2.059±0.049 b), and full bloom stage (both whorls of perianth segments fully open, with abundant pollen but not browned and withered, bud length / cm 2.444±0.033 a). Perianth segments (petals), pistils, and stamens were collected as test materials. Figure 1 (Different lowercase letters in the text indicate significant differences at different flowering stages, P<0.05, the same below). Each stage has a total of twelve flowers. After separating the different flower organs with sharp tweezers, they were immediately stored in 5mL cryovials and frozen in liquid nitrogen. They were then transported to the Modern Analytical Testing Center of Central South University for volatile component determination and stored in an ultra-low temperature freezer at -80℃ for later use.

[0023] (1.2) HS-SPME determination process After separating the samples and removing the stems, perianth segments, stamens, and pistils at different flowering stages were collected. Liquid nitrogen was added, and each floral organ was ground into powder using a mortar and pestle. After thorough mixing, 0.100 g of powder was accurately weighed and added to a 120 mL solid-phase microextraction bottle (Thermo Fisher Scientific, Waltham, MA, USA), and sealed with a polytetrafluoroethylene septum aluminum cap. 990 µL of distilled water was added to 10 µL of 0.802 g / mL 4-methyl-2-pentanol solution, and the prepared dilution was used as an internal standard. Each sample was equilibrated in a 60 °C water bath for 10 min before analysis. A preheated and equilibrated 50 / 30 μm DVB / CAR / PDMS (divinylbenzene / formaldehyde / polydimethylsiloxane) solid-phase microextraction head was automatically inserted for headspace extraction for 40 min. Immediately after extraction, the extracted fibers were inserted into the high-resolution gas chromatograph inlet and thermally desorbed at 250 °C for 1 min.

[0024] (1.3) GC-HRMS measurement conditions GC-HRMS analysis was performed using a Trace 1310 GC chromatograph equipped with a TriPlus RSH autosampler, coupled with a Q-Exactive Orbitrap mass spectrometer. Chromatographic separation was performed on a DB-5MS capillary column. High-purity helium (99.999%) was used as the carrier gas, with a split injection method of 5:1 and a total flow rate of 1 mL / min. The initial temperature was 70 °C for 1 min, then increased to 100 °C at a rate of 12 °C / min, then to 180 °C at a rate of 2 °C / min, and finally to 250 °C at a rate of 12 °C / min, held at 280 °C for 2 min. The EI source voltage is 70eV, the ion source temperature is 250℃, the interface temperature is 250℃, the mass scan range is m / z 30~3000u, the resolution is R=120000 FWHM (m / z200), the accurate mass tolerance is ≤1ppm, and the detection is performed using Orbitrap HRMS full scan mode.

[0025] (1.4) Data Analysis After obtaining the chromatograms and mass spectra of the compounds, high-resolution precision mass spectra (HRAM) data acquisition was performed. Comparative analysis was conducted using the GC-Orbitrap Contaminants Library, GC-Orbitrap Other Environmental, GC-Orbitrap PCBs, GC-Orbitrap Pesticides, and HiRes mainlib high-resolution spectral databases within the Thermo TraceFinder General GC software associated with the high-resolution GC-MS workstation to identify the volatile components.

[0026] The content of 4-methyl-2-pentanol (internal standard) (1 µL, 8.020 µg / kg) and the peak area of ​​the volatile component to be analyzed were compared with the peak area of ​​the internal standard to calculate the content of the volatile component relative to the internal standard, thus enabling quantitative analysis of the compound. The calculation method was referenced from Li Xiaoying et al. and modified; the calculation formula is as follows: ω x =[(A x ×m s ) / (A s ×m x )]×M r ; In its calculation formula, ω x A is the concentration (µg / kg) of the volatile compound x to be tested relative to the internal standard. x It is the peak area of ​​the volatile substance x to be measured, m s It is the amount of internal standard (µg), A s It is the peak area of ​​the internal standard, m x It is the sample amount (g), M r It is the molecular weight of the volatile component to be tested.

[0027] Based on the quantitative analysis results of volatile components, the aroma thresholds of each volatile component were obtained from relevant literature, and their aroma activity values ​​(OAV) were calculated using the following formula: OAV s =C / A; In its calculation formula, C is the content of volatile components, A is the aroma threshold of volatile components, and OAV is... s It is the ratio of the content of its volatile components to the aroma threshold.

[0028] (1.5) Test Results (1.5.1) Analysis of the types of volatile components in the fragrance of Michelia champaca The volatile components of Michelia champaca flowers were analyzed by HS-SPME-GC-Orbitrap-HRMS. The total ion chromatogram of volatile components was compared with a high-resolution mass spectrometry database. After removing compounds with a relative content of less than 0.01%, a total of 69 volatile floral fragrance compounds were identified. According to their chemical classification, they can be mainly divided into terpenes (48), alcohols (11), esters (5), benzenes (3), aldehydes (3), phenols (1), and ketones (1). Terpenes had the highest content, accounting for 84% of the total content, as shown in Table 1. By screening floral fragrance compounds with a relative content of more than 1%, 24 floral fragrance compounds were found to have a release rate of more than 1% in a certain floral organ of Michelia champaca. Among them, α-guaiacol had the highest relative content, accounting for 15.32%~51.06%, followed by β-caryophyllene (7.03-16.49%) and geraniol B (6.96-14.04%). In addition, β-caryophyllene (2.89-4.86%), α-caryophyllene (2.35-3.43%), γ-ylangolene (3.32-5.89%), and α-cobaene (1.86-3.87%) also accounted for a significant proportion in various floral organs at different flowering stages. Figure 2 ).

[0029] Table 1. Relative contents of fragrance compounds in Michelia champaca.

[0030] Table Note: Values ​​are the mean ± SD of 5 replicates; Tr: values ​​< 0.01; the same applies below.

[0031] (1.5.2) Analysis of the aroma intensity values ​​(OAVs) and characteristic aroma components of Michelia champaca Aroma intensity value (OAV) can be calculated by dividing the average concentration of a specific volatile substance by its aroma threshold. A higher OAV value indicates a greater contribution of that volatile component to the aroma. Generally, if OAV ≥ 1, it indicates that the volatile component has a non-negligible contribution to the aroma and is considered a characteristic aroma component; if 0.1 < OAVs < 1, it indicates that the volatile component has a modifying effect on the aroma and is considered a modifying aroma component; if OAVs ≤ 0.1, it indicates that the volatile component has no significant effect on the aroma. Therefore, as shown in Table 2, 16 floral fragrance components with aroma intensity values ​​greater than 0.1 were screened in a certain floral organ during three flowering stages in *Michelia champaca*, of which 7 floral fragrance components had aroma intensity values ​​greater than 1.

[0032] Therefore, methyl benzoate, ethyl 3-methylvalerate, β-damascone, β-caryophyllene, α-pinene, β-ionone, and phenethyl alcohol, which have high aroma intensity values, can be considered characteristic aroma components of *Michelia champaca*. These aroma components constitute the characteristic fruity, floral, and woody aroma of *Michelia champaca*. Meanwhile, cis-β-ocimene, β-caryophyllene, linalool, and nerolidol are modifying aroma components of *Michelia champaca*, contributing to its complex fresh, floral, and woody fragrance. Furthermore, since the aroma thresholds for many high-content volatile compounds were not found, the aroma intensity values ​​of some major volatile components could not be calculated. Therefore, volatile compounds with a total release percentage of less than 1% but an aroma intensity value greater than 0.1 are also considered major floral aroma components of *Michelia champaca*, including ethyl 3-methylvalerate, β-damascone, β-ionone, β-apigenin, D-limonene, and nerolidol. Among them, methyl benzoate, a benzene ring compound, had an aroma intensity value (OAVs) greater than 1 in all three floral organs at three flowering stages, with an average OAVs of 5.99 in the stamens. It is the characteristic aroma compound that gives Michelia champaca its fruity fragrance, and its release was highest in the stamens during the initial flowering stage of Michelia champaca.

[0033] Table 2. Volatile components with aroma intensity values ​​greater than 0.1 in Michelia champaca (OAVs>0.1)

[0034] (2) Changes in the fragrance of Michelia champaca during the three flowering stages (2.1) Using Michelia purpurea as the test material, the changes in fragrance during the flowering process of Michelia purpurea were detected by HS-SPME combined with GC-HRMS technology.

[0035] (2.2) Test Results like Figure 3 As shown, the release of benzene ring-based floral fragrance components varied significantly at different stages of Michelia champaca flower development. A comparison of the release levels of major floral fragrance components from different flowering stages and floral organs of Michelia champaca revealed that the overall release level was highest during full bloom (891.82–1520.63 µg / kg), with the highest content of volatile components in the pistil, approximately 3 times and 7 times higher than that in the perianth segments (350.12–449.11 µg / kg) and stamens (135.72–229.05 µg / kg), respectively. Figure 3 (a)). Further principal component analysis showed that the variance contribution rates of the first principal component (PC1) and the second principal component (PC2) were 56.2% and 36.3%, respectively. The top 10 fragrance components with the highest loading values ​​on each PC were used as the main factors to distinguish different flowering periods and different floral organs. Figure 3(b)). Among them, δ-juniperene, β-damascene, and geraniol D are the main components that distinguish the pistil from the perianth and stamen. Bicyclosesquiterpenesene, geraniol D, α-branthene, and cis-β-ocimene help distinguish the perianth segments from other parts. In addition, methyl benzoate and phenethyl alcohol are the main components that distinguish the stamen from other parts. However, the main volatiles of the same floral organ at different flowering periods are not significantly different. The results of hierarchical cluster analysis show that the release patterns of the fragrance components of Michelia champaca can be clustered into 4 categories ( Figure 3 (c)). Components in the first and fourth clusters are mainly released from the pistil, while components in the second and third clusters are mainly released from the perianth segments and stamens, respectively. Specifically, during the initial flowering stage of *Michelia purpurea*, the contents of α-guaiacene, linalool formate, and hesperidin significantly increased in the pistil; the contents of borneol acetate, geraniol D, β-ionone, β-capryne, and benzyl acetate significantly increased in the perianth segments; and the contents of methyl benzoate and phenylethanol significantly increased in the stamens.

[0036] like Figure 4 The C-value shows that the absolute content of methyl benzoate, a benzene ring-based floral fragrance compound, exhibits a trend of first increasing and then decreasing at different stages of Michelia champaca flower development. Its release reaches its maximum during the initial flowering stage, and the changes are significant across the three stages.

[0037] (3) Screening for synthase genes that are significantly related to the release patterns of major floral fragrance compounds. Illumina sequencing was performed on nine samples of petals, stamens, and pistils from Michelia champaca at the bud stage, early flowering stage, and full bloom stage.

[0038] Test Results: 431,489 high-quality transcripts were assembled using Trinity software, and a total of 279,232 were annotated. Through transcriptome analysis of flowers at different flowering stages of *Michelia purpurea*, 30 terpene synthase genes (McTPS) were identified in *Michelia purpurea* in terms of gene screening significantly related to the release patterns of terpenoids. Two McDXS, one McDXR, one McGGPPS, one McTPS-b, and two McTPS-g genes in the MEP synthesis pathway were found to be consistent with the release pattern of linalool, a characteristic fragrance modifier. Simultaneously, two McHDS genes in the MVA synthesis pathway were found to be consistent with the release patterns of α-pinene, cis-β-ocimene, and D-limonene, characteristic fragrance modifiers of sesquiterpenes. It is speculated that these genes are key genes regulating the synthesis of terpenoids, the main volatile components of *Michelia purpurea* flowers.

[0039] (4) Screening to obtain the McKAT gene that regulates the synthesis of benzene ring-type floral fragrance substances. In gene screening that is significantly associated with the release patterns of phenylpropanol / benzene ring compounds, the McKAT gene, encoding a key rate-limiting enzyme in the benzene ring (C6-C1) biosynthetic pathway, was identified. Figure 5 The expression pattern of this gene is consistent with the release pattern of methyl benzoate, a key component contributing to the characteristic fragrance of Michelia champaca. Figure 5 , Figure 4 C), which is expressed in large quantities in the stamens of Michelia champaca during its initial flowering stage ( Figure 4 The gene B in the figure suggests that it is a key synthetic enzyme gene that regulates the release of floral fragrance.

[0040] Example 2: McKAT gene cloning Total RNA extraction from flowers at three different flowering stages (S1, S2, and S3): Plant materials consisted of three floral organs (tepals, stamens, and pistils) from three flowering stages (S1, S2, and S3). Liquid nitrogen grinding was used, with specific procedures following the instructions of the RNA EasyFast Plant Tissue RNA Rapid Extraction Kit (TIANGEN, Beijing, China). Total RNA concentration was determined using a micro-ultraviolet spectrophotometer. Qualified total RNA was used for reverse transcription or stored at -80℃.

[0041] S2. cDNA Synthesis: Following the instructions for the Tiangen Reverse Transcription Kit, gently mix the reagents with the total RNA in the reverse transcription PCR reaction system, place it in a PCR instrument, and react under the following conditions: 42℃ for 15 min, 95℃ for 3 min. Store the synthesized cDNA at -20℃ for later use. The reverse transcription PCR reaction system consisted of 4.0 μL of 5×FastKing-RT SuperMix, 1 μg of total RNA, and RNase-free H2O to a final volume of 20.0 μL.

[0042] S3. Gene Cloning: Cloning primers KAT-F: ATGGAGAAAGCGATCGAAAGGCAGAG, as shown in SEQ ID NO.2; KAT-R: CTATAGAGCATCCTTGGACAAAAGATTGTTG, as shown in SEQ ID NO.3. PCR amplification was performed using the cDNA obtained in step S2 as a template. The reaction system consisted of 10.0 μL 2×Taq PCR MasterMix II, 0.5 μL KAT-F (10 μM), 0.5 μL KAT-R (10 μM), 1.0 μL cDNA (template), and 8.0 μL RNase-Free ddH2O. The reaction program was: pre-denaturation at 98℃ for 3 min; denaturation at 94℃ for 30 s; annealing at 60℃ for 30 s; extension at 72℃ for 30 s; 35 cycles; final extension at 72℃ for 5 min. PCR amplification products were purified by agarose gel electrophoresis. The purified target fragment was ligated with the vector enzyme digestion product, and the ligation product was transformed into *E. coli* DH5α competent cells. Kanamycin (Kan) resistant monoclonal antibodies were obtained after plate culture. Single colonies were picked with sterile toothpicks as templates for colony PCR verification. The amplification products were detected by agarose gel electrophoresis, and positive clones were sequenced by Wuhan Boyuan Biotechnology Co., Ltd.

[0043] The obtained McKAT gene sequence, as shown in SEQ ID NO.1, is 1383 bp in length. Figure 6 As shown, it encodes 460 amino acids. The specific sequence information is as follows:

[0044] Example 3 Biochemical functional analysis of the McKAT gene (1) Physicochemical properties analysis of McKAT protein The physicochemical properties of the McKAT protein were predicted using Expasy-ProtParam (https: / / web.expasy.org / protparam / ) and SOPMA (https: / / npsa-prabi.ibcp.fr / ). The results showed that the molecular formula is C 2111 H 3436 N 602 O 647 S 20 The theoretical isoelectric point (pI) is 8.25, suggesting it is a basic protein. The instability coefficient is 31.42, suggesting it is a stable protein. The hydrophilicity coefficient is 0.029, as shown in the results. Figure 7 As shown in A in the diagram.

[0045] To further clarify its hydrophilic characteristics, an online hydrophilicity map of the McKAT protein was constructed using Expasy-ProtScale (https: / / web.expasy.org / protscale / ). The results showed that there were more negative values ​​than positive values, and most of them were located in the hydrophilic region, suggesting that the McKAT protein is a hydrophilic protein.

[0046] The secondary structure composition of the McKAT protein was predicted using the online tool SOPMA (https: / / npsa-prabi.ibcp.fr / ). The prediction results are as follows: Figure 7 As shown in B, the McKAT protein consists of three conformations, with the random coil being the most prevalent at 50.00%, followed by the α-helix and extended strand at 37.39% and 12.61%, respectively.

[0047] Subcellular localization prediction using WoLF PSORT showed that the McKAT protein is located in the peroxisome, which is consistent with its function as a 3-ketoacyl-CoA thiolytic enzyme involved in fatty acid β-oxidation.

[0048] (2) Evolutionary and phylogenetic analysis of the McKAT gene The McKAT gene sequence was compared with that of other known plants in the same family to analyze its evolutionary process within plants. This work primarily utilized software such as DNAMAN 6.0 and MEGA 11.0. Phylogenetic analysis of the McKAT gene is as follows: Figure 8As shown, after comparing members of the KAT family such as Magnolia officinalis, Arabidopsis thaliana, and Petunia spp., McKAT and PsKAT protein of Magnolia officinalis, which also belongs to the Magnoliaceae family, belong to the same cluster and are closely related.

[0049] (3) Subcellular localization S1. Construction of subcellular localization vector: The PCR product obtained in Example 2 was diluted 100 times as a template. PCR amplification was performed using subcellular localization primers KAT-SL-F: ATTACAATTACGGATCCACGCGTATGGAGAAAGCGATCGAAAGGCA (SEQ ID NO. 10) and KAT-SL-R: CAGCTCCTCGCCCTTGCTCACCATAGATCCTCCTCCAGATCCTCCTCCTAGAGCATCCTTGG (SEQ ID NO. 11). The PCR amplification reaction system was: 1.0 μL cDNA template, 0.5 μL KAT-SL-F, 0.5 μL KAT-SL-R, 2.5 μL 10×PrimeSTAR®Max, and 20.5 μL ddH2O. The PCR reaction program was: 98℃ for 3 min; 98℃ for 30 s, 60℃ for 30 s, 72℃ for 60 s (35 cycles); 72℃ for 5 min; and stored at 4℃. The cloned McKAT gene was recombined with the vector. First, the EGFP and pBWA(V)H2STMV vector were digested with enzymes. The specific digestion reaction system consisted of 12 μL Nuclease-free Water, 2.0 μL 10× Buffer, 1.0 μL MluI, 1.0 μL BsaI / Eco31I, and 4.0 μL pBWA(V)KS-ccDB, and the reaction was carried out at 37℃ for 1 h. Then, the digested vector was purified using a PCR purification kit, and the resulting product was named pBWA(V)H2STMVΩ-3xflag-ccdB-egfp(D). Subsequently, a recombinant system for the target gene and vector was constructed. The specific recombinant system consisted of 10.0 μL Biorun 2×Easy Clone Mix, 4.0 μL rDNAG1, 4.0 μL pBWA(V)H2STMVΩ-3xflag-ccdB-egfp(D), and 2.0 μL Nuclease-free Water. The mixture was incubated at 37°C for 30 min to obtain pBWA(V)H2STMVΩ-McKAT-egfp. The ligation product was introduced into competent *E. coli* cells using a heat shock technique. The specific procedure was as follows: 50 μL of competent cells were thoroughly mixed with 5 μL of the ligation product; the mixture was incubated on ice for 30 min, then heat-shocked at 42°C for 45 s, and immediately transferred to ice for 2 min. 500 μL of LB liquid medium was added to the system, and the mixture was incubated at 37°C with shaking for 1 h. Take 100 μL of the resuscitated bacterial culture and spread it evenly on a solid screening plate containing Kan. Invert the plate and incubate at 37°C for 12 h.

[0050] S2. To verify whether the selected colonies carry the target plasmid, 10 single colonies were selected from the plate and inoculated into 1.5 mL EP tubes, which were then incubated in a shaker at 37°C. Using a sterile pipette tip, the bacterial cells were carefully picked up and added to the plaque identification PCR reaction system. The reaction program was: 98°C, 30 s; 98°C, 10 s; 55°C, 10 s; 72°C, 15 s; 72°C, 5 min, for a total of 35 cycles. The plaque identification PCR reaction system consisted of 9.5 μL Nuclease-free Water, 12.5 μL Magic PCR Mix, 1.0 μL TMV+, 1.0 μL F34880 (456C), and 1.0 μL Template. The primer sequences for plaque identification were TMV+: TTGAGGCAACACAATTACCAAC (SEQ ID NO. 12) and F34880 (456C): GAGTCTGATGATGCACCTGT (SEQ ID NO. 13). After agarose gel electrophoresis analysis of the PCR products, 100 μL of bacterial culture corresponding to 1-3 positive bands was selected for sequencing. The remaining 400 μL of bacterial culture was transferred to LB medium containing 5-10 mL of Kan resistance and cultured with shaking. Correct colonies were screened based on the sequencing results, and their plasmids were extracted. EcoRV restriction enzymes were used for digestion and identification, and the actual fragment size was compared with the theoretical expectation.

[0051] S3. Add 1 μL of the subcellular localization recombinant plasmid to 50 μL of Agrobacterium GV3101 competent cells and mix gently. Transfer to an electroporation cuvette for electroporation. Incubate Agrobacterium GV3101 containing the pBWA(V)H2STMVΩ-McKAT-egfp vector at 25°C for 2 days. Scrape a single colony from a plate using an inoculation loop and inoculate into 10 mL of YEB liquid medium containing the corresponding antibiotic. Activate by shaking at 170 rpm for 1 h; then centrifuge at 4000 rpm for 4 min to collect the cells. Discard the supernatant and resuspend the precipitate in 10 mM MgCl2 buffer supplemented with 120 μM acetylsalicylic acid (AS). Adjust the OD of the bacterial culture. 600 To a concentration of approximately 0.6, select healthy, undamaged tobacco plants with uniform growth. Using a 1mL syringe without a needle, draw up the bacterial solution and inject it into the lower epidermis of the leaves, marking the injection site. Infected tobacco plants are then incubated in a low-light environment for 2 days before fluorescence observation. Temporary slides are prepared from infected tobacco leaves and observed and images are acquired using a laser confocal microscope. Observation parameters: chloroplast autofluorescence, excitation light 640nm, emission light 675nm; green fluorescent protein (GFP), excitation light 488nm, emission light 510nm.

[0052] The results showed that the green fluorescent protein signal of the control group (GFP) was uniformly diffused within the cells, without exhibiting obvious specific subcellular localization characteristics; while the green fluorescent protein signal of the pBWA(V)H2STMV-McKAT-GFP fusion protein was mainly detected in the cytoplasm, overlapping with the fluorescence signal of some granular chloroplasts, and no signal was detected in the cell nucleus, indicating that the McKAT protein is mainly localized in the cytoplasm. Figure 9 ).

[0053] Example 4: McKAT gene function verification (1) Spatiotemporal expression pattern analysis of the McKAT gene The specific steps for testing the relative expression level of the McKAT gene are as follows: RNA extraction, cDNA acquisition, RT-qPCR primer design, and RT-qPCR testing. RNA extraction and cDNA acquisition for different flowering organs at different flowering stages are performed according to the steps in Example 2. RT-qPCR primer design: Primer Premier 6.0 software was used for design. The forward primer for qRT-PCR is KATqpcr-F: CACACCAGGAGCAAGATCAGG (SEQ ID NO.4), and the reverse primer is KATqpcr-R: GCACCATCACTCACTTGGCTAG (SEQ ID NO.5). The internal reference gene is McActin1, whose sequence is shown in SEQ ID NO.14. The forward primer for qRT-PCR is Act-F: ATGGGGTATTTGAGGGTGAGG (SEQ ID NO.15), and the reverse primer is Act-R: AGGCTGGATTTGCTGGTGAT (SEQ ID NO.16). The SuperReal Premix Plus kit was used to prepare the qRT-qPCR reaction system. The qPCR reaction system was as follows: 10 μL of 2×FastReal qPCR PreMix, 0.6 μL of 10 µM forward primer, 0.6 μL of 10 µM reverse primer, 2 μL of cDNA, and 6.8 μL of RNase-free ddH2O. qPCR was performed on a Bio-Rad CFX96 Real-Time PCR system (Hercules, CA, USA) under the following conditions: 95℃ denaturation for 5 s, 60℃ annealing for 10 s, and 72℃ extension for 15 s; a total of 40 cycles were set. Three cDNA samples (biological replicates) were used for each group of samples, and three technical replicates were performed for each cDNA sample. The obtained CT value was used as 2^( The relative expression levels of genes in different floral organs at different flowering stages were calculated using the ΔΔCT method.

[0054] Test results are as follows Figure 4 As shown in B, the McKAT gene expression level was highest in the stamens during the initial flowering stage, 2.02–2.35 times higher than that in the stamens during the bud and full bloom stages, 1.4–3.11 times higher than that in the petals during the three flowering stages, and 3.17–5.03 times higher than that in the pistils during the three flowering stages. Simultaneously, spatiotemporal release analysis of methyl benzoate, a major contributor to the characteristic fragrance of Michelia champaca, also revealed that its release level peaked in the stamens during the initial flowering stage. Figure 4 The C in the gene is 1.25 to 1.66 times the amount released in stamens during the bud and full bloom stages, which is similar to the expression pattern of the McKAT gene.

[0055] The nucleotide sequence information (SEQ ID NO.14) of the internal reference gene McActin1 is as follows:

[0056] (2) Construction of McKAT gene overexpression vector Using the PCR product obtained in Example 2 diluted 100-fold as a template, PCR amplification was performed using overexpression primers KATZT-F:AACACGGGGGACTTTGCAACATGGAGAAAGCGATCGAAAGGCAGAG (SEQ ID NO. 6) and KATZT-R:TGAAGACAGAGCTAGTTACACTATAGAGCATCCTTGGACAGAAGATTGTTG (SEQ ID NO. 7). The PCR amplification reaction system consisted of: 1.0 μL cDNA template, 0.5 μL KATZT-F, 0.5 μL KATZT-R, 2.5 μL 10×PrimeSTAR®Max, and 0.5 μL ddH2O2. The PCR reaction program was: 98℃ for 3 min; 98℃ for 30 s, 60℃ for 30 s, and 72℃ for 60 s (35 cycles); 72℃ for 5 min; and storage at 4℃. An overexpression vector was constructed using enzyme digestion. The pBWA(V)KS expression vector was digested with BsaI / Eco31I and reacted at 37°C for 1 h. The digested vector was then purified using a PCR purification kit, and the resulting product was named pBWA(V)KS-ccDB(D). A recombinant system of the target gene and the vector was then constructed and reacted at 37°C for 30 min. The ligation product was introduced into competent *E. coli* cells using heat shock technology, following the same procedure as for the subcellular localization vector construction method for *E. coli* competent cell transformation. Plaque PCR identification was performed using the same method as for the subcellular localization vector construction. The overexpression vector was constructed using the following enzyme digestion system: Nuclease-free Water 13.0 μL, 10×Buffer 2.0 μL, BsaI / Eco31I 1.0 μL, and pBWA(V)KS-ccDB 4.0 μL. The target gene and vector recombination system consisted of Biorun 2×Easy CloneMix 10.0 μL, rDNAG1 5.0 μL, and pBWA(V)KS-ccDB(D) 5.0 μL. After successful identification, the overexpression vector was added to 50 μL of EHA105 Agrobacterium competent cells and gently mixed. The mixture was then transferred to an electroporation cuvette for electroporation. After transformation, the cells were added to LB liquid medium and thoroughly mixed by pipetting, followed by resuscitation culture. The mixture was then spread onto the surface of LB solid medium, and single colonies were picked for colony PCR identification to screen for positive clones. The resulting colonies were inoculated into antibiotic-resistant medium, and the bacterial culture was collected and preserved for petunia transformation.

[0057] (3) Analysis of overexpression of wild-type and transgenic McKAT petunia flowers The petunia leaf disc transformation method was employed, with the following steps: Leaves of aseptic tissue culture seedlings of petunia 'W115' were rinsed with water and then disinfected sequentially with 75% alcohol and mercuric chloride. The disinfected leaves were then cut into small pieces and transferred to a pre-culture medium, where they were incubated in the dark at 25°C for 2 days. Agrobacterium carrying the McKAT overexpression vector plasmid was initially activated on a resistant medium. After 48 hours of culture, the bacterial cells were collected and transferred to fresh medium for secondary activation. After 24 hours of culture, the bacterial cells were collected and dissolved in 50 μL of 100 mmol / L acetylsyl syringone (AS) until OD200 was reached. 600 =0.4~0.6 for later use. Pick leaves and immerse them in the prepared bacterial solution for 10 minutes. After infection, remove the leaves and blot off excess bacterial solution with sterile filter paper. Then, inoculate the infected leaves onto a symbiotic culture medium and co-culture at 25℃ in the dark for 3 days. Next, transfer to a selective medium and incubate at 25℃ for 16 hours of light / 8 hours of darkness. Once adventitious buds emerge from the leaves, transfer to a seedling growth medium and incubate at 25℃ for 16 hours of light / 8 hours of darkness until seedlings emerge and the leaves reach 2~3 cm in length. Then, transfer to a rooting medium for selection.

[0058] Seven days after being transferred to the screening medium, rooted petunia seedlings were subjected to PCR detection using primers OE-F (sequence CACAGTCGATGAATCCAGAA, SEQ ID NO.8) and OE-R (sequence CCGAGAAAGTATCCATCATG, SEQ ID NO.9). The reaction system consisted of: 10 μL of 2×Taq PCR MasterMix II, 0.5 μL of OE-F, 0.5 μL of OE-R, 1 μL of cDNA, and 8 μL of RNase-Free ddH2O. The reaction conditions were: pre-denaturation at 98℃ for 3 min; denaturation at 94℃ for 30 s; annealing at 60℃ for 30 s; extension at 72℃ for 30 s; 35 cycles; and final extension at 72℃ for 5 min. Lines with correctly positioned and clearly defined electrophoretic bands were used as positive transgenic lines for subsequent metabolomics analysis. The changes in floral fragrance components in overexpressing plants and wild-type plants were analyzed and compared using GC-MS technology. The specific measurement steps are detailed in Example 1, which further verified its potential function in regulating the synthesis of benzene ring-based floral fragrances.

[0059] The results are as follows Figure 10 As shown in Figure A: Compared to the negative control and the water control, the flowers overexpressing the McKAT gene showed a clearly defined band in the correct position, indicating that the McKAT gene was successfully transferred into petunias. The results are as follows... Figure 10As shown in B, C, and D, by comparing the phenotypes of wild-type (WT) and transgenic McKAT petunia (OE-McKAT) plants from seedling hardening and transplantation to flowering and fruiting, it was found that transgenic petunias, apart from having a significantly stronger aroma than wild-type plants, did not show significant differences in other traits. This suggests that overexpression of the McKAT gene may only promote the synthesis of floral fragrance substances in petunias.

[0060] The volatile metabolomes of wild-type and McKAT transgenic petunia flowers were compared and analyzed using HS-SPME-GC-MS technology. Results are as follows: Figure 10 As shown in Figure E: Principal Component Analysis (PCA) and OPLS-DA analysis revealed a significant difference in the volatile metabolites of wild-type and transgenic McKAT petunia flowers. A total of 71 major floral volatile metabolites (OAV>1 and relative content>0.1 μg / g) were detected, including 13 terpenes, 12 benzene / phenylpropanoids, 31 fatty acid derivatives, 14 heterocyclic compounds, and 1 nitrogen-containing compound. Among them, fatty acid derivatives accounted for the largest proportion (43.7%) in wild-type and transgenic McKAT petunia flowers, followed by heterocyclic compounds (19.7%), terpenes (18.3%), benzene / phenylpropanoids (16.9%), and nitrogen- or sulfur-containing compounds (1.4%). More importantly, the total relative content of major volatiles in transgenic flowers was 424.03 μg / g, which was 1.05 times higher than that in wild-type (405.36 μg / g).

[0061] Further analysis revealed 10 differentially expressed metabolites (satisfying VIP>1, Log2|FC|>1) in wild-type and transgenic petunias. Figure 10(As shown in F and G). The levels of nine differentially expressed metabolites were upregulated in the transgenic flowers, including four benzene ring / phenylpropanoid compounds: phenethyl butyrate, hexyl benzoate, 2,3-dimethylphenol, and 3,4-dimethylphenol; three heterocyclic compounds: ethyl isonicotinate, 4-t-Butyl-1-isopropyl-1H-imidazole-2-thiol, and ethyl nicotinate; and two fatty acid derivatives: pseudoinonone and 1-acetyl-2-methylcyclopentene. Among them, three differentially regulated metabolites accounted for more than 20% of the total differentially regulated metabolites, including phenethyl β-butyrate, hexyl benzoate, and 1-acetyl-2-methyl-1-cyclopentene, which were upregulated by 1.16, 7.17, and 2.36 times, respectively; while hexyl benzoate, 2,3-dimethylphenol, and 1-acetyl-2-methyl-1-cyclopentene had the largest upregulation factors, at 7.17, 2.48, and 2.36 times, respectively; and one differentially regulated metabolite was 1,3-dimethylpiperidin-4-one, which is a heterocyclic compound and was downregulated by 1.05 times.

[0062] The results above indicate that overexpression of the McKAT gene significantly promotes the synthesis of benzene ring compounds in petunia flowers, with a particularly significant increase in hexyl benzoate, which uses benzoic acid as a precursor.

[0063] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A McKAT gene that regulates the synthesis of benzene ring-like floral fragrance compounds in Michelia champaca, characterized in that, The nucleotide sequence is shown in SEQ ID NO.

1.

2. A primer pair for amplifying the McKAT gene of claim 1, characterized in that, The sequences of the primer pairs are shown in SEQ ID NO.2 and SEQ ID NO.

3.

3. A real-time PCR primer for detecting the McKAT gene of claim 1, characterized in that, The sequences of the fluorescent quantitative PCR primers are shown in SEQ ID NO.4 and SEQ ID NO.

5.

4. A recombinant vector, characterized in that, It contains the McKAT gene as described in claim 1.

5. A recombinant bacterium comprising the recombinant vector of claim 4.

6. A cell line comprising the recombinant vector of claim 4.

7. The application of the McKAT gene as described in claim 1 in regulating the synthesis of benzene ring-type floral fragrance substances in Michelia violacea.

8. The application of the McKAT gene as described in claim 1 in improving the fragrance quality of plant flowers, characterized in that, The content of benzene ring-type floral fragrance substances, hybrid compound A, and fatty acid derivatives is increased and the content of hybrid compound B is decreased by overexpressing the McKAT gene in plants; the plants include one or more of Michelia champaca and Petunia purpurea.

9. The application according to claim 8, characterized in that, The benzene ring floral fragrance compounds include at least one of β-butyrate, hexyl benzoate, 2,3-dimethylphenol, and 3,4-dimethylphenol; the hybrid compound A includes at least one of isonicotinic acid ethyl ester, 4-tert-butyl-1-isopropyl-1H-imidazol-2-thiol, and nicotinic acid ethyl ester; the fatty acid derivatives include at least one of pseudoionone and 1-acetyl-2-methyl-1-cyclopentene; and the hybrid compound B includes 1,3-dimethyl-4-piperidinone.

10. A method for constructing a transgenic plant with increased content of benzene ring-based aromatic compounds, characterized in that, Using Agrobacterium-mediated transformation, a vector containing the McKAT gene as described in claim 1 is transferred into the plant genome, and transgenic plants are obtained by screening; the plants include one or more of Michelia champaca and Petunia purpurea.

Images